CO-2 - Complete Raw Mutation Data

Full TSV data with all sample columns and abundance information
← Back to Dashboard

Complete Mutations Data

This table shows the complete data from the mutations.tsv file exactly as it appears in the source. Scroll horizontally to see all columns.

SRR35288390(2133) SRR35288904(30952) SRR35288905(40354) SRR35288911(59817) SRR35288927(45558) SRR35294484(53120) SRR35294647(18456) SRR35294709(55857) SRR35294776(13070) SRR35294878(93216) SRR35294885(15378) SRR35295099(64525) SRR35295109(52962)
('2024-07-29', '29643.0') ('2024-07-31', '15000') ('2024-07-29', '15000.0') ('2024-07-29', '17571') ('2024-07-29', '23194') ('2024-07-29', '18364') ('2024-07-29', '27857') ('2024-07-29', '23429') ('2024-07-29', '16714.0') ('2024-07-29', '28571') ('2024-07-29', '25714') ('2024-07-29', '17601') ('2024-07-29', '26621')
Sequences Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Total samples Positives Sum Negatives Sum Total Sum
147 C147A 3 0.300 1 0.3 0 0.3
linked 344 C344T|(ORF1ab_polyprotein:C79T(L27F))|(ORF1a_polyprotein:C79T(L27F)) 3 0.176 1 0.176 0 0.176
376 G376A|(ORF1ab_polyprotein:G111A(E37E))|(ORF1a_polyprotein:G111A(E37E)) 4 0.364 1 0.364 0 0.364
444 T444-444del|(ORF1ab_polyprotein:179-179del(60fs))|(ORF1a_polyprotein:179-179del(60fs)) 6 0.857 1 0.857 0 0.857
510 GTCATGTTATGGTT510-523del|(ORF1ab_polyprotein:245-258del(82fs))|(ORF1a_polyprotein:245-258del(82fs)) 5 0.833 1 0.833 0 0.833
569 G569A|(ORF1ab_polyprotein:G304A(E102K))|(ORF1a_polyprotein:G304A(E102K)) 8 1.000 1 1.0 0 1.0
711 T711C|(ORF1ab_polyprotein:T446C(L149P))|(ORF1a_polyprotein:T446C(L149P)) 48 0.043 111 0.163 1 0.001 1 0.001 4 0.20600000000000002 0.002 0.20800000000000002
721 T721A|(ORF1ab_polyprotein:T456A(D152E))|(ORF1a_polyprotein:T456A(D152E)) 103 0.087 161 0.200 1 0.001 1 0.000 4 0.28700000000000003 0.001 0.28800000000000003
786 T786C|(ORF1ab_polyprotein:T521C(M174T))|(ORF1a_polyprotein:T521C(M174T)) 125 0.109 420 0.530 1 0.001 1 0.003 4 0.639 0.004 0.643
795 T795C|(ORF1ab_polyprotein:T530C(L177P))|(ORF1a_polyprotein:T530C(L177P)) 227 0.262 1 0.001 1 0.000 3 0.262 0.001 0.263
888 C888T|(ORF1ab_polyprotein:C623T(A208V))|(ORF1a_polyprotein:C623T(A208V)) 475 0.331 2 0.001 2 0.331 0.001 0.332
linked 897 C897A|(ORF1ab_polyprotein:C632A(A211D))|(ORF1a_polyprotein:C632A(A211D)) 957 0.651 37 0.030 978 0.996 995 0.996 1608 1.000 1905 0.997 2678 0.999 448 0.998 1799 0.997 9 0.681 6.983 7.664
942 G942A|(ORF1ab_polyprotein:G677A(R226K))|(ORF1a_polyprotein:G677A(R226K)) 250 0.336 600 0.909 1 0.001 3 1.245 0.001 1.246
1088 T1088A|(ORF1ab_polyprotein:T823A(F275I))|(ORF1a_polyprotein:T823A(F275I)) 9 0.750 1 0.75 0 0.75
1099 T1099C|(ORF1ab_polyprotein:T834C(N278N))|(ORF1a_polyprotein:T834C(N278N)) 11 0.917 1 0.917 0 0.917
1419 C1419G|(ORF1ab_polyprotein:C1154G(A385G))|(ORF1a_polyprotein:C1154G(A385G)) 1 1.000 1 1.0 0 1.0
1628 C1628A|(ORF1ab_polyprotein:CAA1363-1365AAC(Q455N))|(ORF1a_polyprotein:CAA1363-1365AAC(Q455N)) 3 0.250 1 0.25 0 0.25
1630 A1630C|(ORF1ab_polyprotein:CAA1363-1365AAC(Q455N))|(ORF1a_polyprotein:CAA1363-1365AAC(Q455N)) 3 0.250 1 0.25 0 0.25
1703 T1703C|(ORF1ab_polyprotein:T1438C(F480L))|(ORF1a_polyprotein:T1438C(F480L)) 3 0.250 1 0.25 0 0.25
1710 C1710T|(ORF1ab_polyprotein:C1445T(A482V))|(ORF1a_polyprotein:C1445T(A482V)) 7 0.233 1 0.233 0 0.233
