CA-1 - Complete Raw Mutation Data

Full TSV data with all sample columns and abundance information
← Back to Dashboard

Complete Mutations Data

This table shows the complete data from the mutations.tsv file exactly as it appears in the source. Scroll horizontally to see all columns.

Linked/Ubiquitous Position Flagged Sequences Count Abundance Count.1 Abundance.1 Count.2 Abundance.2 Count.3 Abundance.3 Count.4 Abundance.4 Count.5 Abundance.5 Count.6 Abundance.6 Count.7 Abundance.7 Count.8 Abundance.8 Count.9 Abundance.9 Count.10 Abundance.10 Count.11 Abundance.11 Count.12 Abundance.12 Total samples Positives Sum Negatives Sum Total Sum Unnamed: 34 Unnamed: 35 Non-Cryptic Sewershed
SRR26424950 SRR26424955 SRR26425053 SRR26424883 SRR26424952 SRR26424954 SRR26424994 SRR26424995 SRR26425024 SRR26425042 SRR26425064 SRR26425084 SRR26425108 Key
"('2023-09-12', '4000000')" "('2023-09-10', '4000000')" "('2023-09-19', '4000000')" "('2023-09-19', '740000')" "('2023-09-12', '230000')" "('2023-09-12', '740000')" "('2023-09-19', '1500000')" "('2023-09-19', '1500000')" "('2023-09-19', '131000')" "('2023-09-11', '130000')" "('2023-09-19', '230000')" "('2023-09-12', '58496')" "('2023-09-11', '131000')" Cryptic Sewershed
216.0 G216T 3780 0.085 1844 0.022 9 0.001 3.0 0.107 0.001 0.108
linkedubiq 241.0 Delta C241T 9426 0.999 44678 0.998 79451 0.952 10152 0.999 6130 0.998 8504 0.999 30343 0.998 30302 0.998 79202 0.998 12937 0.998 9659 0.998 18123 0.998 82839 0.998 13.0 2.949 9.982 12.931
linked 378.0 RATG13 T378C|(ORF1ab_polyprotein:T113C(V38A))|(ORF1a_polyprotein:T113C(V38A)) 3686 0.046 1.0 0.046 0.0 0.046
linkedubiq 405.0 A405G|(ORF1ab_polyprotein:A140G(K47R))|(ORF1a_polyprotein:A140G(K47R)) 9065 0.999 42555 0.999 87734 0.959 9739 0.999 5799 0.999 8168 0.999 29013 0.999 29052 0.999 75686 0.999 12304 0.999 9387 0.999 17315 0.999 78993 0.999 13.0 2.957 9.99 12.947
529.0 G529T|(ORF1ab_polyprotein:G264T(L88L))|(ORF1a_polyprotein:G264T(L88L)) 11 0.071 2 0.002 2.0 0.073 0.0 0.073
532.0 A532T|(ORF1ab_polyprotein:A267T(V89V))|(ORF1a_polyprotein:A267T(V89V)) 2 0.013 38 0.041 2.0 0.054 0.0 0.054
539.0 C539T|(ORF1ab_polyprotein:C274T(L92F))|(ORF1a_polyprotein:C274T(L92F)) 6 0.039 2 0.002 2.0 0.041 0.0 0.041
569.0 G569A|(ORF1ab_polyprotein:G304A(E102K))|(ORF1a_polyprotein:G304A(E102K)) 2 0.013 37 0.04 2.0 0.053 0.0 0.053
linked 670.0 T670G|(ORF1ab_polyprotein:T405G(S135R))|(ORF1a_polyprotein:T405G(S135R)) 19283 0.998 59578 0.881 106012 0.963 111343 0.998 189023 0.998 68 1.0 54001 0.998 67458 0.998 109105 0.998 52504 0.998 93223 0.998 64408 0.997 73032 0.998 13.0 2.842 9.981 12.823
683.0 C683T|(ORF1ab_polyprotein:C418T(L140L))|(ORF1a_polyprotein:C418T(L140L)) 4697 0.069 1749 0.016 2.0 0.085 0.0 0.085
900.0 C900T|(ORF1ab_polyprotein:C635T(S212L))|(ORF1a_polyprotein:C635T(S212L)) 2447 0.123 4914 0.07 2.0 0.193 0.0 0.193
1067.0 G1067A|(ORF1ab_polyprotein:G802A(G268R))|(ORF1a_polyprotein:G802A(G268R)) 2099 0.088 32 0.011 2.0 0.0989999999999999 0.0 0.0989999999999999
1504.0 T1504C|(ORF1ab_polyprotein:T1239C(Y413Y))|(ORF1a_polyprotein:T1239C(Y413Y)) 24 0.04 13 0.011 2.0 0.051 0.0 0.051
1545.0 C1545T|(ORF1ab_polyprotein:C1280T(A427V))|(ORF1a_polyprotein:C1280T(A427V)) 33 0.055 3 0.003 2.0 0.058 0.0 0.058
2066.0 A2066G|(ORF1ab_polyprotein:A1801G(I601V))|(ORF1a_polyprotein:A1801G(I601V)) 1481 0.076 658 0.021 2.0 0.097 0.0 0.097
linked 2592.0 C2592A|(ORF1ab_polyprotein:C2327A(A776D))|(ORF1a_polyprotein:C2327A(A776D)) 771 0.022 25 0.002 2.0 0.024 0.0 0.024
2672.0 G2672C|(ORF1ab_polyprotein:G2407C(A803P))|(ORF1a_polyprotein:G2407C(A803P)) 2890 0.252 54 0.002 3 0.001 6 0.001 2 0.001 11 0.002 27 0.001 84 0.002 8.0 0.255 0.007 0.262
