MD-1 - Complete Raw Mutation Data

Full TSV data with all sample columns and abundance information
← Back to Dashboard

Complete Mutations Data

This table shows the complete data from the mutations.tsv file exactly as it appears in the source. Scroll horizontally to see all columns.

SRR29809889(1863465) SRR29809900(1781127) SRR29809904(1650963) SRR29849357(2300373) SRR29849401(2164468) SRR29849457(1469899) SRR29914854(2818995) SRR29914865(1160412) SRR29914933(2983090) SRR30022271(2289850) SRR30022285(2402504) SRR30133754(2517264) SRR30133767(2597521) SRR30133783(2204971) SRR30211149(2480301) SRR30211150(2585857) SRR30211160(2165270) SRR30292423(2216515) SRR30292427(833615) SRR30292482(1132171) SRR30409395(2968184) SRR30409486(2016750) SRR30409505(2596753) SRR30537597(2579504) SRR30537676(2252935) SRR30608707(3505733) SRR30608737(2890905) SRR30608790(2205232) SRR30682056(1973051) SRR30682082(1569646) SRR30750592(1180505) SRR30779283(2322684) SRR30779313(2489514) SRR30779340(2283719)
('2024-07-01', '90000') ('2024-07-02', '150078') ('2024-07-02', '78365') ('2024-07-04', '78365') ('2024-07-03', '90000') ('2024-07-03', '150078') ('2024-07-16', '78365') ('2024-07-16', '150078') ('2024-07-15', '90000') ('2024-07-22', '90000') ('2024-07-23', '78365') ('2024-07-29', '90000') ('2024-07-30', '78365') ('2024-07-30', '150078') ('2024-08-06', '150078') ('2024-08-06', '78365') ('2024-08-05', '90000') ('2024-08-13', '78365') ('2024-08-13', '150078') ('2024-08-12', '90000') ('2024-08-20', '78365') ('2024-08-20', '150078') ('2024-08-19', '90000') ('2024-08-27', '78365') ('2024-08-27', '150078') ('2024-09-03', '150078') ('2024-09-02', '90000') ('2024-08-28', '90000') ('2024-09-09', '90000') ('2024-09-03', '78365') ('2024-09-12', '150078') ('2024-09-16', '78365') ('2024-09-17', '150078') ('2024-09-16', '90000')
Sequences Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Total samples Positives Sum Negatives Sum Total Sum
178 A178G 1904 0.051 16538 0.370 4267 0.081 79 0.001 23667 0.490 6072 0.094 13740 0.305 5419 0.249 8 1.641 0 1.641
279 T279A|(ORF1ab_polyprotein:T14A(V5D))|(ORF1a_polyprotein:T14A(V5D)) 1665 0.044 13601 0.306 1425 0.027 89 0.002 7552 0.156 67 0.001 3068 0.068 2238 0.103 8 0.707 0 0.707
344 C344T|(ORF1ab_polyprotein:C79T(L27F))|(ORF1a_polyprotein:C79T(L27F)) 13214 0.271 66377 0.557 2028 0.027 75 0.001 53400 0.427 6232 0.102 1439 0.046 7 1.431 0 1.431
364 C364A|(ORF1ab_polyprotein:C99A(D33E))|(ORF1a_polyprotein:C99A(D33E)) 13166 0.271 362 0.007 85762 0.720 30798 0.406 76 0.001 105674 0.845 17227 0.252 34357 0.564 16226 0.521 9 3.5869999999999997 0 3.5869999999999997
404 A404G|(ORF1ab_polyprotein:A139G(K47E))|(ORF1a_polyprotein:A139G(K47E)) 11542 0.237 62806 0.515 4937 0.065 6349 0.103 52004 0.416 3746 0.055 5268 0.086 7 1.4769999999999999 0 1.4769999999999999
425 GTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTT425-457del|(ORF1ab_polyprotein:160-192del(VEVEKGVLPQL54-64del))|(ORF1a_polyprotein:160-192del(VEVEKGVLPQL54-64del)) 9 0.030 63 0.234 62 0.400 9 0.075 34 0.246 56 0.583 6 1.568 0 1.568
486 C486T|(ORF1ab_polyprotein:C221T(S74L))|(ORF1a_polyprotein:C221T(S74L)) 9 0.030 62 0.230 62 0.400 9 0.075 35 0.252 55 0.573 6 1.56 0 1.56
488 G488A|(ORF1ab_polyprotein:G223A(D75N))|(ORF1a_polyprotein:G223A(D75N)) 9 0.030 63 0.234 63 0.406 9 0.075 35 0.252 56 0.583 6 1.58 0 1.58
632 C632T|(ORF1ab_polyprotein:C367T(L123F))|(ORF1a_polyprotein:C367T(L123F)) 9 0.030 68 0.247 9 0.035 67 0.427 9 0.075 37 0.266 50 0.556 7 1.6360000000000001 0 1.6360000000000001
663 G663A|(ORF1ab_polyprotein:G398A(G133D))|(ORF1a_polyprotein:G398A(G133D)) 11210 0.301 76251 0.668 23254 0.341 5994 0.087 75329 0.568 3520 0.045 16129 0.223 9720 0.238 8 2.471 0 2.471
669 GTT669-671del|(ORF1ab_polyprotein:AGTTAC403-408AACdel(SY135-136Ndel))|(ORF1a_polyprotein:AGTTAC403-408AACdel(SY135-136Ndel)) 21896 0.192 18432 0.271 33750 0.254 12086 0.167 9385 0.230 5 1.114 0 1.114
670 T670A|(ORF1ab_polyprotein:T405A(S135R))|(ORF1a_polyprotein:T405A(S135R)) 2755 0.034 4344 0.038 1671 0.025 18808 0.142 7001 0.089 5288 0.073 8588 0.210 2796 0.061 8 0.6719999999999999 0 0.6719999999999999
676 C676A|(ORF1ab_polyprotein:C411A(G137G))|(ORF1a_polyprotein:C411A(G137G)) 13430 0.118 18444 0.271 22917 0.173 12109 0.168 9389 0.230 5 0.96 0 0.96
751 C751T|(ORF1ab_polyprotein:C486T(N162N))|(ORF1a_polyprotein:C486T(N162N)) 5972 0.080 8387 0.344 3163 0.107 24017 0.566 7080 0.094 5405 0.097 11302 0.428 2805 0.061 8 1.777 0 1.777
1598 G1598T|(ORF1ab_polyprotein:G1333T(G445C))|(ORF1a_polyprotein:G1333T(G445C)) 330 0.022 558 0.069 6146 0.345 1943 0.078 28865 0.781 16427 0.322 10430 0.267 6681 0.453 8 2.337 0 2.337
2516 G2516T|(ORF1ab_polyprotein:G2251T(V751L))|(ORF1a_polyprotein:G2251T(V751L)) 339 0.022 4352 0.377 2715 0.122 5945 0.319 1395 0.197 5 1.037 0 1.037