2037 RATG13 C2037T|(ORF1ab_polyprotein:C1772T(A591V))|(ORF1a_polyprotein:C1772T(A591V)) 30 0.395 1 0.003 2 0.395 0.003 0.398
2485 RATG13 C2485T|(ORF1ab_polyprotein:C2220T(I740I))|(ORF1a_polyprotein:C2220T(I740I)) 2 0.250 1 0.25 0 0.25
2494 G2494T|(ORF1ab_polyprotein:G2229T(E743D))|(ORF1a_polyprotein:G2229T(E743D)) 1 0.500 1 0.5 0 0.5
2534 G2534A|(ORF1ab_polyprotein:G2269A(V757I))|(ORF1a_polyprotein:G2269A(V757I)) 1 0.500 1 0.250 2 0.75 0 0.75
2551 T2551C|(ORF1ab_polyprotein:T2286C(D762D))|(ORF1a_polyprotein:T2286C(D762D)) 2 0.500 1 0.5 0 0.5
2570 C2570T|(ORF1ab_polyprotein:C2305T(P769S))|(ORF1a_polyprotein:C2305T(P769S)) 1 0.333 1 0.333 2 0.666 0 0.666
ubiq 3037 RATG13,Delta C3037T|(ORF1ab_polyprotein:C2772T(F924F))|(ORF1a_polyprotein:C2772T(F924F)) 9 1.000 18 1.000 33 1.000 43 1.000 52 1.000 1 1.000 11 1.000 7 1.000 17 1.000 27 1.000 24 0.960 11 2.0 8.96 10.96
3177 C3177T|(ORF1ab_polyprotein:C2912T(P971L))|(ORF1a_polyprotein:C2912T(P971L)) 4 0.571 9 1.000 2 1.571 0 1.571
3562 G3562A|(ORF1ab_polyprotein:G3297A(V1099V))|(ORF1a_polyprotein:G3297A(V1099V)) 7 0.304 1 0.304 0 0.304
3695 C3695T|(ORF1ab_polyprotein:C3430T(L1144L))|(ORF1a_polyprotein:C3430T(L1144L)) 19 0.365 1 0.365 0 0.365
3743 C3743T|(ORF1ab_polyprotein:C3478T(H1160Y))|(ORF1a_polyprotein:C3478T(H1160Y)) 17 0.567 1 0.567 0 0.567
3927 C3927T|(ORF1ab_polyprotein:C3662T(S1221L))|(ORF1a_polyprotein:C3662T(S1221L)) 2 0.667 1 0.667 0 0.667
4181 G4181A|(ORF1ab_polyprotein:G3916A(A1306T))|(ORF1a_polyprotein:G3916A(A1306T)) 34 0.607 119 0.672 2 1.279 0 1.279
4321 C4321A|(ORF1ab_polyprotein:C4056A(A1352A))|(ORF1a_polyprotein:C4056A(A1352A)) 45 0.634 109 0.703 2 1.337 0 1.337
5182 T5182G|(ORF1ab_polyprotein:T4917G(D1639E))|(ORF1a_polyprotein:T4917G(D1639E)) 4 0.444 1 0.014 2 0.444 0.014 0.458
5225 5225-insertA|(ORF1ab_polyprotein:4960insertA(1654fs))|(ORF1a_polyprotein:4960insertA(1654fs)) 3 0.250 1 0.25 0 0.25
5309 A5309G|(ORF1ab_polyprotein:A5044G(T1682A))|(ORF1a_polyprotein:A5044G(T1682A)) 1 0.500 1 0.062 2 0.562 0 0.562
5431 A5431G|(ORF1ab_polyprotein:A5166G(V1722V))|(ORF1a_polyprotein:A5166G(V1722V)) 13 0.224 1 0.224 0 0.224
5455 A5455C|(ORF1ab_polyprotein:A5190C(E1730D))|(ORF1a_polyprotein:A5190C(E1730D)) 65 0.774 1 0.774 0 0.774
5600 RATG13 T5600C|(ORF1ab_polyprotein:T5335C(F1779L))|(ORF1a_polyprotein:T5335C(F1779L)) 53 0.707 1 0.707 0 0.707
5648 RATG13 A5648C|(ORF1ab_polyprotein:A5383C(K1795Q))|(ORF1a_polyprotein:A5383C(K1795Q)) 50 0.735 1 0.735 0 0.735
5831 T5831C|(ORF1ab_polyprotein:T5566C(S1856P))|(ORF1a_polyprotein:T5566C(S1856P)) 5 0.833 1 0.833 0 0.833
5878 RATG13 C5878T|(ORF1ab_polyprotein:C5613T(N1871N))|(ORF1a_polyprotein:C5613T(N1871N)) 2 0.333 1 0.333 0 0.333
6283 RATG13 T6283C|(ORF1ab_polyprotein:T6018C(N2006N))|(ORF1a_polyprotein:T6018C(N2006N)) 135 0.567 1 0.567 0 0.567
6317 C6317T|(ORF1ab_polyprotein:C6052T(P2018S))|(ORF1a_polyprotein:C6052T(P2018S)) 130 0.344 1 0.344 0 0.344
6336 C6336T|(ORF1ab_polyprotein:C6071T(S2024L))|(ORF1a_polyprotein:C6071T(S2024L)) 19 0.088 426 0.957 1 0.002 3 1.045 0.002 1.047
6513 GTT6513-6515del|(ORF1ab_polyprotein:AGTTTA6247-6252ATAdel(SL2083-2084Idel))|(ORF1a_polyprotein:AGTTTA6247-6252ATAdel(SL2083-2084Idel)) 7 0.043 335 0.923 2 0.9660000000000001 0 0.9660000000000001
6527 GAAGAGGTTGGCCACACAGATCTAATGGCTGCTTATGTAGACAATTCTAGTCTTACTATTAAGAAACCTAATGAATTATCTAGAGTATTAGGTTT6527-6621del|(ORF1ab_polyprotein:6262-6356del(2088fs))|(ORF1a_polyprotein:6262-6356del(2088fs)) 2 1.000 1 1.0 0 1.0