linkedubiq 2790.0 C2790T|(ORF1ab_polyprotein:C2525T(T842I))|(ORF1a_polyprotein:C2525T(T842I)) 11284 0.984 25371 0.984 2279 0.903 125 1.0 4585 0.983 1937 0.983 5010 0.987 544 0.993 107 0.982 20447 0.987 38855 0.984 11.0 2.871 7.899 10.77
2836.0 C2836T|(ORF1ab_polyprotein:C2571T(C857C))|(ORF1a_polyprotein:C2571T(C857C)) 763 0.031 22 0.009 2.0 0.04 0.0 0.04
linked 2900.0 G2900A|(ORF1ab_polyprotein:G2635A(V879I))|(ORF1a_polyprotein:G2635A(V879I)) 760 0.029 21 0.002 2.0 0.031 0.0 0.031
ubiq 3037.0 "RATG13,Delta" C3037T|(ORF1ab_polyprotein:C2772T(F924F))|(ORF1a_polyprotein:C2772T(F924F)) 1400 0.992 1512 0.986 11563 0.99 6 1.0 1787 0.985 6780 0.988 3702 0.991 13163 0.99 2748 0.99 6608 0.989 10.0 2.968 6.933 9.901
ubiq 4184.0 G4184A|(ORF1ab_polyprotein:G3919A(G1307S))|(ORF1a_polyprotein:G3919A(G1307S)) 3528 0.99 5422 0.99 21280 0.99 30819 0.99 43504 0.991 58246 0.99 42635 0.795 18942 0.99 35717 0.99 67183 0.991 29286 0.991 8821 0.991 12.0 2.96999999999999 8.719 11.689
ubiq 4321.0 C4321T|(ORF1ab_polyprotein:C4056T(A1352A))|(ORF1a_polyprotein:C4056T(A1352A)) 3680 0.996 5660 0.995 22184 0.996 32204 0.995 3 0.75 22546 0.494 60910 0.996 44555 0.799 19727 0.996 37487 0.995 70035 0.996 30672 0.996 9199 0.995 13.0 2.987 9.012 11.999
4535.0 T4535C|(ORF1ab_polyprotein:T4270C(F1424L))|(ORF1a_polyprotein:T4270C(F1424L)) 929 0.042 631 0.031 2.0 0.073 0.0 0.073
4897.0 RATG13 C4897T|(ORF1ab_polyprotein:C4632T(F1544F))|(ORF1a_polyprotein:C4632T(F1544F)) 332 0.024 1001 0.013 2.0 0.037 0.0 0.037
5391.0 A5391G|(ORF1ab_polyprotein:AAC5125-5127AGG(N1709R))|(ORF1a_polyprotein:AAC5125-5127AGG(N1709R)) 148 0.028 1116 0.038 2.0 0.066 0.0 0.066
5391.0 A5391G|(ORF1ab_polyprotein:AAC5125-5127AGA(N1709R))|(ORF1a_polyprotein:AAC5125-5127AGA(N1709R)) 109 0.02 865 0.082 3307 0.112 3.0 0.214 0.0 0.214
5392.0 C5392G|(ORF1ab_polyprotein:AAC5125-5127AGG(N1709R))|(ORF1a_polyprotein:AAC5125-5127AGG(N1709R)) 148 0.028 1116 0.038 2.0 0.066 0.0 0.066
5392.0 C5392A|(ORF1ab_polyprotein:AAC5125-5127AGA(N1709R))|(ORF1a_polyprotein:AAC5125-5127AGA(N1709R)) 109 0.02 865 0.082 3307 0.112 3.0 0.214 0.0 0.214
5724.0 C5724T|(ORF1ab_polyprotein:C5459T(T1820I))|(ORF1a_polyprotein:C5459T(T1820I)) 4727 0.118 1049 0.023 2.0 0.141 0.0 0.141
5839.0 RATG13 A5839G|(ORF1ab_polyprotein:A5574G(E1858E))|(ORF1a_polyprotein:A5574G(E1858E)) 5951 0.154 4549 0.104 2.0 0.258 0.0 0.258
5907.0 RATG13 C5907T|(ORF1ab_polyprotein:C5642T(T1881I))|(ORF1a_polyprotein:C5642T(T1881I)) 4540 0.089 1092 0.019 2.0 0.108 0.0 0.108
6273.0 A6273G|(ORF1ab_polyprotein:A6008G(Y2003C))|(ORF1a_polyprotein:A6008G(Y2003C)) 1415 0.069 3085 0.048 2.0 0.117 0.0 0.117
6402.0 C6402T|(ORF1ab_polyprotein:C6137T(P2046L))|(ORF1a_polyprotein:C6137T(P2046L)) 1468 0.165 3144 0.091 2.0 0.256 0.0 0.256
linked 6541.0 C6541T|(ORF1ab_polyprotein:C6276T(H2092H))|(ORF1a_polyprotein:C6276T(H2092H)) 1414 0.129 1923 0.081 4793 0.128 4292 0.256 7839 0.6 3039 0.071 3003 0.1 996 0.046 8.0 0.338 1.073 1.411
linked 6734.0 G6734T|(ORF1ab_polyprotein:G6469T(V2157F))|(ORF1a_polyprotein:G6469T(V2157F)) 7 0.003 201 0.095 180 0.052 12 0.001 12 0.002 8 0.001 5 0.002 20 0.002 18 0.002 4 0.002 10.0 0.15 0.012 0.162
6866.0 A6866C|(ORF1ab_polyprotein:A6601C(N2201H))|(ORF1a_polyprotein:A6601C(N2201H)) 653 0.044 191 0.007 1660 0.067 3.0 0.118 0.0 0.118
7124.0 C7124T|(ORF1ab_polyprotein:C6859T(P2287S))|(ORF1a_polyprotein:C6859T(P2287S)) 659 0.052 1262 0.07 2.0 0.122 0.0 0.122
7162.0 RATG13 C7162T|(ORF1ab_polyprotein:C6897T(D2299D))|(ORF1a_polyprotein:C6897T(D2299D)) 422 0.034 239 0.012 2.0 0.046 0.0 0.046
7840.0 C7840T|(ORF1ab_polyprotein:C7575T(D2525D))|(ORF1a_polyprotein:C7575T(D2525D)) 1589 0.054 657 0.015 2.0 0.069 0.0 0.069
8017.0 G8017T|(ORF1ab_polyprotein:G7752T(A2584A))|(ORF1a_polyprotein:G7752T(A2584A)) 1280 0.074 2745 0.066 2.0 0.14 0.0 0.14