linkedubiq 3037 RATG13,Delta C3037T|(ORF1ab_polyprotein:C2772T(F924F))|(ORF1a_polyprotein:C2772T(F924F)) 2831 0.993 4553 0.996 11275 0.995 4771 0.997 2417 0.996 11019 0.990 2433 0.991 12066 0.992 4132 0.997 7944 0.995 4233 0.995 8225 0.996 5994 0.996 6893 0.995 10269 0.996 2333 0.997 1703 0.996 1115 0.998 7927 0.997 2783 0.996 3668 0.996 3771 0.996 3132 0.996 5635 0.990 3198 0.990 3534 0.995 1818 0.992 1690 0.992 1243 0.998 4875 0.996 4555 0.996 3171 0.997 32 10.946 20.892 31.838
3096 C3096T|(ORF1ab_polyprotein:C2831T(S944L))|(ORF1a_polyprotein:C2831T(S944L)) 48 0.004 444 0.056 532 0.227 344 0.043 477 0.126 370 0.217 6 0.673 0 0.673
3247 T3247C|(ORF1ab_polyprotein:T2982C(S994S))|(ORF1a_polyprotein:T2982C(S994S)) 7 0.002 94 0.008 42 0.004 208 0.026 342 0.040 11493 0.827 1562 0.158 802 0.168 629 0.267 9 1.5 0 1.5
3341 A3341C|(ORF1ab_polyprotein:A3076C(N1026H))|(ORF1a_polyprotein:A3076C(N1026H)) 75 0.547 42 0.500 139 0.454 313 0.728 5745 0.491 913 0.425 339 0.320 504 0.706 8 4.171 0 4.171
3828 C3828T|(ORF1ab_polyprotein:C3563T(S1188L))|(ORF1a_polyprotein:C3563T(S1188L)) 191 0.013 487 0.038 2254 0.092 1143 0.038 4497 0.465 3832 0.128 4551 0.356 7148 0.463 8 1.593 0 1.593
4181 G4181T|(ORF1ab_polyprotein:G3916T(A1306S))|(ORF1a_polyprotein:G3916T(A1306S)) 210 0.018 391 0.042 1690 0.092 1128 0.042 2492 0.445 2444 0.101 1678 0.108 29 0.001 5372 0.424 9 1.272 0.001 1.273
4353 A4353C|(ORF1ab_polyprotein:A4088C(E1363A))|(ORF1a_polyprotein:A4088C(E1363A)) 215 0.018 1714 0.092 1125 0.041 2367 0.421 2494 0.103 1392 0.089 4651 0.365 7 1.129 0 1.129
4485 A4485G|(ORF1ab_polyprotein:A4220G(K1407R))|(ORF1a_polyprotein:A4220G(K1407R)) 613 0.018 671 0.021 6392 0.173 1400 0.029 12946 0.495 4173 0.092 3870 0.107 14726 0.408 8 1.343 0 1.343
4495 A4495C|(ORF1ab_polyprotein:A4230C(K1410N))|(ORF1a_polyprotein:A4230C(K1410N)) 4862 0.255 976 0.043 22 0.001 42 0.001 7988 0.396 10 0.001 4175 0.179 1652 0.075 101 0.002 133 0.003 42 0.002 9276 0.386 38 0.001 13 1.334 0.011 1.345
5218 T5218G|(ORF1ab_polyprotein:T4953G(N1651K))|(ORF1a_polyprotein:T4953G(N1651K)) 670 0.096 165 0.027 3 0.001 3337 0.443 623 0.070 487 0.057 4104 0.628 2562 0.209 1645 0.315 6207 0.686 10 2.531 0.001 2.532
5648 RATG13 A5648C|(ORF1ab_polyprotein:A5383C(K1795Q))|(ORF1a_polyprotein:A5383C(K1795Q)) 1633 0.109 6372 0.254 1445 0.051 12520 0.702 8205 0.238 6778 0.291 8612 0.560 7 2.205 0 2.205
5812 C5812T|(ORF1ab_polyprotein:C5547T(D1849D))|(ORF1a_polyprotein:C5547T(D1849D)) 375 0.029 1507 0.172 3 0.001 980 0.104 563 0.034 4147 0.588 2310 0.273 3404 0.590 8 1.79 0.001 1.791
6336 C6336T|(ORF1ab_polyprotein:C6071T(S2024L))|(ORF1a_polyprotein:C6071T(S2024L)) 1686 0.067 1977 0.072 15784 0.222 2722 0.047 40799 0.370 27106 0.299 41443 0.336 24276 0.385 8 1.798 0 1.798
6358 G6358A|(ORF1ab_polyprotein:G6093A(E2031E))|(ORF1a_polyprotein:G6093A(E2031E)) 560 0.022 3914 0.142 11266 0.158 2484 0.043 35123 0.318 5786 0.064 35528 0.288 15999 0.254 8 1.289 0 1.289
6378 A6378C|(ORF1ab_polyprotein:A6113C(N2038T))|(ORF1a_polyprotein:A6113C(N2038T)) 1682 0.067 2005 0.073 19457 0.273 5304 0.092 61561 0.558 38872 0.428 72018 0.583 43373 0.687 8 2.761 0 2.761
6402 C6402T|(ORF1ab_polyprotein:C6137T(P2046L))|(ORF1a_polyprotein:C6137T(P2046L)) 8599 0.343 4728 0.172 1294 0.032 53294 0.749 32096 0.557 1970 0.070 1820 0.050 97788 0.886 54622 0.602 98084 0.794 54149 0.858 11 5.043 0.07 5.113
6443 G6443T|(ORF1ab_polyprotein:G6178T(D2060Y))|(ORF1a_polyprotein:G6178T(D2060Y)) 8566 0.342 8690 0.316 55489 0.780 32685 0.568 1814 0.050 105860 0.957 60389 0.665 106859 0.865 52651 0.835 9 5.378 0 5.378
6447 T6447C|(ORF1ab_polyprotein:T6182C(V2061A))|(ORF1a_polyprotein:T6182C(V2061A)) 7543 0.301 7706 0.280 51066 0.718 30996 0.539 100494 0.909 60261 0.664 100205 0.811 50838 0.806 8 5.0280000000000005 0 5.0280000000000005
6633 RATG13 C6633T|(ORF1ab_polyprotein:C6368T(A2123V))|(ORF1a_polyprotein:C6368T(A2123V)) 413 0.133 706 0.221 807 0.119 958 0.583 1451 0.303 689 0.167 854 0.370 161 0.041 8 1.937 0 1.937
7040 A7040C|(ORF1ab_polyprotein:A6775C(M2259L))|(ORF1a_polyprotein:A6775C(M2259L)) 406 0.028 2010 0.137 1476 0.070 1852 0.259 3313 0.092 5169 0.199 8551 0.415 7 1.2 0 1.2
7124 C7124T|(ORF1ab_polyprotein:C6859T(P2287S))|(ORF1a_polyprotein:C6859T(P2287S)) 841 0.059 211 0.033 3952 0.270 3039 0.144 896 0.036 4366 0.611 9934 0.276 10942 0.422 12048 0.589 1008 0.041 10 2.481 0 2.481
7622 G7622A|(ORF1ab_polyprotein:G7357A(V2453I))|(ORF1a_polyprotein:G7357A(V2453I)) 435 0.141 97 0.047 582 0.120 336 0.175 3208 0.251 1574 0.105 382 0.076 7 0.9149999999999999 0 0.9149999999999999
7881 A7881G|(ORF1ab_polyprotein:A7616G(N2539S))|(ORF1a_polyprotein:A7616G(N2539S)) 4581 0.165 1181 0.049 16029 0.401 4887 0.118 28889 0.740 21295 0.453 25914 0.553 21820 0.644 8 3.123 0 3.123
8039 G8039A|(ORF1ab_polyprotein:G7774A(D2592N))|(ORF1a_polyprotein:G7774A(D2592N)) 809 0.029 9554 0.239 13105 0.335 15881 0.337 10682 0.228 11420 0.336 6 1.504 0 1.504
8040 A8040G|(ORF1ab_polyprotein:A7775G(D2592G))|(ORF1a_polyprotein:A7775G(D2592G)) 2464 0.088 2216 0.055 3335 0.080 14370 0.368 5380 0.114 15198 0.324 10549 0.311 7 1.34 0 1.34