6593 C6593A|(ORF1ab_polyprotein:C6328A(P2110T))|(ORF1a_polyprotein:C6328A(P2110T)) 8 0.333 1 0.333 0 0.333
6656 A6656-6656del|(ORF1ab_polyprotein:6391-6391del(2131fs))|(ORF1a_polyprotein:6391-6391del(2131fs)) 6 0.300 1 0.3 0 0.3
linked 6659 A6659T|(ORF1ab_polyprotein:A6394T(S2132C))|(ORF1a_polyprotein:A6394T(S2132C)) 1 0.100 1 0.1 0 0.1
6696 C6696A|(ORF1ab_polyprotein:C6431A(P2144H))|(ORF1a_polyprotein:C6431A(P2144H)) 1 0.250 1 0.25 0 0.25
6761 A6761T|(ORF1ab_polyprotein:A6496T(T2166S))|(ORF1a_polyprotein:A6496T(T2166S)) 1 0.333 1 0.333 0 0.333
6762 C6762T|(ORF1ab_polyprotein:C6497T(T2166I))|(ORF1a_polyprotein:C6497T(T2166I)) 6 1.000 1 1.0 0 1.0
6913 T6913C|(ORF1ab_polyprotein:T6648C(N2216N))|(ORF1a_polyprotein:T6648C(N2216N)) 215 0.348 1 0.002 1 0.001 1 0.000 4 0.348 0.003 0.351
7295 G7295A|(ORF1ab_polyprotein:G7030A(A2344T))|(ORF1a_polyprotein:G7030A(A2344T)) 1 1.000 1 1.0 0 1.0
7452 G7452T|(ORF1ab_polyprotein:G7187T(S2396I))|(ORF1a_polyprotein:G7187T(S2396I)) 1 1.000 1 1.0 0 1.0
7834 C7834T|(ORF1ab_polyprotein:C7569T(N2523N))|(ORF1a_polyprotein:C7569T(N2523N)) 13 0.765 1 0.014 2 0.765 0.014 0.779
ubiq 8393 G8393A|(ORF1ab_polyprotein:G8128A(A2710T))|(ORF1a_polyprotein:G8128A(A2710T)) 105 0.991 214 1.000 436 0.995 138 0.993 219 0.995 268 1.000 565 0.995 99 1.000 670 0.985 9 1.991 6.963 8.954
8634 T8634C|(ORF1ab_polyprotein:T8369C(I2790T))|(ORF1a_polyprotein:T8369C(I2790T)) 8 0.667 1 0.667 0 0.667
8863 G8863A|(ORF1ab_polyprotein:G8598A(V2866V))|(ORF1a_polyprotein:G8598A(V2866V)) 3 0.273 1 0.273 0 0.273
8894 A8894G|(ORF1ab_polyprotein:A8629G(T2877A))|(ORF1a_polyprotein:A8629G(T2877A)) 5 0.714 1 0.714 0 0.714
9042 C9042T|(ORF1ab_polyprotein:C8777T(S2926F))|(ORF1a_polyprotein:C8777T(S2926F)) 3 0.600 1 0.6 0 0.6
9269 G9269T|(ORF1ab_polyprotein:G9004T(G3002C))|(ORF1a_polyprotein:G9004T(G3002C)) 1 0.250 1 0.25 0 0.25
linked 9315 T9315G|(ORF1ab_polyprotein:T9050G(V3017G))|(ORF1a_polyprotein:T9050G(V3017G)) 1 0.125 1 0.056 2 0.125 0.056 0.181
9756 G9756A|(ORF1ab_polyprotein:G9491A(R3164H))|(ORF1a_polyprotein:G9491A(R3164H)) 28 0.718 1 0.718 0 0.718
10012 T10012A|(ORF1ab_polyprotein:T9747A(L3249L))|(ORF1a_polyprotein:T9747A(L3249L)) 1 1.000 2 0.667 2 1.667 0 1.667
linkedubiq 10029 C10029T|(ORF1ab_polyprotein:C9764T(T3255I))|(ORF1a_polyprotein:C9764T(T3255I)) 1 1.000 2 1.000 6 1.000 2 1.000 7 1.000 2 1.000 3 1.000 1 1.000 14 1.000 9 2.0 7.0 9.0
10078 C10078T|(ORF1ab_polyprotein:C9813T(F3271F))|(ORF1a_polyprotein:C9813T(F3271F)) 1 0.333 1 0.333 0 0.333
ubiq 10449 C10449A|(ORF1ab_polyprotein:C10184A(P3395H))|(ORF1a_polyprotein:C10184A(P3395H)) 160 1.000 344 1.000 478 1.000 284 0.993 326 1.000 211 1.000 163 0.988 131 1.000 698 0.999 258 1.000 1607 0.999 11 2.0 8.979 10.979
10717 T10717C|(ORF1ab_polyprotein:T10452C(N3484N))|(ORF1a_polyprotein:T10452C(N3484N)) 12 0.235 36 0.429 2 0.6639999999999999 0 0.6639999999999999
10875 A10875G|(ORF1ab_polyprotein:A10610G(N3537S))|(ORF1a_polyprotein:A10610G(N3537S)) 10 0.323 1 0.323 0 0.323
11081 RATG13 T11081G|(ORF1ab_polyprotein:T10816G(L3606V))|(ORF1a_polyprotein:T10816G(L3606V)) 1 0.019 78 0.765 2 0.784 0 0.784
11109 C11109T|(ORF1ab_polyprotein:C10844T(A3615V))|(ORF1a_polyprotein:C10844T(A3615V)) 56 0.528 1 0.528 0 0.528