9053.0 G9053T|(ORF1ab_polyprotein:G8788T(V2930L))|(ORF1a_polyprotein:G8788T(V2930L)) 108 0.042 209 0.021 1032 0.073 3.0 0.136 0.0 0.136
9077.0 G9077A|(ORF1ab_polyprotein:G8812A(V2938I))|(ORF1a_polyprotein:G8812A(V2938I)) 107 0.042 207 0.021 1027 0.072 3.0 0.135 0.0 0.135
9141.0 G9141A|(ORF1ab_polyprotein:G8876A(G2959D))|(ORF1a_polyprotein:G8876A(G2959D)) 112 0.107 213 0.117 1099 0.125 3.0 0.349 0.0 0.349
ubiq 9424.0 A9424G|(ORF1ab_polyprotein:A9159G(V3053V))|(ORF1a_polyprotein:A9159G(V3053V)) 2141 0.996 4369 0.996 9873 0.912 6929 0.996 11919 0.997 3827 0.997 575 0.991 9131 0.992 6058 0.998 5064 0.998 6407 0.997 5323 0.995 12.0 2.904 8.961 11.865
ubiq 9534.0 C9534T|(ORF1ab_polyprotein:C9269T(T3090I))|(ORF1a_polyprotein:C9269T(T3090I)) 2146 0.999 4364 0.997 9855 0.911 6937 0.997 11919 0.997 3834 0.998 578 1.0 9156 0.997 6050 0.998 5069 0.998 6415 0.998 5336 0.997 12.0 2.907 8.98 11.887
ubiq 9866.0 C9866T|(ORF1ab_polyprotein:C9601T(L3201F))|(ORF1a_polyprotein:C9601T(L3201F)) 17025 0.997 19541 0.997 12392 0.944 23700 0.997 13191 0.997 36564 0.997 33404 0.995 15282 0.973 34330 0.996 21809 0.998 36024 0.996 12582 0.998 12.0 2.93799999999999 8.947 11.8849999999999
ubiq 10029.0 C10029T|(ORF1ab_polyprotein:C9764T(T3255I))|(ORF1a_polyprotein:C9764T(T3255I)) 273 1.0 601 0.992 3153 0.992 1031 0.987 411 0.99 929 0.988 355 0.997 3118 0.99 1516 0.99 1133 0.993 1360 0.986 11.0 2.984 7.921 10.905
ubiq 10447.0 RATG13 G10447A|(ORF1ab_polyprotein:G10182A(R3394R))|(ORF1a_polyprotein:G10182A(R3394R)) 4342 0.996 7317 0.997 59760 0.997 47598 0.996 2 0.667 24930 0.996 37444 0.996 13858 0.998 52812 0.996 60350 0.997 4175 0.996 10662 0.996 12.0 2.99 8.638 11.628
ubiq 10449.0 C10449A|(ORF1ab_polyprotein:C10184A(P3395H))|(ORF1a_polyprotein:C10184A(P3395H)) 4339 0.995 7303 0.995 59687 0.996 47481 0.994 2 0.667 24899 0.995 37394 0.995 13816 0.995 52789 0.996 60261 0.995 4174 0.995 10650 0.995 12.0 2.98599999999999 8.627 11.613
10966.0 T10966A|(ORF1ab_polyprotein:T10701A(T3567T))|(ORF1a_polyprotein:T10701A(T3567T)) 222 0.033 552 0.041 2.0 0.074 0.0 0.074
11081.0 RATG13 T11081G|(ORF1ab_polyprotein:T10816G(L3606V))|(ORF1a_polyprotein:T10816G(L3606V)) 215 0.032 562 0.042 2.0 0.074 0.0 0.074
11138.0 G11138C|(ORF1ab_polyprotein:G10873C(A3625P))|(ORF1a_polyprotein:G10873C(A3625P)) 3 0.001 426 0.068 2.0 0.069 0.0 0.069
11201.0 A11201G|(ORF1ab_polyprotein:A10936G(T3646A))|(ORF1a_polyprotein:A10936G(T3646A)) 1314 0.08 2082 0.04 2.0 0.12 0.0 0.12
11332.0 A11332G|(ORF1ab_polyprotein:A11067G(V3689V))|(ORF1a_polyprotein:A11067G(V3689V)) 1181 0.113 1837 0.046 2.0 0.159 0.0 0.159
11779.0 RATG13 C11779T|(ORF1ab_polyprotein:C11514T(F3838F))|(ORF1a_polyprotein:C11514T(F3838F)) 49 0.056 3 0.008 2.0 0.064 0.0 0.064
12596.0 C12596T|(ORF1ab_polyprotein:C12331T(L4111F))|(ORF1a_polyprotein:C12331T(L4111F)) 53 0.046 222 0.026 2.0 0.072 0.0 0.072
12652.0 A12652G|(ORF1ab_polyprotein:A12387G(T4129T))|(ORF1a_polyprotein:A12387G(T4129T)) 3 0.004 132 0.115 2 0.001 2 0.002 4.0 0.119 0.003 0.122
12706.0 T12706A|(ORF1ab_polyprotein:T12441A(V4147V))|(ORF1a_polyprotein:T12441A(V4147V)) 10 0.014 132 0.115 2 0.001 2 0.002 4.0 0.129 0.003 0.132
ubiq 12880.0 C12880T|(ORF1ab_polyprotein:C12615T(I4205I))|(ORF1a_polyprotein:C12615T(I4205I)) 6187 0.996 7953 0.995 9956 0.956 883 0.997 1942 0.996 28392 0.997 16141 0.771 6577 0.997 13202 0.995 4697 0.996 10913 0.996 11.0 2.947 7.745 10.692
13694.0 C13694A|(ORF1ab_polyprotein:C13430A(T4477K)) 6212 0.083 3397 0.039 2.0 0.122 0.0 0.122
14044.0 G14044T|(ORF1ab_polyprotein:G13780T(V4594F)) 3 0.002 1550 0.052 13 0.002 3.0 0.054 0.002 0.056
14067.0 T14067C|(ORF1ab_polyprotein:T13803C(N4601N)) 1006 0.166 690 0.023 2.0 0.189 0.0 0.189
ubiq 14408.0 Delta C14408T|(ORF1ab_polyprotein:C14144T(P4715L)) 32568 0.969 32821 0.971 46717 0.973 35172 0.974 48539 0.97 13711 0.972 32847 0.971 40864 0.973 857 0.998 61490 0.973 13375 0.969 33169 0.955 12.0 2.913 8.75499999999999 11.668