8389 RATG13 C8389T|(ORF1ab_polyprotein:C8124T(N2708N))|(ORF1a_polyprotein:C8124T(N2708N)) 4209 0.122 21198 0.394 5353 0.090 27410 0.688 6939 0.110 7497 0.152 16526 0.596 7 2.152 0 2.152
8535 A8535G|(ORF1ab_polyprotein:A8270G(K2757R))|(ORF1a_polyprotein:A8270G(K2757R)) 358 0.163 2515 0.394 966 0.203 1902 0.769 1584 0.395 1070 0.439 2104 0.612 7 2.975 0 2.975
8682 T8682C|(ORF1ab_polyprotein:T8417C(I2806T))|(ORF1a_polyprotein:T8417C(I2806T)) 360 0.164 2592 0.406 955 0.201 1730 0.703 1583 0.394 1073 0.440 1993 0.581 7 2.889 0 2.889
8986 C8986T|(ORF1ab_polyprotein:C8721T(D2907D))|(ORF1a_polyprotein:C8721T(D2907D)) 1281 0.111 432 0.026 7158 0.454 1749 0.095 9228 0.588 3169 0.193 6396 0.345 5197 0.594 8 2.406 0 2.406
9053 G9053T|(ORF1ab_polyprotein:G8788T(V2930L))|(ORF1a_polyprotein:G8788T(V2930L)) 1767 0.117 435 0.020 11214 0.454 2299 0.088 11995 0.616 4733 0.240 8220 0.355 7617 0.615 8 2.505 0 2.505
9073 RATG13 C9073T|(ORF1ab_polyprotein:C8808T(T2936T))|(ORF1a_polyprotein:C8808T(T2936T)) 5204 0.209 281 0.011 4146 0.212 4295 0.217 3562 0.153 4252 0.341 1377 0.062 357 0.039 8 1.205 0.039 1.244
ubiq 10029 C10029T|(ORF1ab_polyprotein:C9764T(T3255I))|(ORF1a_polyprotein:C9764T(T3255I)) 395 0.992 2769 0.995 3033 0.997 4133 0.993 238 0.996 1437 0.950 4814 0.995 1260 0.998 1081 0.996 1043 0.996 3461 0.994 1538 0.995 5555 0.993 3503 0.991 2386 0.995 4532 0.996 4113 0.979 816 0.994 1298 0.993 5024 0.965 1349 0.992 4597 0.995 3203 0.994 2528 0.994 1389 0.991 1310 0.986 1824 0.994 2054 0.989 3053 0.989 652 0.994 4658 0.993 3440 0.995 3436 0.926 33 10.888 21.747 32.635
linked 10969 C10969T|(ORF1ab_polyprotein:C10704T(F3568F))|(ORF1a_polyprotein:C10704T(F3568F)) 788 0.111 2570 0.206 1692 0.126 2107 0.362 698 0.047 1131 0.083 1969 0.252 1402 0.165 8 1.1 0.252 1.352
linked 11001 C11001T|(ORF1ab_polyprotein:C10736T(T3579I))|(ORF1a_polyprotein:C10736T(T3579I)) 1047 0.148 154 0.008 6160 0.494 2063 0.154 4295 0.737 1195 0.115 706 0.047 3792 0.278 5244 0.616 9 2.474 0.123 2.5970000000000004
11014 G11014A|(ORF1ab_polyprotein:G10749A(L3583L))|(ORF1a_polyprotein:G10749A(L3583L)) 796 0.112 2019 0.162 1695 0.127 2154 0.370 708 0.048 1121 0.082 1377 0.162 7 1.063 0 1.063
11201 A11201G|(ORF1ab_polyprotein:A10936G(T3646A))|(ORF1a_polyprotein:A10936G(T3646A)) 2544 0.110 1361 0.058 12491 0.445 4388 0.115 14111 0.719 4324 0.102 9188 0.311 15133 0.658 8 2.518 0 2.518
11332 A11332G|(ORF1ab_polyprotein:A11067G(V3689V))|(ORF1a_polyprotein:A11067G(V3689V)) 1476 0.092 1325 0.083 6077 0.388 2272 0.092 9310 0.690 3587 0.128 4656 0.291 9425 0.645 8 2.409 0 2.409
13827 TGCTTTAAGGCATTT13827-13841del|(ORF1ab_polyprotein:TATGCTTTAAGGCATTTT13561-13578TATdel(YALRHF4521-4526Ydel)) 1349 0.101 1193 0.054 6175 0.232 6388 0.205 830 0.035 11987 0.373 2473 0.106 7254 0.202 7244 0.198 1032 0.038 10 1.544 0 1.544
13827 TGCTTTAAGGCATTTT13827-13842del|(ORF1ab_polyprotein:13563-13578del(4521fs)) 368 0.028 1755 0.080 4822 0.181 2200 0.071 12759 0.397 5959 0.256 20980 0.585 21845 0.597 8 2.195 0 2.195
13926 G13926A|(ORF1ab_polyprotein:G13662A(W4554*)) 591 0.044 1581 0.072 9625 0.358 5525 0.176 857 0.035 24210 0.747 6817 0.290 26841 0.742 32915 0.887 1041 0.038 10 3.389 0 3.389
13993 G13993C|(ORF1ab_polyprotein:G13729C(A4577P)) 619 0.028 2100 0.078 993 0.032 35 0.002 35 0.001 28 0.001 5183 0.161 507 0.022 5765 0.159 14 0.001 18 0.001 11953 0.322 12 0.803 0.005 0.808
13993 G13993T|(ORF1ab_polyprotein:G13729T(A4577S)) 1234 0.092 2917 0.132 5522 0.206 4611 0.147 14030 0.436 4010 0.171 16015 0.443 16925 0.456 8 2.083 0 2.083
14023 G14023A|(ORF1ab_polyprotein:G13759A(A4587T)) 1844 0.069 780 0.025 862 0.035 13769 0.428 5064 0.216 11987 0.331 8573 0.231 1045 0.039 8 1.374 0 1.374
14104 TTCA14104-14107del|(ORF1ab_polyprotein:13840-13843del(4614fs)) 1887 0.036 9467 0.114 987 0.012 6536 0.085 10345 0.114 12008 0.129 16077 0.205 7 0.695 0 0.695
14110 C14110-14110del|(ORF1ab_polyprotein:13846-13846del(4616fs)) 1888 0.036 9910 0.119 989 0.012 6655 0.087 10351 0.114 12014 0.129 16105 0.205 7 0.702 0 0.702
14176 ACCTT14176-14180del|(ORF1ab_polyprotein:13912-13916del(4638fs)) 4591 0.082 4063 0.075 24836 0.556 30121 0.442 24674 0.431 25422 0.607 6 2.193 0 2.193
14262 C14262T|(ORF1ab_polyprotein:C13998T(D4666D)) 6679 0.240 4913 0.164 38628 0.689 21338 0.393 39015 0.873 41211 0.603 36606 0.638 39854 0.948 8 4.548 0 4.548
14320 T14320C|(ORF1ab_polyprotein:T14056C(Y4686H)) 5588 0.100 4938 0.091 27876 0.622 35263 0.516 30474 0.531 33445 0.796 6 2.656 0 2.656
linkedubiq 14408 Delta C14408T|(ORF1ab_polyprotein:C14144T(P4715L)) 22642 0.999 35237 0.999 28433 0.968 30146 0.944 79156 0.999 29563 0.999 51164 0.999 15963 0.999 422 0.998 38131 0.994 55089 0.934 1650 1.000 56971 0.977 42813 0.998 40526 0.998 40254 0.998 23091 0.999 46778 0.995 15263 0.998 16792 0.999 70108 0.999 31649 0.999 47666 0.999 59124 0.998 23984 0.997 70438 0.862 43730 0.998 44079 0.998 28351 0.998 44195 0.984 25789 0.998 40771 0.999 32292 0.998 41106 0.999 34 10.795 22.825 33.62