11199 C11199T|(ORF1ab_polyprotein:C10934T(A3645V))|(ORF1a_polyprotein:C10934T(A3645V)) 1 0.043 69 0.812 2 0.8550000000000001 0 0.8550000000000001
11278 T11278C|(ORF1ab_polyprotein:T11013C(D3671D))|(ORF1a_polyprotein:T11013C(D3671D)) 13 0.232 197 0.727 2 0.959 0 0.959
11283 GTTTGTCTG11283-11291del|(ORF1ab_polyprotein:AGTTTGTCTGGT11017-11028AGTdel(SLSG3673-3676Sdel))|(ORF1a_polyprotein:AGTTTGTCTGGT11017-11028AGTdel(SLSG3673-3676Sdel)) 12 0.250 184 0.814 2 1.064 0 1.064
11537 A11537G|(ORF1ab_polyprotein:A11272G(I3758V))|(ORF1a_polyprotein:A11272G(I3758V)) 1 0.500 1 0.5 0 0.5
11615 T11615C|(ORF1ab_polyprotein:T11350C(C3784R))|(ORF1a_polyprotein:T11350C(C3784R)) 1 1.000 1 1.0 0 1.0
11875 A11875G|(ORF1ab_polyprotein:A11610G(V3870V))|(ORF1a_polyprotein:A11610G(V3870V)) 9 0.529 1 0.529 0 0.529
11950 C11950T|(ORF1ab_polyprotein:C11685T(H3895H))|(ORF1a_polyprotein:C11685T(H3895H)) 14 0.636 1 0.636 0 0.636
12525 C12525T|(ORF1ab_polyprotein:C12260T(T4087I))|(ORF1a_polyprotein:C12260T(T4087I)) 10 0.455 1 0.455 0 0.455
ubiq 12815 RATG13 C12815T|(ORF1ab_polyprotein:C12550T(L4184L))|(ORF1a_polyprotein:C12550T(L4184L)) 2 1.000 32 0.941 11 1.000 6 1.000 11 1.000 13 1.000 11 0.917 7 1.9409999999999998 4.917 6.858
13137 T13137A|(ORF1ab_polyprotein:T12872A(I4291N))|(ORF1a_polyprotein:T12872A(I4291N)) 1 1.000 1 1.0 0 1.0
13150 T13150G|(ORF1ab_polyprotein:T12885G(V4295V))|(ORF1a_polyprotein:T12885G(V4295V)) 1 0.500 1 0.5 0 0.5
13195 T13195C|(ORF1ab_polyprotein:T12930C(V4310V))|(ORF1a_polyprotein:T12930C(V4310V)) 1 0.333 1 0.333 0 0.333
13296 A13296C|(ORF1ab_polyprotein:A13031C(D4344A))|(ORF1a_polyprotein:A13031C(D4344A)) 1 1.000 1 1.0 0 1.0
13427 G13427A|(ORF1ab_polyprotein:G13162A(E4388K))|(ORF1a_polyprotein:G13162A(E4388K)) 1 1.000 1 1.0 0 1.0
13560 T13560C|(ORF1ab_polyprotein:T13296C(D4432D)) 93 0.220 1 0.003 2 0.22 0.003 0.223
14107 A14107C|(ORF1ab_polyprotein:A13843C(I4615L)) 2 1.000 1 1.0 0 1.0
14116 A14116G|(ORF1ab_polyprotein:A13852G(T4618A)) 7 0.233 1 0.233 0 0.233
14126 G14126A|(ORF1ab_polyprotein:G13862A(S4621N)) 33 0.717 1 0.717 0 0.717
14408 C14408A|(ORF1ab_polyprotein:C14144A(P4715H)) 6 0.316 1 0.316 0 0.316
14558 T14558A|(ORF1ab_polyprotein:T14294A(V4765E)) 1 0.250 1 0.25 0 0.25
14698 T14698A|(ORF1ab_polyprotein:T14434A(Y4812N)) 1 1.000 1 1.0 0 1.0
14868 T14868A|(ORF1ab_polyprotein:T14604A(V4868V)) 4 0.308 1 0.308 0 0.308
15240 C15240T|(ORF1ab_polyprotein:C14976T(N4992N)) 125 0.762 1 0.002 2 0.762 0.002 0.764
15640 A15640G|(ORF1ab_polyprotein:A15376G(N5126D)) 11 0.077 68 0.673 2 0.75 0 0.75
15656 C15656T|(ORF1ab_polyprotein:C15392T(T5131I)) 13 0.091 60 0.638 2 0.729 0 0.729
16175 C16175A|(ORF1ab_polyprotein:C15911A(T5304N)) 53 0.189 159 0.674 2 0.863 0 0.863
16926 T16926C|(ORF1ab_polyprotein:T16662C(H5554H)) 45 0.134 37 0.135 2 0.269 0 0.269
17236 A17236G|(ORF1ab_polyprotein:A16972G(I5658V)) 61 0.389 246 0.882 2 1.271 0 1.271
17322 A17322G|(ORF1ab_polyprotein:A17058G(A5686A)) 2 0.008 111 0.771 2 0.779 0 0.779
18139 18139-insertA|(ORF1ab_polyprotein:17875insertA(5959fs)) 2 0.286 1 0.286 0 0.286
linked 18163 A18163G|(ORF1ab_polyprotein:A17899G(I5967V)) 6 1.000 2 0.125 28 1.000 10 1.000 2 1.000 13 1.000 11 1.000 52 1.000 33 1.000 18 1.000 10 1.125 8.0 9.125
18306 RATG13 C18306T|(ORF1ab_polyprotein:C18042T(F6014F)) 3 0.273 1 0.273 0 0.273
19287 T19287C|(ORF1ab_polyprotein:T19023C(G6341G)) 2 0.222 58 0.707 1 0.006 3 0.9289999999999999 0.006 0.9349999999999999