linkedubiq 15451.0 G15451A|(ORF1ab_polyprotein:G15187A(G5063S)) 18244 0.994 23928 0.994 31179 0.996 7028 0.995 4845 0.995 8214 0.996 13631 0.994 26463 0.988 5991 0.995 5463 0.996 2782 0.995 30287 0.993 12.0 2.984 8.947 11.931
15540.0 RATG13 C15540T|(ORF1ab_polyprotein:C15276T(V5092V)) 2341 0.127 3247 0.135 444 0.014 3.0 0.276 0.0 0.276
ubiq 15939.0 T15939C|(ORF1ab_polyprotein:T15675C(D5225D)) 2610 0.944 6963 0.951 11748 0.994 7880 0.995 3968 0.996 6503 0.995 5340 0.994 9859 0.993 6577 0.996 97 1.0 1605 0.994 9186 0.989 12.0 2.889 8.952 11.841
16076.0 A16076G|(ORF1ab_polyprotein:A15812G(D5271G)) 2968 0.054 1126 0.023 2.0 0.077 0.0 0.077
16135.0 A16135C|(ORF1ab_polyprotein:A15871C(M5291L)) 3084 0.054 1184 0.023 2.0 0.077 0.0 0.077
16290.0 T16290G|(ORF1ab_polyprotein:T16026G(A5342A)) 3083 0.053 1176 0.022 2.0 0.075 0.0 0.075
16466.0 C16466T|(ORF1ab_polyprotein:C16202T(P5401L)) 16 0.037 55 0.06 2.0 0.097 0.0 0.097
17236.0 A17236G|(ORF1ab_polyprotein:A16972G(I5658V)) 302 0.012 1822 0.043 1543 0.024 3.0 0.079 0.0 0.079
ubiq 17410.0 C17410T|(ORF1ab_polyprotein:C17146T(R5716C)) 15512 0.996 18269 0.973 30099 0.949 26223 0.997 132966 0.997 7918 0.998 15901 0.997 40423 0.997 31711 0.997 42781 0.997 13481 0.997 16871 0.997 19062 0.996 13.0 2.918 9.97 12.888
17674.0 A17674G|(ORF1ab_polyprotein:A17410G(I5804V)) 5112 0.049 1488 0.017 2.0 0.066 0.0 0.066
17805.0 A17805T|(ORF1ab_polyprotein:A17541T(S5847S)) 1960 0.02 2985 0.035 2824 0.034 3.0 0.089 0.0 0.089
17849.0 G17849T|(ORF1ab_polyprotein:G17585T(G5862V)) 5475 0.053 1462 0.015 2.0 0.068 0.0 0.068
linkedubiq 17859.0 T17859C|(ORF1ab_polyprotein:T17595C(Y5865Y)) 101021 0.979 87151 0.964 90614 0.954 224313 0.998 161541 0.998 123212 0.998 109455 0.925 72882 0.996 100494 0.998 105134 0.998 67688 0.998 124526 0.998 76259 0.998 13.0 2.897 9.905 12.802
linkedubiq 18163.0 A18163G|(ORF1ab_polyprotein:A17899G(I5967V)) 4323 0.998 5988 0.943 18398 0.961 16233 0.999 5460 0.999 12096 0.998 10168 0.999 15663 0.979 6472 0.998 5620 0.999 9149 0.999 11.0 2.902 7.97 10.872
18395.0 C18395T|(ORF1ab_polyprotein:C18131T(A6044V)) 88 0.078 236 0.032 2.0 0.11 0.0 0.11
18412.0 G18412T|(ORF1ab_polyprotein:G18148T(V6050F)) 68 0.06 5 0.002 4 0.001 5 0.001 4.0 0.062 0.002 0.064
19255.0 C19255T|(ORF1ab_polyprotein:C18991T(L6331L)) 217 0.019 294 0.017 2.0 0.036 0.0 0.036
linkedubiq 19326.0 A19326G|(ORF1ab_polyprotein:A19062G(P6354P)) 4575 0.996 11629 0.996 16535 0.947 7722 0.996 16132 0.997 14038 0.995 15476 0.997 10778 0.997 22207 0.996 32013 0.997 8692 0.875 9845 0.997 12.0 2.939 8.847 11.786
linkedubiq 19955.0 C19955T|(ORF1ab_polyprotein:C19691T(T6564I)) 48272 0.995 40868 0.944 10283 0.921 1941 0.994 2 1.0 1094 0.997 44606 0.995 29338 0.996 14815 0.995 1017 0.985 2173 0.996 40271 0.995 44289 0.995 13.0 2.86 9.948 12.808
linkedubiq 20055.0 A20055G|(ORF1ab_polyprotein:A19791G(E6597E)) 48828 0.997 45337 0.944 11868 0.921 3225 0.969 3508 0.958 44331 0.996 28473 0.997 15787 0.99 3197 0.97 1712 0.814 43061 0.996 46503 0.997 12.0 2.862 8.687 11.549
20060.0 G20060T|(ORF1ab_polyprotein:G19796T(S6599I)) 2564 0.052 726 0.056 2.0 0.108 0.0 0.108
20148.0 C20148T|(ORF1ab_polyprotein:C19884T(F6628F)) 592 0.081 46 0.02 2.0 0.101 0.0 0.101
20302.0 G20302A|(ORF1ab_polyprotein:G20038A(E6680K)) 502 0.069 45 0.02 2.0 0.089 0.0 0.089
20346.0 T20346C|(ORF1ab_polyprotein:T20082C(H6694H)) 488 0.069 43 0.02 2.0 0.089 0.0 0.089
20405.0 C20405A|(ORF1ab_polyprotein:C20141A(P6714H)) 499 0.068 240 0.063 2.0 0.131 0.0 0.131
linkedubiq 21618.0 C21618T|(surface_glycoprotein:C56T(T19I)) 67228 0.998 67445 0.936 48481 0.987 107679 0.998 45046 0.998 66684 0.998 58038 0.998 50906 0.997 20819 0.998 141317 0.998 110509 0.998 55910 0.998 12.0 2.921 8.981 11.902