14419 14419-insertGACAGCGGACTTTC|(ORF1ab_polyprotein:14155insertGACAGCGGACTTTC(4719fs)) 6014 0.102 5224 0.089 200 0.005 29113 0.616 32820 0.467 30427 0.512 28797 0.638 7 2.429 0 2.429
14605 C14605T|(ORF1ab_polyprotein:C14341T(L4781L)) 54 0.031 786 0.265 784 0.190 219 0.055 826 0.401 338 0.165 716 0.338 972 0.301 8 1.746 0 1.746
14808 T14808C|(ORF1ab_polyprotein:T14544C(Y4848Y)) 1223 0.164 753 0.085 335 0.087 673 0.063 636 0.103 1234 0.255 6 0.757 0 0.757
14925 C14925T|(ORF1ab_polyprotein:C14661T(V4887V)) 185 0.056 181 0.033 2462 0.330 969 0.109 2431 0.636 1420 0.132 2722 0.442 3499 0.724 8 2.462 0 2.462
15017 C15017T|(ORF1ab_polyprotein:C14753T(A4918V)) 185 0.010 182 0.006 2352 0.095 442 0.012 2406 0.158 1779 0.053 2702 0.145 3475 0.233 8 0.712 0 0.712
15451 G15451A|(ORF1ab_polyprotein:G15187A(G5063S)) 3159 0.165 5737 0.181 27972 0.663 22046 0.558 55 0.002 761 0.021 48192 0.881 28308 0.538 35161 0.698 26813 0.906 10 4.611 0.002 4.6129999999999995
15661 T15661-15661del|(ORF1ab_polyprotein:15397-15397del(5133fs)) 310 0.011 240 0.006 4609 0.073 2386 0.038 9957 0.116 7321 0.104 11058 0.165 12817 0.221 8 0.734 0 0.734
15871 G15871T|(ORF1ab_polyprotein:G15607T(E5203*)) 442 0.079 2299 0.255 3211 0.333 13712 0.593 11375 0.470 1806 0.123 27369 0.829 11232 0.568 11456 0.615 27006 0.885 493 0.046 11 4.717 0.079 4.795999999999999
15933 C15933T|(ORF1ab_polyprotein:C15669T(Y5223Y)) 2174 0.241 3232 0.335 13475 0.583 11330 0.468 1814 0.124 27350 0.829 10498 0.531 11432 0.614 26721 0.876 490 0.045 10 4.646 0 4.646
15938 A15938C|(ORF1ab_polyprotein:A15674C(D5225A)) 780 0.086 308 0.032 7339 0.318 4808 0.198 787 0.054 10571 0.320 6144 0.311 3661 0.197 8091 0.265 9 1.7810000000000001 0 1.7810000000000001
15942 A15942T|(ORF1ab_polyprotein:A15678T(P5226P)) 2480 0.275 4586 0.475 17165 0.743 12483 0.515 1810 0.124 30911 0.937 11969 0.605 13547 0.729 28464 0.934 490 0.045 10 5.382 0 5.382
15959 C15959T|(ORF1ab_polyprotein:C15695T(A5232V)) 537 0.060 1204 0.125 4079 0.177 2695 0.112 12553 0.382 5021 0.254 7352 0.397 16357 0.540 489 0.045 9 2.092 0 2.092
15963 CTGTT15963-15967del|(ORF1ab_polyprotein:15699-15703del(5233fs)) 2284 0.254 3197 0.333 13543 0.591 10533 0.438 1792 0.124 27047 0.826 10987 0.559 11289 0.613 26401 0.876 485 0.045 10 4.659 0 4.659
16007 T16007A|(ORF1ab_polyprotein:ATT15742-15744AAG(I5248K)) 3361 0.049 1269 0.016 9553 0.154 5417 0.062 7760 0.123 14762 0.307 492 0.008 7 0.719 0 0.719
16008 T16008G|(ORF1ab_polyprotein:ATT15742-15744AAG(I5248K)) 3361 0.049 1269 0.016 9553 0.154 5417 0.062 7760 0.123 14762 0.307 492 0.008 7 0.719 0 0.719
16008 T16008G|(ORF1ab_polyprotein:T15744G(I5248M)) 2723 0.058 4603 0.076 13733 0.201 11154 0.140 1806 0.025 21274 0.343 6540 0.075 5715 0.091 13645 0.284 9 1.293 0 1.293
16017 RATG13 C16017T|(ORF1ab_polyprotein:C15753T(F5251F)) 3352 0.049 1275 0.016 10209 0.164 4583 0.052 7601 0.120 15265 0.316 492 0.008 7 0.725 0 0.725
16887 C16887T|(ORF1ab_polyprotein:C16623T(Y5541Y)) 3930 0.133 3578 0.077 736 0.011 11880 0.264 6197 0.126 24490 0.682 16486 0.249 16359 0.361 14546 0.539 9 2.442 0 2.442
17236 A17236G|(ORF1ab_polyprotein:A16972G(I5658V)) 4303 0.175 3966 0.098 25160 0.494 11213 0.219 97 0.003 40950 0.845 257 0.009 14550 0.316 23379 0.492 32356 0.813 1506 0.035 11 3.4899999999999998 0.009 3.4989999999999997
18744 RATG13 C18744T|(ORF1ab_polyprotein:C18480T(Y6160Y)) 4358 0.071 4860 0.127 5030 0.118 1048 0.023 5541 0.181 4727 0.097 5936 0.128 6957 0.292 8 1.014 0.023 1.037
ubiq 18894 C18894T|(ORF1ab_polyprotein:C18630T(C6210C)) 17563 0.998 26578 0.998 21457 0.994 45851 0.997 27204 0.998 6506 0.998 15281 0.998 25551 0.998 3445 0.986 9946 0.971 14977 0.998 10129 0.958 10160 0.999 49941 0.997 36174 0.998 8112 0.998 5213 0.779 5670 0.999 3283 0.999 17052 0.989 20087 0.998 6073 0.999 26857 0.969 23732 0.997 27274 0.995 20906 0.995 37887 0.997 22235 0.997 7133 0.951 29536 0.998 43115 0.997 47411 0.998 45139 0.998 33 10.600999999999999 21.938 32.539
linked 19186 C19186T|(ORF1ab_polyprotein:C18922T(L6308L)) 286 0.006 1678 0.092 991 0.054 592 0.068 97 0.004 1743 0.048 860 0.080 7 0.352 0 0.352
19220 C19220T|(ORF1ab_polyprotein:C18956T(A6319V)) 18 0.003 279 0.059 1714 0.204 1006 0.130 605 0.277 98 0.009 1750 0.196 876 0.246 8 1.124 0 1.124
20298 A20298G|(ORF1ab_polyprotein:A20034G(K6678K)) 364 0.083 401 0.107 896 0.291 371 0.163 1709 0.698 751 0.166 1028 0.195 1539 0.401 8 2.104 0 2.104
20846 A20846G|(ORF1ab_polyprotein:A20582G(Y6861C)) 3932 0.107 3444 0.084 18714 0.439 11269 0.219 29137 0.740 6759 0.110 8365 0.225 9131 0.402 8 2.326 0 2.326
20991 G20991A|(ORF1ab_polyprotein:G20727A(L6909L)) 644 0.018 3350 0.082 5171 0.122 6975 0.136 17557 0.447 1750 0.047 1757 0.078 7 0.93 0 0.93
21608 G21608T|(surface_glycoprotein:G46T(V16F)) 474 0.195 1628 0.447 8723 0.724 4851 0.684 9188 0.902 4922 0.663 9335 0.850 2831 0.690 8 5.155 0 5.155
21611 A21611G|(surface_glycoprotein:A49G(N17D)) 473 0.195 1631 0.448 1573 0.131 3107 0.438 8199 0.804 2531 0.341 7572 0.690 2833 0.692 2 0.003 9 3.739 0.003 3.742