19290 C19290T|(ORF1ab_polyprotein:C19026T(G6342G)) 2 0.222 1 0.222 0 0.222
19493 G19493A|(ORF1ab_polyprotein:G19229A(R6410K)) 48 0.212 1 0.212 0 0.212
19538 T19538C|(ORF1ab_polyprotein:T19274C(M6425T)) 55 0.417 1 0.002 2 0.417 0.002 0.419
19718 C19718T|(ORF1ab_polyprotein:C19454T(T6485I)) 31 0.564 1 0.564 0 0.564
19722 A19722G|(ORF1ab_polyprotein:A19458G(K6486K)) 24 0.436 33 0.277 2 0.7130000000000001 0 0.7130000000000001
20404 C20404T|(ORF1ab_polyprotein:C20140T(P6714S)) 3 0.600 1 0.6 0 0.6
20411 A20411C|(ORF1ab_polyprotein:A20147C(E6716A)) 4 0.500 1 0.5 0 0.5
20846 A20846G|(ORF1ab_polyprotein:A20582G(Y6861C)) 8 0.250 1 0.25 0 0.25
linked 20976 T20976A|(ORF1ab_polyprotein:T20712A(D6904E)) 1 0.023 1 0.023 0 0.023
linked 20985 A20985C|(ORF1ab_polyprotein:A20721C(S6907S)) 1 0.028 1 0.028 0 0.028
linked 20988 T20988A|(ORF1ab_polyprotein:T20724A(T6908T)) 1 0.034 1 0.034 0 0.034
linked 21010 G21010T|(ORF1ab_polyprotein:G20746T(V6916L)) 1 0.062 1 0.062 0 0.062
21021 T21021A|(ORF1ab_polyprotein:T20757A(A6919A)) 1 0.500 1 0.5 0 0.5
21430 G21430T|(ORF1ab_polyprotein:G21166T(A7056S)) 7 0.206 1 0.206 0 0.206
21587 C21587A|(surface_glycoprotein:C25A(P9T)) 25 0.581 1 0.581 0 0.581
linked 21618 C21618T|(surface_glycoprotein:C56T(T19I)) 7 0.412 2 0.059 20 1.000 30 1.000 7 1.000 2 1.000 3 1.000 63 1.000 16 1.000 9 0.471 7.0 7.471
linked 21622 RATG13 C21622T|(surface_glycoprotein:C60T(T20T)) 7 0.500 2 0.050 20 1.000 30 1.000 7 1.000 2 1.000 3 1.000 63 1.000 16 1.000 9 0.55 7.0 7.55
linked 21624 G21624C|(surface_glycoprotein:G62C(R21T)) 7 0.500 2 0.042 20 1.000 30 1.000 7 1.000 2 1.000 3 1.000 63 1.000 16 1.000 9 0.542 7.0 7.542
21633 T21633C|(surface_glycoprotein:T71C(L24S)) 7 0.500 10 0.208 2 0.708 0 0.708
21634 ACCCCCTGC21634-21642del|(surface_glycoprotein:TTACCCCCTGCA70-81TTAdel(LPPA24-27Ldel)) 4 0.286 1 0.286 0 0.286
linked 21711 RATG13 C21711T|(surface_glycoprotein:C149T(S50L)) 10 1.000 32 0.865 11 1.000 9 1.000 9 1.000 3 1.000 26 1.000 15 1.000 8 1.865 6.0 7.865
21762 C21762T|(surface_glycoprotein:C200T(A67V)) 25 0.962 1 0.962 0 0.962
linkedubiq 21765 TACATG21765-21770del|(surface_glycoprotein:ATACATGTC202-210ATCdel(IHV68-70Idel)) 6 1.000 19 1.000 5 1.000 6 1.000 4 1.000 1 1.000 19 1.000 7 1.000 8 2.0 6.0 8.0
21788 A21788G|(surface_glycoprotein:ACT226-228GTT(T76V)) 4 0.211 1 0.211 0 0.211
21789 RATG13 C21789T|(surface_glycoprotein:ACT226-228GTT(T76V)) 4 0.211 1 0.211 0 0.211
21789 RATG13 C21789T|(surface_glycoprotein:C227T(T76I)) 10 0.526 1 0.526 0 0.526
21816 C21816A|(surface_glycoprotein:C254A(P85Q)) 4 0.571 1 0.571 0 0.571
21846 C21846T|(surface_glycoprotein:C284T(T95I)) 27 1.000 1 1.0 0 1.0
21977 CCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGG21977-22018del|(surface_glycoprotein:415-456del(PFLGVYYHKNNKSW139-152del)) 2 0.080 21 0.488 2 0.568 0 0.568
22111 G22111A|(surface_glycoprotein:G549A(Q183Q)) 7 0.189 65 0.619 2 0.808 0 0.808
22120 C22120T|(surface_glycoprotein:C558T(F186F)) 8 0.205 1 0.205 0 0.205
linkedubiq 22194 ATT22194-22196del|(surface_glycoprotein:AATTTA631-636ATAdel(NL211-212Idel)) 8 1.000 40 1.000 19 1.000 7 1.000 29 1.000 9 1.000 39 1.000 10 1.000 65 0.985 9 2.0 6.985 8.985
22205 22205-insertGAGCCAGAA|(surface_glycoprotein:643insertGAGCCAGAA(215EPE)) 2 0.250 15 0.349 2 0.599 0 0.599
22217 G22217A|(surface_glycoprotein:G655A(G219S)) 9 0.750 35 0.778 2 1.528 0 1.528