linkedubiq 21633.0 TACCCCCTG21633-21641del|(surface_glycoprotein:TTACCCCCTGCA70-81TCAdel(LPPA24-27Sdel)) 66272 0.998 68270 0.961 47708 0.987 103905 0.998 44669 0.998 66014 0.998 57051 0.998 50121 0.995 20778 0.997 137235 0.998 108554 0.998 55154 0.998 12.0 2.94599999999999 8.978 11.924
21792.0 A21792G|(surface_glycoprotein:A230G(K77R)) 1855 0.044 1597 0.035 2.0 0.079 0.0 0.079
linkedubiq 21810.0 T21810C|(surface_glycoprotein:T248C(V83A)) 41912 0.988 45129 0.989 27705 0.966 35812 0.989 52093 0.988 32272 0.989 34782 0.989 20417 0.989 29791 0.989 47822 0.988 36546 0.988 11.0 2.943 7.909 10.852
ubiq 21987.0 G21987A|(surface_glycoprotein:G425A(G142D)) 26212 0.996 42369 0.975 16195 0.977 87522 0.995 2 0.5 18382 0.995 24820 0.995 60468 0.995 16359 0.986 55275 0.996 63783 0.995 48926 0.994 14851 0.994 13.0 2.948 9.445 12.393
21987.0 GTGTTT21987-21992del|(surface_glycoprotein:GGTGTTTAT424-432GATdel(GVY142-144Ddel)) 892 0.021 292 0.018 2.0 0.039 0.0 0.039
ubiq 21991.0 TTA21991-21993del|(surface_glycoprotein:GTTTAT427-432GTTdel(VY143-144Vdel)) 26164 0.994 41358 0.952 15906 0.96 87329 0.993 3 0.75 18353 0.994 24774 0.993 60330 0.993 16326 0.984 55187 0.994 63647 0.993 48709 0.99 14059 0.941 13.0 2.90599999999999 9.625 12.5309999999999
21995.0 T21995G|(surface_glycoprotein:T433G(Y145D)) 901 0.021 292 0.018 2.0 0.039 0.0 0.039
22029.0 Delta AGTTCA22029-22034del|(surface_glycoprotein:GAGTTCAGA466-474GGAdel(EFR156-158Gdel)) 921 0.021 287 0.017 2.0 0.038 0.0 0.038
ubiq 22109.0 C22109G|(surface_glycoprotein:C547G(Q183E)) 26231 0.995 42305 0.973 16232 0.977 87512 0.994 4 1.0 18372 0.994 24817 0.994 60437 0.994 16544 0.994 55270 0.995 63820 0.995 48888 0.993 14884 0.994 13.0 2.945 9.947 12.892
ubiq 22200.0 T22200A|(surface_glycoprotein:T638A(V213E)) 37743 0.99 62591 0.98 38927 0.965 113411 0.997 174786 0.998 100336 0.998 81379 0.998 112325 0.997 37803 0.98 83514 0.998 141694 0.998 108754 0.997 29593 0.995 13.0 2.935 9.956 12.891
22616.0 G22616C|(surface_glycoprotein:G1054C(A352P)) 3491 0.096 46 0.001 11 0.001 5 0.001 7 0.001 21 0.001 6.0 0.097 0.004 0.101
22812.0 A22812C|(surface_glycoprotein:A1250C(K417T)) 6423 0.094 1016 0.039 2.0 0.133 0.0 0.133
22910.0 A22910G|(surface_glycoprotein:A1348G(N450D)) 1553 0.072 2741 0.097 912 0.038 3.0 0.207 0.0 0.207
22917.0 T22917A|(surface_glycoprotein:T1355A(L452Q)) 1557 0.072 2744 0.097 909 0.038 3.0 0.207 0.0 0.207
ubiq 22992.0 G22992A|(surface_glycoprotein:G1430A(S477N)) 21495 0.996 25336 0.899 23268 0.961 18707 0.995 2748 0.99 46253 0.995 19001 0.996 18450 0.996 2 1.0 65187 0.995 37463 0.996 19110 0.995 12.0 2.856 8.958 11.814
22994.0 A22994C|(surface_glycoprotein:ACA1432-1434CAA(T478Q)) 2723 0.097 864 0.036 2.0 0.133 0.0 0.133
22995.0 "RATG13,Delta" C22995A|(surface_glycoprotein:ACA1432-1434CAA(T478Q)) 2723 0.097 864 0.036 2.0 0.133 0.0 0.133
23014.0 A23014C|(surface_glycoprotein:A1452C(E484D)) 2738 0.097 473 0.02 2.0 0.117 0.0 0.117
23015.0 G23015A|(surface_glycoprotein:G1453A(G485S)) 2732 0.097 859 0.035 2.0 0.132 0.0 0.132
23039.0 C23039A|(surface_glycoprotein:C1477A(Q493K)) 1561 0.072 387 0.016 3 0.001 3.0 0.088 0.001 0.089
23040.0 A23040G|(surface_glycoprotein:A1478G(Q493R)) 2693 0.096 473 0.02 2.0 0.116 0.0 0.116
23054.0 RATG13 C23054T|(surface_glycoprotein:CAA1492-1494TAC(Q498Y)) 2626 0.097 816 0.035 2.0 0.132 0.0 0.132
23056.0 RATG13 A23056C|(surface_glycoprotein:CAA1492-1494TAC(Q498Y)) 2626 0.097 816 0.035 2.0 0.132 0.0 0.132
ubiq 23063.0 A23063T|(surface_glycoprotein:A1501T(N501Y)) 20778 0.998 24514 0.902 22490 0.964 18042 0.998 2659 0.998 44677 0.999 18374 0.999 17854 0.999 62589 0.998 36305 0.998 18506 0.998 11.0 2.864 7.987 10.8509999999999
23064.0 A23064G|(surface_glycoprotein:A1502G(N501S)) 2629 0.097 455 0.019 2.0 0.116 0.0 0.116