21615 T21615C|(surface_glycoprotein:T53C(L18P)) 7863 0.771 4 0.002 2242 0.302 7765 0.707 2 0.002 2829 0.691 6 2.471 0.004 2.475
21617 A21617G|(surface_glycoprotein:ACA55-57GAA(T19E)) 9092 0.756 1833 0.258 1471 0.144 2399 0.323 1573 0.143 5 1.624 0 1.624
21618 C21618A|(surface_glycoprotein:ACA55-57GAA(T19E)) 9092 0.756 1833 0.258 1471 0.144 2399 0.323 1573 0.143 5 1.624 0 1.624
21618 C21618A|(surface_glycoprotein:C56A(T19K)) 474 0.195 1630 0.448 1574 0.131 3120 0.439 4 0.002 7814 0.766 2530 0.341 7776 0.708 2831 0.691 9 3.719 0.002 3.7209999999999996
21633 T21633C|(surface_glycoprotein:T71C(L24S)) 472 0.194 1634 0.449 10710 0.889 4943 0.695 9671 0.948 4932 0.665 9353 0.851 2829 0.691 8 5.382 0 5.382
21657 RATG13 T21657C|(surface_glycoprotein:T95C(F32S)) 470 0.192 1642 0.445 10865 0.890 4999 0.698 9367 0.912 4934 0.664 9357 0.851 2831 0.690 8 5.342 0 5.342
21701 G21701A|(surface_glycoprotein:G139A(V47I)) 4 0.001 6902 0.568 3834 0.537 9258 0.900 4641 0.630 9401 0.855 2623 0.644 7 4.135 0 4.135
21707 C21707T|(surface_glycoprotein:C145T(H49Y)) 6888 0.566 3838 0.537 4 0.004 9227 0.897 4638 0.630 9412 0.856 2620 0.644 7 4.13 0.004 4.1339999999999995
linked 21721 RATG13 C21721T|(surface_glycoprotein:C159T(D53D)) 1191 0.324 110 0.009 303 0.042 202 0.050 4 0.425 0 0.425
21765 T21765C|(surface_glycoprotein:T203C(I68T)) 1186 0.772 103 0.013 305 0.064 103 0.011 279 0.054 308 0.104 6 1.018 0 1.018
21767 C21767A|(surface_glycoprotein:C205A(H69N)) 1183 0.770 104 0.014 304 0.064 102 0.011 282 0.055 309 0.104 6 1.018 0 1.018
21800 G21800A|(surface_glycoprotein:G238A(D80N)) 6834 0.888 3809 0.796 9014 0.962 4636 0.898 9401 0.993 2494 0.841 6 5.378 0 5.378
21801 A21801G|(surface_glycoprotein:A239G(D80G)) 1182 0.771 241 0.031 308 0.064 30 0.003 204 0.069 5 0.9380000000000001 0 0.9380000000000001
21846 C21846T|(surface_glycoprotein:C284T(T95I)) 1175 0.766 7063 0.919 4095 0.856 3 0.007 9132 0.976 4910 0.952 9387 0.992 2798 0.944 8 6.405 0.007 6.412
21973 T21973A|(surface_glycoprotein:T411A(N137K)) 398 0.031 531 0.074 4723 0.334 3012 0.150 461 0.023 4665 0.640 4510 0.190 4459 0.288 4711 0.441 9 2.171 0 2.171
21986 G21986A|(surface_glycoprotein:GGT424-426AAT(G142N)) 117 0.009 279 0.039 2557 0.181 908 0.045 455 0.022 1977 0.271 4516 0.190 2944 0.190 3000 0.281 9 1.228 0 1.228
21987 G21987A|(surface_glycoprotein:GGT424-426AAT(G142N)) 117 0.009 279 0.039 2557 0.181 908 0.045 455 0.022 1977 0.271 4516 0.190 2944 0.190 3000 0.281 9 1.228 0 1.228
21987 G21987C|(surface_glycoprotein:G425C(G142A)) 277 0.021 248 0.034 1557 0.110 1472 0.073 2678 0.368 1513 0.098 1698 0.159 7 0.863 0 0.863
21990 TTTATTACCACA21990-22001del|(surface_glycoprotein:GTTTATTACCACAAA427-441GAAdel(VYYHK143-147Edel)) 397 0.031 526 0.073 4739 0.335 3632 0.181 455 0.022 4659 0.640 4508 0.190 2944 0.190 3950 0.369 9 2.031 0 2.031
22014 G22014A|(surface_glycoprotein:G452A(S151N)) 278 0.022 245 0.034 2184 0.154 2572 0.128 2754 0.378 2132 0.137 1913 0.179 7 1.032 0 1.032
22022 G22022C|(surface_glycoprotein:G460C(E154Q)) 281 0.022 245 0.034 2196 0.155 3058 0.152 2813 0.386 2145 0.138 2815 0.263 7 1.1500000000000001 0 1.1500000000000001
22022 G22022T|(surface_glycoprotein:GAA460-462TCA(E154S)) 116 0.009 288 0.040 1300 0.092 447 0.022 1559 0.214 4518 0.190 2330 0.150 1911 0.178 8 0.895 0 0.895
22023 A22023C|(surface_glycoprotein:GAA460-462TCA(E154S)) 116 0.009 288 0.040 1300 0.092 447 0.022 1559 0.214 4518 0.190 2330 0.150 1911 0.178 8 0.895 0 0.895
22029 Delta AGTTCA22029-22034del|(surface_glycoprotein:GAGTTCAGA466-474GGAdel(EFR156-158Gdel)) 397 0.031 527 0.073 4737 0.335 3630 0.180 450 0.022 4668 0.640 4524 0.190 4465 0.288 4713 0.440 9 2.199 0 2.199
22054 T22054G|(surface_glycoprotein:T492G(N164K)) 398 0.031 534 0.074 4706 0.333 3029 0.150 443 0.022 4577 0.627 4487 0.189 4444 0.286 4698 0.438 9 2.15 0 2.15
22082 C22082T|(surface_glycoprotein:C520T(P174S)) 117 0.009 371 0.051 4678 0.330 3612 0.179 440 0.022 4584 0.628 4455 0.187 4387 0.283 4691 0.438 9 2.127 0 2.127
22088 C22088T|(surface_glycoprotein:C526T(L176F)) 615 0.048 377 0.052 4445 0.314 3515 0.174 434 0.021 4607 0.630 4448 0.187 4388 0.283 4205 0.392 9 2.101 0 2.101
22120 C22120T|(surface_glycoprotein:C558T(F186F)) 370 0.029 530 0.073 4614 0.326 3571 0.177 426 0.021 4579 0.626 4432 0.186 4385 0.283 4625 0.431 9 2.152 0 2.152
22135 A22135G|(surface_glycoprotein:A573G(E191E)) 376 0.029 522 0.072 4637 0.327 3571 0.177 423 0.021 4571 0.624 4424 0.186 4375 0.282 4597 0.429 9 2.147 0 2.147
22163 T22163C|(surface_glycoprotein:T601C(F201L)) 369 0.016 505 0.031 4642 0.149 3561 0.090 443 0.012 4596 0.365 4405 0.097 4376 0.161 4584 0.236 9 1.157 0 1.157
22200 T22200A|(surface_glycoprotein:T638A(V213E)) 545 0.024 2172 0.131 1128 0.023 7798 0.248 6674 0.168 1807 0.048 454 0.013 6615 0.519 7124 0.156 7188 0.262 190 0.002 9869 0.504 2452 0.065 13 2.09 0.073 2.163
22286 CTTG22286-22289del|(surface_glycoprotein:724-727del(242fs)) 169 0.016 2496 0.140 226 0.011 523 0.098 671 0.029 1389 0.110 3564 0.382 535 0.032 8 0.8180000000000001 0 0.8180000000000001