22246 T22246G|(surface_glycoprotein:T684G(D228E)) 2 0.286 1 0.286 0 0.286
22281 CTTTACTTG22281-22289del|(surface_glycoprotein:ACTTTACTTGCT718-729ACTdel(TLLA240-243Tdel)) 3 0.500 3 0.103 2 0.603 0 0.603
22308 T22308C|(surface_glycoprotein:T746C(L249S)) 2 1.000 23 0.742 2 1.742 0 1.742
22329 CAGGTTGGACAGCTGGTGCTG22329-22349del|(surface_glycoprotein:TCAGGTTGGACAGCTGGTGCTGCA766-789TCAdel(SGWTAGAA256-263Sdel)) 12 0.667 1 0.667 0 0.667
22578 G22578A|(surface_glycoprotein:G1016A(G339D)) 3 1.000 11 1.000 2 2.0 0 2.0
linked 22599 RATG13 G22599C|(surface_glycoprotein:G1037C(R346T)) 2 1.000 8 0.727 5 0.625 4 1.000 3 0.103 2 0.069 48 0.857 2 0.133 8 1.7269999999999999 2.787 4.513999999999999
22632 G22632A|(surface_glycoprotein:G1070A(R357K)) 3 0.375 1 0.375 0 0.375
22661 G22661T|(surface_glycoprotein:G1099T(V367F)) 2 1.000 3 0.600 2 1.6 0 1.6
22667 T22667A|(surface_glycoprotein:T1105A(Y369N)) 2 1.000 1 0.250 2 1.25 0 1.25
linked 22672 T22672G|(surface_glycoprotein:T1110G(N370K)) 1 0.200 1 0.2 0 0.2
22673 T22673C|(surface_glycoprotein:TCC1111-1113CTC(S371L)) 2 1.000 2 0.500 2 1.5 0 1.5
22674 C22674T|(surface_glycoprotein:TCC1111-1113CTC(S371L)) 2 1.000 2 0.500 2 1.5 0 1.5
22676 RATG13 G22676A|(surface_glycoprotein:G1114A(A372T)) 2 1.000 1 1.0 0 1.0
linked 22679 T22679C|(surface_glycoprotein:T1117C(S373P)) 1 1.000 2 1.000 3 0.750 1 1.000 7 1.000 2 1.000 1 1.000 17 1.000 15 1.000 56 1.000 3 1.000 8 1.000 12 1.75 10.0 11.75
22679 TCATTTT22679-22685del|(surface_glycoprotein:TCATTTTCCACTTTT1117-1131CCAdel(SFSTF373-377Pdel)) 1 0.250 1 0.25 0 0.25
22683 T22683C|(surface_glycoprotein:T1121C(F374S)) 3 0.600 2 0.400 2 1.0 0 1.0
linked 22689 CTTTT22689-22693del|(surface_glycoprotein:TCATTTTCCACTTTT1117-1131CCAdel(SFSTF373-377Pdel)) 1 0.125 1 0.125 0 0.125
22812 A22812C|(surface_glycoprotein:AAG1249-1251ACT(K417T)) 23 0.657 78 0.848 2 1.505 0 1.505
22813 G22813T|(surface_glycoprotein:AAG1249-1251ACT(K417T)) 23 0.657 78 0.848 2 1.505 0 1.505
22894 RATG13 G22894A|(surface_glycoprotein:G1332A(K444K)) 49 0.299 1 0.299 0 0.299
22907 T22907A|(surface_glycoprotein:T1345A(Y449N)) 53 0.356 1 0.356 0 0.356
22907 T22907C|(surface_glycoprotein:T1345C(Y449H)) 45 0.938 79 0.530 2 1.468 0 1.468
linkedubiq 22992 G22992A|(surface_glycoprotein:G1430A(S477N)) 52 1.000 169 0.994 32 1.000 4 1.000 11 1.000 22 1.000 31 0.969 92 1.000 12 1.000 14 1.000 10 1.994 7.969 9.963000000000001
23040 A23040G|(surface_glycoprotein:A1478G(Q493R)) 28 0.800 117 0.854 2 1.654 0 1.654
linkedubiq 23063 A23063T|(surface_glycoprotein:A1501T(N501Y)) 20 1.000 78 1.000 8 1.000 1 1.000 5 1.000 4 1.000 14 1.000 26 1.000 4 1.000 6 1.000 10 2.0 8.0 10.0
23073 G23073A|(surface_glycoprotein:G1511A(G504D)) 6 0.600 37 0.902 2 1.502 0 1.502
linkedubiq 23075 RATG13 T23075C|(surface_glycoprotein:T1513C(Y505H)) 10 1.000 41 1.000 4 1.000 1 1.000 1 1.000 1 1.000 9 1.000 12 1.000 4 1.000 3 1.000 10 2.0 8.0 10.0
23202 C23202A|(surface_glycoprotein:C1640A(T547K)) 30 0.273 64 0.561 2 0.018 3 0.8340000000000001 0.018 0.8520000000000001
ubiq 23403 Delta A23403G|(surface_glycoprotein:A1841G(D614G)) 26 1.000 58 1.000 60 1.000 59 0.983 56 1.000 125 1.000 107 0.991 152 1.000 49 1.000 25 1.000 46 1.000 172 0.994 12 2.0 9.968 11.968
23707 RATG13 C23707T|(surface_glycoprotein:C2145T(P715P)) 8 0.333 1 0.333 0 0.333