23198.0 T23198C|(surface_glycoprotein:T1636C(L546L)) 572 0.019 2068 0.029 2.0 0.048 0.0 0.048
linked 23280.0 C23280T|(surface_glycoprotein:C1718T(T573I)) 470 0.01 9892 0.11 4433 0.047 3488 0.035 550 0.005 5985 0.076 6771 0.079 7.0 0.167 0.195 0.362
linkedubiq 23403.0 Delta A23403G|(surface_glycoprotein:A1841G(D614G)) 44861 0.998 87893 0.997 91480 0.998 66021 0.998 93352 0.998 68977 0.998 79370 0.998 97137 0.998 112943 0.998 30375 0.998 96306 0.998 76743 0.997 85032 0.997 13.0 2.993 9.978 12.971
23470.0 RATG13 T23470C|(surface_glycoprotein:T1908C(Y636Y)) 2984 0.034 415 0.005 2.0 0.039 0.0 0.039
linkedubiq 23525.0 C23525T|(surface_glycoprotein:C1963T(H655Y)) 15539 0.994 24256 0.978 21508 0.996 1489 0.998 2509 0.993 21913 0.995 11836 0.994 31597 0.995 2520 0.993 16605 0.928 31495 0.994 11.0 2.968 7.89 10.858
23604.0 Delta C23604G|(surface_glycoprotein:C2042G(P681R)) 3377 0.067 7078 0.101 3854 0.071 3.0 0.239 0.0 0.239
24044.0 C24044T|(surface_glycoprotein:C2482T(L828F)) 5726 0.257 256 0.036 2.0 0.293 0.0 0.293
24194.0 T24194C|(surface_glycoprotein:T2632C(L878L)) 1085 0.05 23 0.003 2.0 0.053 0.0 0.053
24208.0 C24208T|(surface_glycoprotein:C2646T(I882I)) 5474 0.252 290 0.034 2.0 0.286 0.0 0.286
24374.0 C24374T|(surface_glycoprotein:C2812T(L938F)) 8 0.066 42 0.097 32 0.022 3.0 0.185 0.0 0.185
24410.0 Delta G24410A|(surface_glycoprotein:G2848A(D950N)) 9 0.074 42 0.097 77 0.052 3.0 0.223 0.0 0.223
linked 24469.0 T24469A|(surface_glycoprotein:T2907A(N969K)) 7399 0.998 10063 0.839 31040 0.955 13661 0.998 42146 0.998 23960 0.999 13400 0.998 28047 0.998 36506 0.998 23493 0.998 52355 0.998 10990 0.998 21162 0.995 13.0 2.792 9.978 12.77
24499.0 T24499C|(surface_glycoprotein:T2937C(D979D)) 8 0.001 1923 0.16 946 0.029 3.0 0.19 0.0 0.19
24644.0 A24644-24644del|(surface_glycoprotein:3082-3082del(1028fs)) 274 0.036 682 0.056 2.0 0.092 0.0 0.092
25020.0 A25020C|(surface_glycoprotein:A3458C(D1153A)) 2328 0.029 5604 0.091 1496 0.078 3.0 0.198 0.0 0.198
25088.0 G25088T|(surface_glycoprotein:G3526T(V1176F)) 2327 0.03 5541 0.091 1800 0.079 3.0 0.2 0.0 0.2
25121.0 A25121G|(surface_glycoprotein:A3559G(N1187D)) 2200 0.028 5209 0.086 1735 0.076 3.0 0.19 0.0 0.19
25162.0 C25162A|(surface_glycoprotein:C3600A(L1200L)) 40 0.036 361 0.071 4 0.002 6 0.001 2 0.001 3 0.001 6.0 0.106999999999999 0.005 0.111999999999999
linked 25163.0 C25163A|(surface_glycoprotein:C3601A(Q1201K)) 4 0.003 45 0.041 387 0.076 8 0.005 32 0.005 10 0.003 9 0.002 13 0.003 29 0.006 25 0.004 3 0.002 12 0.006 12.0 0.12 0.036 0.156
linkedubiq 25416.0 C25416T|(ORF3a_protein:C24T(F8F)) 14571 0.999 35036 0.998 46819 0.904 67237 0.994 47357 0.989 56755 0.999 38602 0.999 50789 0.999 58670 0.999 5931 0.998 49137 0.999 36402 0.999 12.0 2.901 8.975 11.876
25420.0 RATG13 A25420C|(ORF3a_protein:A28C(I10L)) 39 0.001 3790 0.073 2.0 0.074 0.0 0.074
25471.0 G25471T|(ORF3a_protein:G79T(D27Y)) 832 0.061 911 0.019 2.0 0.08 0.0 0.08
linkedubiq 25584.0 C25584T|(ORF3a_protein:C192T(T64T)) 13983 0.985 34996 0.986 43803 0.891 68153 0.987 3 1.0 44001 0.986 55732 0.985 36250 0.987 47991 0.986 56042 0.986 49212 0.987 35152 0.986 12.0 2.862 8.89 11.752
25682.0 T25682C|(ORF3a_protein:T290C(V97A)) 36 0.001 4786 0.089 2.0 0.09 0.0 0.09
25937.0 A25937G|(ORF3a_protein:A545G(H182R)) 34 0.036 391 0.056 2.0 0.092 0.0 0.092
25991.0 G25991A|(ORF3a_protein:G599A(C200Y)) 34 0.037 386 0.057 2.0 0.094 0.0 0.094
linked 26030.0 A26030T|(ORF3a_protein:A638T(Q213L)) 35 0.004 373 0.018 2.0 0.022 0.0 0.022
linked 26035.0 T26035A|(ORF3a_protein:T643A(Y215N)) 12 0.001 42 0.005 435 0.021 64 0.006 52 0.004 62 0.004 87 0.006 63 0.003 43 0.005 39 0.005 19 0.001 11.0 0.027 0.034 0.061