22289 GCTTTA22289-22294del|(surface_glycoprotein:727-732del(AL243-244del)) 1045 0.153 751 0.042 1447 0.073 1464 0.275 2208 0.094 1643 0.130 2268 0.243 7 1.01 0 1.01
22294 AC22294-22295del|(surface_glycoprotein:732-733del(244fs)) 169 0.016 2497 0.140 229 0.012 523 0.098 672 0.029 1391 0.110 3576 0.383 534 0.032 8 0.8200000000000001 0 0.8200000000000001
22432 C22432T|(surface_glycoprotein:C870T(D290D)) 51 0.005 2489 0.139 68 0.003 509 0.096 662 0.028 1477 0.117 4149 0.445 7 0.8330000000000001 0 0.8330000000000001
linked 22599 RATG13 G22599C|(surface_glycoprotein:G1037C(R346T)) 2794 0.996 3126 0.813 1828 0.637 1085 0.743 1358 0.996 1222 0.816 4199 0.725 1738 0.640 17297 0.997 3732 0.514 2822 0.594 6042 0.994 4618 0.665 4666 0.672 10293 0.646 6474 0.442 9696 0.464 6508 0.810 4096 0.756 6225 0.830 10202 0.624 8212 0.569 5823 0.500 8251 0.660 11864 0.553 21920 0.372 8547 0.378 15568 0.581 1882 0.252 1834 0.644 17785 0.463 3681 0.467 8982 0.469 4003 0.392 34 7.011 14.663 21.674
22624 C22624A|(surface_glycoprotein:C1062A(N354K)) 2 0.001 60 0.010 420 0.088 446 0.064 223 0.015 2414 0.301 669 0.041 832 0.067 800 0.281 9 0.868 0 0.868
22661 G22661T|(surface_glycoprotein:G1099T(V367F)) 45 0.016 23 0.016 62 0.011 405 0.085 368 0.053 230 0.016 2468 0.308 839 0.051 822 0.066 895 0.314 10 0.936 0 0.936
22713 C22713T|(surface_glycoprotein:C1151T(P384L)) 94 0.033 39 0.027 60 0.010 1006 0.212 518 0.075 225 0.015 3389 0.424 2686 0.165 2154 0.173 996 0.350 10 1.484 0 1.484
linked 22770 G22770A|(surface_glycoprotein:G1208A(R403K)) 2787 0.892 3810 0.572 2841 0.607 1452 0.532 1353 0.775 1483 0.478 5706 0.815 2691 0.920 17074 0.988 7217 0.970 4700 0.569 6035 0.955 6851 0.592 6895 0.800 15743 0.916 14511 0.930 20760 0.998 8012 0.859 5390 0.947 7432 0.955 16006 0.707 14234 0.965 11451 0.838 12413 0.749 21270 0.974 58240 0.992 22231 0.746 26637 0.985 7387 0.881 2815 0.429 38286 0.973 7806 0.831 19025 0.952 10175 0.988 34 7.62 20.46 28.080000000000002
22776 A22776G|(surface_glycoprotein:A1214G(D405G)) 446 0.095 156 0.057 60 0.009 3305 0.400 3312 0.286 226 0.014 4562 0.489 6547 0.289 5769 0.348 4559 0.695 10 2.682 0 2.682
22812 A22812C|(surface_glycoprotein:A1250C(K417T)) 455 0.097 157 0.057 61 0.009 3298 0.402 3355 0.290 226 0.014 4617 0.495 6580 0.291 5830 0.351 4623 0.702 10 2.7079999999999997 0 2.7079999999999997
22820 G22820A|(surface_glycoprotein:G1258A(D420N)) 451 0.097 157 0.057 62 0.009 3287 0.401 3355 0.290 225 0.014 4589 0.492 6574 0.291 5819 0.351 4584 0.697 10 2.699 0 2.699
22855 RATG13 C22855T|(surface_glycoprotein:C1293T(G431G)) 354 0.076 101 0.037 2278 0.278 2788 0.241 1188 0.128 3947 0.175 3706 0.224 3623 0.552 8 1.711 0 1.711
linkedubiq 22882 T22882G|(surface_glycoprotein:T1320G(N440K)) 334 1.000 2873 0.997 1843 0.996 1186 0.997 394 0.997 1620 0.999 1258 0.999 218 1.000 219 0.995 3497 0.999 281 0.996 4702 0.998 1735 0.998 1454 0.997 1107 0.998 1269 0.998 322 1.000 331 1.000 6556 0.997 410 0.998 2116 0.998 4199 0.998 521 0.996 233 1.000 7581 0.993 315 1.000 996 0.998 3754 0.997 1010 0.999 1658 0.995 929 0.999 101 1.000 32 10.972 20.96 31.932000000000002
22893 A22893G|(surface_glycoprotein:A1331G(K444R)) 355 0.192 92 0.077 2241 0.640 2759 0.586 1146 0.902 3932 0.598 3688 0.876 3610 0.959 5 0.003 9 4.833 0 4.833
22898 G22898A|(surface_glycoprotein:GGT1336-1338AAT(G446N)) 355 0.192 92 0.077 2239 0.639 2757 0.585 1148 0.904 3943 0.600 3692 0.877 3589 0.953 8 4.827 0 4.827
22899 G22899A|(surface_glycoprotein:GGT1336-1338AAT(G446N)) 355 0.192 92 0.077 2239 0.639 2757 0.585 1148 0.904 3943 0.600 3692 0.877 3589 0.953 8 4.827 0 4.827
22910 A22910G|(surface_glycoprotein:AAT1348-1350GAA(N450E)) 357 0.193 92 0.077 2172 0.620 2757 0.585 1150 0.904 3937 0.599 3692 0.877 3597 0.955 8 4.81 0 4.81
22912 T22912A|(surface_glycoprotein:AAT1348-1350GAA(N450E)) 357 0.193 92 0.077 2172 0.620 2757 0.585 1150 0.904 3937 0.599 3692 0.877 3597 0.955 8 4.81 0 4.81
22917 T22917A|(surface_glycoprotein:T1355A(L452Q)) 357 0.193 91 0.077 2237 0.638 2759 0.586 1151 0.904 3942 0.599 3691 0.877 3596 0.955 8 4.829 0 4.829
22942 T22942G|(surface_glycoprotein:T1380G(N460K)) 357 0.193 92 0.077 2238 0.638 2684 0.570 1150 0.903 3937 0.599 3690 0.876 3598 0.955 8 4.811 0 4.811
22988 G22988A|(surface_glycoprotein:G1426A(G476S)) 2 0.001 1010 0.288 6 0.001 323 0.253 3332 0.507 2341 0.557 2754 0.731 7 2.338 0 2.338
linkedubiq 22992 G22992A|(surface_glycoprotein:G1430A(S477N)) 333 1.000 2873 0.998 1847 0.999 1195 1.000 395 1.000 1622 1.000 1260 1.000 218 1.000 220 1.000 2769 0.790 281 1.000 4639 0.985 1736 0.998 1455 0.999 1105 0.998 1123 0.880 318 1.000 331 1.000 6548 0.997 407 0.990 2110 0.996 4201 0.999 522 0.998 233 1.000 7616 0.998 315 1.000 997 0.999 3736 0.992 1004 0.996 1660 0.997 928 0.999 101 1.000 32 10.637 20.971 31.608
23009 G23009T|(surface_glycoprotein:GTT1447-1449TAT(V483Y)) 354 0.192 1415 0.404 1240 0.263 1155 0.907 3914 0.596 3679 0.876 3586 0.954 7 4.192 0 4.192