linkedubiq 24424 A24424T|(surface_glycoprotein:A2862T(Q954H)) 3 1.000 1 1.000 2 1.000 2 1.000 1 1.000 2 1.000 4 1.000 7 2.0 5.0 7.0
linkedubiq 24469 T24469A|(surface_glycoprotein:T2907A(N969K)) 3 1.000 2 1.000 3 1.000 3 1.000 1 1.000 2 1.000 7 1.000 7 2.0 5.0 7.0
24503 C24503T|(surface_glycoprotein:C2941T(L981F)) 2 0.333 1 0.333 0 0.333
24503 C24503T|(surface_glycoprotein:CTT2941-2943TTG(L981L)) 1 0.333 1 0.167 2 0.5 0 0.5
24505 T24505G|(surface_glycoprotein:CTT2941-2943TTG(L981L)) 1 0.333 1 0.167 2 0.5 0 0.5
ubiq 25000 RATG13 C25000T|(surface_glycoprotein:C3438T(D1146D)) 15 1.000 97 0.990 101 1.000 18 0.947 43 1.000 10 1.000 1 1.000 25 1.000 92 1.000 60 1.000 26 1.000 11 1.99 8.947 10.937
25067 A25067T|(surface_glycoprotein:A3505T(I1169F)) 2 0.143 37 0.474 2 0.617 0 0.617
25265 T25265A|(surface_glycoprotein:T3703A(C1235S)) 1 0.333 1 0.333 0 0.333
25296 A25296G|(surface_glycoprotein:A3734G(K1245R)) 1 0.500 1 0.5 0 0.5
25392 T25392C 3 0.750 1 0.75 0 0.75
25420 RATG13 A25420C|(ORF3a_protein:A28C(I10L)) 20 0.625 1 0.625 0 0.625
25440 RATG13 G25440A|(ORF3a_protein:G48A(K16K)) 3 0.333 5 0.083 2 0.41600000000000004 0 0.41600000000000004
25525 T25525A|(ORF3a_protein:T133A(W45R)) 6 0.261 57 0.626 2 0.887 0 0.887
25536 T25536A|(ORF3a_protein:T144A(V48V)) 8 0.320 67 0.684 2 1.004 0 1.004
linkedubiq 25584 C25584T|(ORF3a_protein:C192T(T64T)) 27 1.000 114 0.983 83 0.988 31 0.969 81 1.000 117 1.000 194 0.995 39 1.000 369 0.932 9 1.983 6.884 8.867
25614 RATG13 C25614T|(ORF3a_protein:C222T(S74S)) 6 0.400 47 0.635 2 1.0350000000000001 0 1.0350000000000001
25698 A25698T|(ORF3a_protein:A306T(E102D)) 4 0.286 17 0.189 1 0.003 3 0.475 0.003 0.478
25710 C25710T|(ORF3a_protein:C318T(L106L)) 1 0.091 55 0.753 2 0.844 0 0.844
26013 C26013T|(ORF3a_protein:C621T(F207F)) 2 0.500 1 0.5 0 0.5
26185 G26185T|(ORF3a_protein:G793T(D265Y)) 3 0.429 18 0.750 2 1.179 0 1.179
26205 T26205C|(ORF3a_protein:T813C(T271T)) 1 0.250 7 0.259 2 0.509 0 0.509
26251 T26251C|(envelope_protein:T7C(S3P)) 2 0.400 11 0.458 2 0.8580000000000001 0 0.8580000000000001
linkedubiq 26270 C26270T|(envelope_protein:C26T(T9I)) 6 1.000 27 1.000 43 1.000 12 1.000 20 1.000 2 1.000 5 1.000 4 1.000 45 1.000 9 1.000 33 1.000 11 2.0 9.0 11.0
26416 G26416A|(envelope_protein:G172A(V58I)) 34 0.209 1 0.209 0 0.209
26485 TTATATTAGTTTTTCTGTTTGGAACTTTAATT26485-26516del 15 0.114 51 0.209 2 0.323 0 0.323
26530 A26530G|(membrane_glycoprotein:A8G(D3G)) 67 0.545 162 0.747 2 1.292 0 1.292
26533 C26533A|(membrane_glycoprotein:C11A(S4Y)) 27 0.218 80 0.362 1 0.009 3 0.58 0.009 0.589
linkedubiq 26577 C26577G|(membrane_glycoprotein:C55G(Q19E)) 51 1.000 158 1.000 287 0.993 209 0.986 246 0.996 12 1.000 49 1.000 72 1.000 130 1.000 54 1.000 87 0.989 264 0.996 12 1.9929999999999999 9.967 11.96
26598 T26598G|(membrane_glycoprotein:T76G(F26V)) 28 0.165 16 0.051 2 0.216 0 0.216
ubiq 26709 G26709A|(membrane_glycoprotein:G187A(A63T)) 22 1.000 439 0.989 700 0.992 698 0.987 184 1.000 258 0.996 505 0.998 236 1.000 35 1.000 912 0.998 18 1.000 649 0.995 94 0.989 13 1.9809999999999999 10.963 12.943999999999999
26873 C26873T|(membrane_glycoprotein:C351T(N117N)) 15 0.034 212 0.290 2 0.002 3 0.32399999999999995 0.002 0.32599999999999996
26934 C26934A|(membrane_glycoprotein:C412A(L138I)) 10 0.034 187 0.325 2 0.359 0 0.359
27005 C27005A|(membrane_glycoprotein:C483A(I161I)) 2 0.133 4 0.068 2 0.201 0 0.201