ubiq 26060.0 C26060T|(ORF3a_protein:C668T(T223I)) 8165 0.99 8836 0.982 18639 0.892 8784 0.829 8828 0.728 16252 0.921 12448 0.862 21832 0.919 7510 0.823 6633 0.8 12396 0.978 20246 0.992 12.0 2.864 7.852 10.716
ubiq 26270.0 C26270T|(envelope_protein:C26T(T9I)) 8146 0.987 8365 0.99 14863 0.99 3869 0.946 4409 0.991 10279 0.986 5883 0.989 17707 0.989 3697 0.991 2920 0.991 11528 0.987 20178 0.987 12.0 2.967 8.857 11.824
ubiq 26275.0 A26275G|(envelope_protein:A31G(T11A)) 8191 0.993 8381 0.992 14901 0.992 4058 0.992 4417 0.993 10332 0.992 5897 0.991 17774 0.993 3704 0.993 2923 0.992 11557 0.99 20262 0.991 12.0 2.977 8.927 11.904
26464.0 C26464T|(envelope_protein:C220T(L74L)) 515 0.157 872 0.068 2.0 0.225 0.0 0.225
26483.0 T26483C 2 0.002 518 0.157 629 0.049 3.0 0.208 0.0 0.208
26527.0 C26527A|(membrane_glycoprotein:C5A(A2E)) 2 0.002 518 0.157 897 0.07 59 0.001 27 0.001 30 0.001 80 0.001 61 0.001 8.0 0.229 0.005 0.234
26530.0 A26530C|(membrane_glycoprotein:A8C(D3A)) 511 0.155 630 0.049 2.0 0.204 0.0 0.204
26552.0 T26552C|(membrane_glycoprotein:T30C(V10V)) 517 0.157 897 0.07 2.0 0.227 0.0 0.227
linked 26621.0 T26621C|(membrane_glycoprotein:T99C(C33C)) 518 0.008 663 0.008 378 0.004 3.0 0.016 0.004 0.02
ubiq 26709.0 G26709A|(membrane_glycoprotein:G187A(A63T)) 31448 0.998 60358 0.971 77233 0.982 96846 0.993 82962 0.997 80322 0.994 56044 0.994 89932 0.994 83677 0.991 100292 0.991 107725 0.993 49864 0.995 44409 0.996 13.0 2.951 9.938 12.889
ubiq 26858.0 C26858T|(membrane_glycoprotein:C336T(F112F)) 31388 0.998 59470 0.979 66383 0.996 47776 0.998 85971 0.998 32106 0.998 34956 0.998 67366 0.998 75531 0.998 31813 0.998 59791 0.998 36614 0.865 42304 0.997 13.0 2.973 9.846 12.8189999999999
27143.0 C27143T|(membrane_glycoprotein:C621T(N207N)) 1210 0.036 475 0.02 2.0 0.0559999999999999 0.0 0.0559999999999999
linkedubiq 27259.0 A27259C|(ORF6_protein:A58C(R20R)) 61912 0.997 81578 0.952 32101 0.931 39028 0.997 2 1.0 51845 0.997 68969 0.997 79328 0.996 37799 0.997 53472 0.997 70747 0.997 111533 0.997 42196 0.995 13.0 2.88 9.97 12.85
27286.0 C27286A|(ORF6_protein:C85A(L29I)) 2841 0.033 316 0.009 2.0 0.042 0.0 0.042
27291.0 T27291C|(ORF6_protein:T90C(D30D)) 3841 0.045 2222 0.065 2.0 0.11 0.0 0.11
linkedubiq 27382.0 G27382C|(ORF6_protein:GAT181-183CTC(D61L)) 30437 0.985 40804 0.946 9390 0.928 27217 0.799 29360 0.798 33365 0.985 44254 0.986 11495 0.985 38859 0.987 47098 0.986 60465 0.986 13778 0.977 12.0 2.859 8.489 11.348
linkedubiq 27383.0 A27383T|(ORF6_protein:GAT181-183CTC(D61L)) 30437 0.985 40804 0.946 9390 0.928 27217 0.799 29360 0.798 33365 0.985 44254 0.986 11495 0.985 38859 0.987 47098 0.986 60465 0.986 13778 0.977 12.0 2.859 8.489 11.348
linkedubiq 27384.0 T27384C|(ORF6_protein:GAT181-183CTC(D61L)) 30437 0.985 40804 0.946 9390 0.928 27217 0.799 29360 0.798 33365 0.985 44254 0.986 11495 0.985 38859 0.987 47098 0.986 60465 0.986 13778 0.977 12.0 2.859 8.489 11.348
27434.0 C27434T|(ORF7a_protein:C41T(T14I)) 1044 0.034 120 0.012 2.0 0.046 0.0 0.046
27459.0 G27459T|(ORF7a_protein:G66T(E22D)) 1859 0.043 534 0.053 2.0 0.096 0.0 0.096
27524.0 C27524T|(ORF7a_protein:C131T(S44L)) 706 0.024 1132 0.027 131 0.014 3.0 0.065 0.0 0.065
27638.0 Delta T27638C|(ORF7a_protein:T245C(V82A)) 2440 0.066 524 0.012 2.0 0.078 0.0 0.078
27752.0 Delta C27752T|(ORF7a_protein:C359T(T120I)) 6651 0.173 1477 0.033 2.0 0.206 0.0 0.206
27847.0 C27847T|(ORF7b:C92T(S31L)) 2479 0.039 506 0.009 2.0 0.048 0.0 0.048
27874.0 C27874T|(ORF7b:C119T(T40I)) 8431 0.132 1856 0.032 422 0.006 3.0 0.164 0.006 0.17
linked 27877.0 G27877T|(ORF7b:G122T(C41F)) 2969 0.046 614 0.011 3559 0.041 3.0 0.0569999999999999 0.041 0.098
27893.0 C27893T 5523 0.086 1837 0.031 2.0 0.116999999999999 0.0 0.116999999999999
linked 27915.0 G27915T|(ORF8_protein:G22T(G8*)) 34927 0.942 53607 0.836 52633 0.905 39908 0.997 72745 0.998 64576 0.973 44823 0.656 66552 0.948 42272 0.997 91966 0.997 66971 0.779 55734 0.897 12.0 2.683 8.242 10.925