23010 T23010A|(surface_glycoprotein:GTT1447-1449TAT(V483Y)) 354 0.192 1415 0.404 1240 0.263 1155 0.907 3914 0.596 3679 0.876 3586 0.954 7 4.192 0 4.192
23012 RATG13 G23012A|(surface_glycoprotein:GAA1450-1452ATA(E484I)) 355 0.192 92 0.077 2222 0.634 2749 0.584 1156 0.907 3903 0.595 3675 0.875 3578 0.952 8 4.816 0 4.816
23013 A23013T|(surface_glycoprotein:GAA1450-1452ATA(E484I)) 355 0.192 92 0.076 2222 0.634 2749 0.583 1156 0.907 3903 0.595 3675 0.875 3578 0.952 8 4.814 0 4.814
linkedubiq 23018 RATG13 T23018C|(surface_glycoprotein:TTT1456-1458CCT(F486P)) 333 1.000 2868 0.998 1843 0.998 1202 0.999 394 0.997 903 0.557 1257 0.998 218 1.000 217 0.986 3500 0.998 281 1.000 4705 0.998 1736 0.998 1452 0.997 1107 0.999 1274 1.000 317 0.997 331 1.000 6545 0.997 410 0.998 2115 0.999 4195 0.998 522 0.998 231 0.996 7601 0.997 313 0.997 997 0.999 3747 0.997 1005 0.997 1661 0.997 928 0.999 101 1.000 32 10.979 20.51 31.489
linkedubiq 23019 T23019C|(surface_glycoprotein:TTT1456-1458CCT(F486P)) 333 1.000 2868 0.998 1843 0.998 1202 0.999 394 0.997 903 0.557 1257 0.998 218 1.000 217 0.986 3500 0.998 281 1.000 4705 0.998 1736 0.998 1452 0.997 1107 0.999 1274 1.000 317 0.997 331 1.000 6545 0.997 410 0.998 2115 0.999 4195 0.998 522 0.998 231 0.996 7601 0.997 313 0.997 997 0.999 3747 0.997 1005 0.997 1661 0.997 928 0.999 101 1.000 32 10.979 20.51 31.489
23031 RATG13 T23031A|(surface_glycoprotein:T1469A(F490Y)) 355 0.192 92 0.076 1700 0.485 2691 0.571 1153 0.906 3906 0.595 3678 0.875 3578 0.952 8 4.652 0 4.652
23039 C23039A|(surface_glycoprotein:C1477A(Q493K)) 358 0.194 92 0.077 2220 0.633 2757 0.585 1151 0.904 3904 0.595 3681 0.876 3576 0.953 8 4.817 0 4.817
23054 RATG13 C23054T|(surface_glycoprotein:CAA1492-1494TAC(Q498Y)) 7 0.004 92 0.077 2103 0.603 1889 0.402 1135 0.893 3888 0.595 3601 0.859 3563 0.954 8 4.387 0 4.387
23056 RATG13 A23056C|(surface_glycoprotein:CAA1492-1494TAC(Q498Y)) 7 0.004 92 0.077 2101 0.603 1889 0.402 1135 0.893 3888 0.595 3598 0.859 3558 0.953 8 4.386 0 4.386
23057 C23057A|(surface_glycoprotein:C1495A(P499T)) 5 0.003 92 0.077 2099 0.602 1895 0.403 1129 0.888 3877 0.593 3595 0.858 3541 0.948 8 4.372 0 4.372
23061 C23061A|(surface_glycoprotein:C1499A(T500N)) 8 0.004 91 0.076 2104 0.604 1900 0.404 1132 0.891 3888 0.595 3597 0.858 3550 0.951 8 4.383 0 4.383
23064 A23064C|(surface_glycoprotein:A1502C(N501T)) 8 0.004 92 0.077 2102 0.603 1898 0.404 1134 0.892 3886 0.594 3600 0.859 3550 0.951 8 4.384 0 4.384
23073 G23073A|(surface_glycoprotein:G1511A(G504D)) 353 0.192 92 0.077 2202 0.632 2748 0.585 1146 0.903 3886 0.594 3677 0.878 3418 0.915 8 4.776 0 4.776
linkedubiq 23075 RATG13 T23075C|(surface_glycoprotein:T1513C(Y505H)) 333 1.000 2854 0.998 1830 0.998 1197 0.997 392 0.995 1611 0.998 1253 0.998 214 1.000 217 0.995 3482 0.999 280 1.000 4697 0.999 1724 0.998 1449 0.999 1094 0.998 1268 0.999 317 1.000 331 1.000 6531 0.999 405 1.000 2105 0.999 4183 0.998 521 0.998 231 1.000 7552 0.997 310 0.994 986 0.996 3728 0.998 1005 1.000 1626 0.981 909 0.982 100 1.000 32 10.964 20.949 31.913000000000004
linked 23117 RATG13 C23117A|(surface_glycoprotein:C1555A(H519N)) 796 0.021 878 0.019 5085 0.097 1261 0.017 2492 0.091 3942 0.050 3822 0.070 4179 0.137 8 0.502 0 0.502
ubiq 23222 G23222A|(surface_glycoprotein:G1660A(E554K)) 77197 0.998 55687 0.998 35485 0.976 44298 0.979 24116 0.999 25691 0.999 79807 0.996 23170 0.996 39431 0.996 98101 0.997 40095 0.813 70324 0.999 63321 0.936 56165 0.998 65237 0.998 66452 0.999 67889 0.998 23175 0.891 23951 0.999 32368 0.999 71880 0.997 46264 0.997 77768 0.998 48366 0.962 64947 0.998 83118 0.995 63807 0.994 50406 0.998 60596 0.998 26309 0.974 13131 0.999 62508 0.998 81756 0.998 57561 0.998 34 10.521 22.947 33.468
ubiq 23271 C23271T|(surface_glycoprotein:C1709T(A570V)) 85091 0.999 67683 0.999 49361 0.998 69410 0.983 44184 0.998 32944 0.999 115980 0.998 33007 0.997 57121 0.998 110490 0.997 59607 0.862 86509 0.998 83340 0.949 79779 0.999 87687 0.998 88771 0.998 75757 0.998 33846 0.907 30967 0.998 39241 0.998 93151 0.992 61957 0.996 85743 0.997 68015 0.968 82733 0.997 102543 0.996 78565 0.997 72325 0.998 69694 0.997 30301 0.969 17994 0.998 81904 0.997 102890 0.998 68598 0.997 34 10.621 22.947 33.568
ubiq 23403 Delta A23403G|(surface_glycoprotein:A1841G(D614G)) 90362 0.995 67395 0.996 49200 0.995 70585 0.998 44214 0.998 32944 0.998 115829 0.999 32944 0.999 57036 0.999 110432 0.999 69091 0.998 86371 0.998 86779 0.989 79746 0.998 87467 0.997 88643 0.998 75568 0.998 37243 0.998 30315 0.975 39167 0.998 93703 0.998 62007 0.998 85675 0.999 70075 0.997 82556 0.997 102018 0.996 78011 0.995 72110 0.996 69579 0.997 31058 0.997 17971 0.999 82080 0.999 102894 0.998 68602 0.998 34 10.966 22.921 33.887
ubiq 23423 C23423T|(surface_glycoprotein:C1861T(P621S)) 90750 0.999 67615 0.999 49348 0.998 70633 0.998 44245 0.999 32967 0.999 115850 0.999 32935 0.999 57058 0.999 110414 0.999 69123 0.999 86429 0.999 87664 0.999 79821 0.999 87508 0.998 88709 0.998 75619 0.999 37266 0.999 31050 0.999 39198 0.999 93754 0.999 62025 0.999 85701 0.999 70136 0.998 82647 0.998 102197 0.998 78181 0.998 71709 0.991 69634 0.998 31095 0.998 17972 0.999 81786 0.995 102542 0.995 68329 0.994 34 10.98 22.955 33.935