27050 T27050C|(membrane_glycoprotein:T528C(L176L)) 19 0.311 140 0.491 2 0.802 0 0.802
27247 C27247G|(ORF6_protein:C46G(L16V)) 57 0.317 1 0.317 0 0.317
27247 C27247T|(ORF6_protein:C46T(L16L)) 25 0.347 77 0.428 2 0.7749999999999999 0 0.7749999999999999
linkedubiq 27259 A27259C|(ORF6_protein:A58C(R20R)) 5 1.000 76 1.000 178 0.994 200 1.000 78 1.000 53 1.000 28 1.000 71 1.000 107 1.000 162 1.000 72 1.000 105 1.000 37 0.974 13 1.994 10.974 12.968
27281 G27281T|(ORF6_protein:G80T(W27L)) 19 0.161 121 0.634 2 0.795 0 0.795
27305 T27305G|(ORF6_protein:T104G(L35R)) 17 0.145 115 0.612 1 0.003 3 0.757 0.003 0.76
ubiq 27807 C27807T|(ORF7b:C52T(L18L)) 152 1.000 298 0.993 110 1.000 755 0.995 703 0.996 461 1.000 318 1.000 973 0.998 296 1.000 718 0.999 313 0.994 369 0.997 1081 0.997 13 1.9929999999999999 10.975999999999999 12.969
28098 T28098A|(ORF8_protein:T205A(S69T)) 4 0.364 1 0.364 0 0.364
linkedubiq 28271 A28271T 3 1.000 16 1.000 31 1.000 10 1.000 4 1.000 4 1.000 8 1.000 26 1.000 6 1.000 7 1.000 10 1.000 12 1.000 12 2.0 10.0 12.0
28303 A28303G|(nucleocapsid_phosphoprotein:A30G(R10R)) 16 0.254 1 0.254 0 0.254
linkedubiq 28311 C28311T|(nucleocapsid_phosphoprotein:C38T(P13L)) 4 1.000 21 1.000 68 0.986 9 1.000 3 1.000 3 1.000 7 1.000 22 1.000 3 1.000 5 1.000 10 1.000 10 1.000 12 1.986 10.0 11.986
28340 T28340C|(nucleocapsid_phosphoprotein:T67C(S23P)) 5 0.227 1 0.227 0 0.227
linkedubiq 28362 GAGAACGCA28362-28370del|(nucleocapsid_phosphoprotein:GGAGAACGCAGT88-99GGTdel(GERS30-33Gdel)) 3 1.000 18 1.000 75 1.000 7 1.000 2 1.000 4 1.000 6 1.000 18 0.947 2 1.000 2 1.000 7 1.000 10 1.000 12 2.0 9.947 11.947
28382 RATG13 T28382C|(nucleocapsid_phosphoprotein:T109C(S37P)) 56 0.718 1 0.718 0 0.718
28472 C28472T|(nucleocapsid_phosphoprotein:C199T(P67S)) 13 1.000 43 0.878 2 1.8780000000000001 0 1.8780000000000001
linked 28881 G28881A|(nucleocapsid_phosphoprotein:AGG607-609AAA(R203K)) 23 1.000 77 0.740 167 0.988 251 0.988 35 0.946 81 1.000 18 1.000 75 1.000 115 1.000 61 1.000 152 1.000 11 1.728 8.934 10.661999999999999
linked 28882 G28882A|(nucleocapsid_phosphoprotein:AGG607-609AAA(R203K)) 23 1.000 77 0.740 167 0.988 251 0.988 35 0.946 81 1.000 18 1.000 75 1.000 115 1.000 61 1.000 152 1.000 11 1.728 8.934 10.661999999999999
28882 G28882A|(nucleocapsid_phosphoprotein:G609A(R203R)) 26 0.250 1 0.25 0 0.25
linked 28883 G28883C|(nucleocapsid_phosphoprotein:G610C(G204R)) 23 1.000 104 1.000 147 0.870 202 0.795 36 0.973 81 1.000 15 0.833 49 0.653 115 1.000 56 0.918 152 1.000 11 1.87 8.172 10.042000000000002
28896 C28896T|(nucleocapsid_phosphoprotein:C623T(A208V)) 61 0.292 1 0.292 0 0.292
28928 C28928T|(nucleocapsid_phosphoprotein:C655T(L219F)) 11 0.069 238 0.799 1 0.009 3 0.021 1 0.006 1 0.004 6 0.8680000000000001 0.04 0.9080000000000001
28992 A28992G|(nucleocapsid_phosphoprotein:A719G(Q240R)) 75 0.240 1 0.24 0 0.24
29006 A29006G|(nucleocapsid_phosphoprotein:A733G(T245A)) 68 0.212 1 0.212 0 0.212
29089 A29089G|(nucleocapsid_phosphoprotein:A816G(Q272Q)) 62 0.244 1 0.244 0 0.244
29138 C29138A|(nucleocapsid_phosphoprotein:C865A(Q289K)) 76 0.384 1 0.384 0 0.384
29708 C29708T 145 0.061 1083 0.426 1 0.000 3 0.487 0.0 0.487
29730 CACCGAGGCCACGCGGAGTACGATCGAGTGTACAGTG29730-29766del 242 0.243 1 0.243 0 0.243
29736 GGCCACGCG29736-29744del 230 0.231 1 0.231 0 0.231
29738 CCACGCGGAGTACGATCGAGT29738-29758del 62 0.069 154 0.155 2 0.224 0 0.224