28081.0 A28081G|(ORF8_protein:A188G(D63G)) 625 0.036 582 0.02 2.0 0.0559999999999999 0.0 0.0559999999999999
28248.0 GATTTC28248-28253del|(ORF8_protein:355-360del(DF119-120del)) 20755 0.135 4039 0.037 2.0 0.172 0.0 0.172
linked 28271.0 A28271T 169358 0.999 128579 0.836 101031 0.935 9862 0.998 2 1.0 61593 0.999 109280 0.999 104439 0.999 139326 0.999 25266 0.999 102711 0.999 155559 0.999 12.0 2.77 8.991 11.761
28271.0 Delta A28271-28271del 20763 0.135 4677 0.043 2.0 0.178 0.0 0.178
28271.0 A28271C 4200 0.027 2179 0.02 2.0 0.047 0.0 0.047
linked 28311.0 C28311T|(nucleocapsid_phosphoprotein:C38T(P13L)) 168461 0.994 132136 0.859 102657 0.95 9836 0.996 2 1.0 61316 0.994 108685 0.994 103878 0.993 138629 0.994 25161 0.994 102235 0.994 154837 0.994 12.0 2.803 8.953 11.756
linked 28362.0 GAGAACGCA28362-28370del|(nucleocapsid_phosphoprotein:GGAGAACGCAGT88-99GGTdel(GERS30-33Gdel)) 166030 0.98 132174 0.86 102117 0.945 9792 0.991 2 1.0 61400 0.995 108754 0.994 103962 0.994 138766 0.995 25213 0.995 102212 0.994 150393 0.966 12.0 2.785 8.924 11.709
28461.0 Delta A28461G|(nucleocapsid_phosphoprotein:A188G(D63G)) 4415 0.03 842 0.008 2.0 0.038 0.0 0.038
28471.0 C28471T|(nucleocapsid_phosphoprotein:C198T(F66F)) 4089 0.028 1152 0.011 2.0 0.039 0.0 0.039
linked 28881.0 G28881A|(nucleocapsid_phosphoprotein:AGG607-609AAA(R203K)) 22390 0.974 23755 0.872 36489 0.934 15383 0.978 25893 0.974 45661 0.975 36142 0.975 45215 0.975 28667 0.976 34602 0.976 31298 0.975 33155 0.968 12.0 2.78 8.772 11.552
28881.0 Delta G28881T|(nucleocapsid_phosphoprotein:G608T(R203M)) 2077 0.076 1185 0.03 2.0 0.106 0.0 0.106
28881.0 G28881A|(nucleocapsid_phosphoprotein:G608A(R203K)) 783 0.029 442 0.011 2.0 0.04 0.0 0.04
linked 28882.0 G28882A|(nucleocapsid_phosphoprotein:AGG607-609AAA(R203K)) 22390 0.974 23755 0.872 36489 0.934 15383 0.978 25893 0.974 45661 0.975 36142 0.975 45215 0.975 28667 0.976 34602 0.976 31298 0.975 33155 0.968 12.0 2.78 8.772 11.552
linked 28883.0 G28883C|(nucleocapsid_phosphoprotein:G610C(G204R)) 22931 0.997 24279 0.891 37278 0.955 15679 0.996 16245 0.611 46723 0.998 36958 0.997 46249 0.997 29282 0.997 35366 0.997 32025 0.997 33726 0.985 12.0 2.843 8.575 11.418
28887.0 C28887A|(nucleocapsid_phosphoprotein:C614A(T205N)) 2122 0.078 1219 0.031 2.0 0.109 0.0 0.109
28916.0 G28916T|(nucleocapsid_phosphoprotein:G643T(G215C)) 2927 0.107 1675 0.043 2.0 0.15 0.0 0.15
28934.0 T28934G|(nucleocapsid_phosphoprotein:T661G(L221V)) 3036 0.107 1765 0.043 2.0 0.15 0.0 0.15
29020.0 A29020G|(nucleocapsid_phosphoprotein:A747G(K249K)) 630 0.026 478 0.012 2.0 0.038 0.0 0.038
29134.0 G29134A|(nucleocapsid_phosphoprotein:G861A(G287G)) 2139 0.079 1231 0.031 2.0 0.11 0.0 0.11
linked 29171.0 C29171T|(nucleocapsid_phosphoprotein:C898T(H300Y)) 2134 0.008 1201 0.006 2.0 0.014 0.0 0.014
29227.0 G29227T|(nucleocapsid_phosphoprotein:G954T(S318S)) 3436 0.012 7973 0.035 2.0 0.047 0.0 0.047
linked 29402.0 Delta G29402T|(nucleocapsid_phosphoprotein:G1129T(D377Y)) 2719 0.009 18758 0.078 4347 0.028 7335 0.035 4.0 0.115 0.035 0.15
29427.0 G29427A|(nucleocapsid_phosphoprotein:G1154A(R385K)) 2601 0.009 14334 0.059 2467 0.016 3.0 0.0839999999999999 0.0 0.0839999999999999
linked 29510.0 A29510C|(nucleocapsid_phosphoprotein:A1237C(S413R)) 498967 0.977 371492 0.902 255822 0.94 306870 0.997 1213055 0.998 358372 0.998 269627 0.998 262939 0.998 350780 0.998 319009 0.998 320656 0.998 350045 0.998 319488 0.99 13.0 2.819 9.971 12.79
29732.0 C29732A 628 0.003 12341 0.065 1775 0.014 3.0 0.082 0.0 0.082
29736.0 GGCCACGCGGAGTACGATCGAGTGTACAGTG29736-29766del 532 0.002 14319 0.077 3703 0.03 3.0 0.109 0.0 0.109
linked 29769.0 RATG13 C29769T 2030 0.009 14374 0.077 3569 0.029 8122 0.055 4.0 0.115 0.055 0.17