ubiq 23525 C23525T|(surface_glycoprotein:C1963T(H655Y)) 13765 0.997 12119 0.997 12806 0.970 22735 0.998 20216 0.999 7409 0.998 36305 0.998 9942 0.999 15276 0.861 12473 0.994 19735 0.994 16323 0.998 19691 0.999 23856 0.999 22403 0.998 22235 0.998 7960 0.999 10658 0.999 7179 0.999 6926 0.998 21931 0.999 16028 0.999 8208 0.999 19750 0.977 18136 0.999 19522 0.997 14706 0.998 22230 0.998 9263 0.994 3989 0.996 4876 0.998 18389 0.996 21349 0.996 11091 0.996 34 10.924 22.81 33.733999999999995
23603 C23603A|(surface_glycoprotein:CCT2041-2043AGT(P681S)) 809 0.022 1194 0.025 10377 0.233 4263 0.084 16716 0.506 4169 0.067 14219 0.272 12123 0.545 8 1.754 0 1.754
23604 Delta C23604G|(surface_glycoprotein:CCT2041-2043AGT(P681S)) 809 0.022 1194 0.025 10377 0.234 4263 0.084 16716 0.507 4169 0.067 14219 0.274 12123 0.547 8 1.76 0 1.76
23689 T23689A|(surface_glycoprotein:T2127A(N709K)) 824 0.034 1034 0.039 5404 0.213 1845 0.058 15410 0.676 1691 0.041 14001 0.429 9926 0.536 8 2.0260000000000002 0 2.0260000000000002
23897 C23897G|(surface_glycoprotein:C2335G(Q779E)) 362 0.011 1778 0.059 4926 0.140 292 0.007 64 0.001 7807 0.284 5660 0.101 12442 0.277 55 0.001 130 0.002 104 0.001 51 0.001 36 0.001 7192 0.307 14 1.186 0.007 1.1929999999999998
23946 A23946C|(surface_glycoprotein:A2384C(K795T)) 340 0.037 1010 0.339 3043 0.305 1020 0.086 2514 0.536 2656 0.177 2992 0.237 3215 0.619 8 2.336 0 2.336
24044 C24044T|(surface_glycoprotein:C2482T(L828F)) 324 0.035 983 0.330 15 0.001 2954 0.296 984 0.083 2405 0.514 2611 0.174 2924 0.231 3206 0.617 9 2.28 0.001 2.2809999999999997
24208 C24208T|(surface_glycoprotein:C2646T(I882I)) 334 0.035 961 0.265 2992 0.286 1094 0.084 2508 0.507 2605 0.165 2857 0.221 4004 0.657 8 2.22 0 2.22
24296 A24296G|(surface_glycoprotein:A2734G(T912A)) 18 0.046 46 0.083 206 0.400 141 0.119 195 0.826 132 0.157 15 0.044 257 0.760 8 2.435 0 2.435
24410 Delta G24410A|(surface_glycoprotein:G2848A(D950N)) 18 0.046 46 0.083 206 0.400 142 0.120 193 0.821 128 0.152 15 0.045 254 0.756 8 2.423 0 2.423
linked 24443 A24443G|(surface_glycoprotein:A2881G(T961A)) 46 0.002 204 0.007 143 0.005 195 0.010 128 0.003 252 0.015 6 0.042 0 0.042
24951 T24951C|(surface_glycoprotein:T3389C(I1130T)) 780 0.034 955 0.041 17506 0.566 1559 0.058 2245 0.066 11253 0.564 6 1.329 0 1.329
24966 A24966T|(surface_glycoprotein:A3404T(N1135I)) 781 0.034 960 0.041 17510 0.566 1560 0.058 2247 0.066 12232 0.614 6 1.379 0 1.379
25020 A25020C|(surface_glycoprotein:A3458C(D1153A)) 1567 0.092 1314 0.101 9458 0.418 3657 0.157 23258 0.753 5037 0.188 4101 0.120 15338 0.772 8 2.601 0 2.601
25052 G25052T|(surface_glycoprotein:G3490T(V1164F)) 1020 0.045 930 0.040 18628 0.604 3538 0.132 2250 0.066 13193 0.668 6 1.555 0 1.555
linked 25163 C25163A|(surface_glycoprotein:C3601A(Q1201K)) 269 0.123 350 0.130 107 0.026 166 0.036 10 0.002 2182 0.458 1074 0.257 1774 0.720 97 0.097 2 0.001 1137 0.218 3 0.001 648 0.185 4 0.002 3 0.001 1723 0.702 16 2.8289999999999997 0.13 2.9589999999999996
25169 C25169T|(surface_glycoprotein:C3607T(L1203F)) 266 0.122 351 0.130 163 0.035 2212 0.461 1071 0.256 1774 0.718 1138 0.218 654 0.186 1739 0.707 9 2.833 0 2.833
25254 C25254T|(surface_glycoprotein:C3692T(T1231I)) 264 0.120 352 0.131 161 0.035 2266 0.464 1075 0.257 1798 0.726 1142 0.218 663 0.188 208 0.103 1750 0.710 10 2.849 0.103 2.9520000000000004
linked 25392 T25392C 270 0.008 363 0.009 171 0.003 2107 0.049 1076 0.019 1790 0.080 1137 0.022 659 0.019 1728 0.074 9 0.283 0 0.283
linked 25469 Delta C25469T|(ORF3a_protein:C77T(S26L)) 577 0.018 1858 0.048 5295 0.137 1966 0.038 8810 0.440 1029 0.065 4529 0.098 1100 0.034 7202 0.345 9 1.158 0.065 1.2229999999999999
25658 C25658T|(ORF3a_protein:C266T(T89I)) 573 0.020 1827 0.045 5261 0.130 1942 0.036 8737 0.402 4597 0.091 1096 0.031 7118 0.308 8 1.063 0 1.063
25907 G25907T|(ORF3a_protein:G515T(G172V)) 56 0.058 54 0.020 754 0.346 292 0.105 1311 0.713 1446 0.299 536 0.176 1645 0.650 8 2.367 0 2.367
25913 G25913A|(ORF3a_protein:G521A(G174D)) 56 0.058 55 0.020 994 0.456 352 0.126 1311 0.713 1445 0.299 536 0.176 1651 0.652 8 2.5 0 2.5
25922 G25922T|(ORF3a_protein:G530T(S177I)) 57 0.059 56 0.021 828 0.380 291 0.104 1311 0.712 1444 0.298 535 0.175 2 0.001 1647 0.650 2 0.001 10 2.399 0.002 2.401
25991 G25991A|(ORF3a_protein:G599A(C200Y)) 55 0.057 57 0.021 992 0.457 346 0.124 1295 0.704 1444 0.300 536 0.177 1630 0.650 8 2.4899999999999998 0 2.4899999999999998
26158 G26158T|(ORF3a_protein:G766T(V256F)) 473 0.035 1732 0.060 34 0.002 16 0.002 5 0.004 4219 0.275 1466 0.059 7226 0.621 1142 0.052 1384 0.107 17 0.001 10 0.001 1339 0.204 13 1.415 0.008 1.423
26228 C26228T 473 0.035 1728 0.059 4229 0.276 1745 0.070 7254 0.624 1147 0.053 1381 0.107 1329 0.202 8 1.426 0 1.426
26320 T26320C|(envelope_protein:T76C(F26L)) 472 0.035 1714 0.059 4205 0.276 1726 0.070 7211 0.623 1141 0.053 1380 0.108 1291 0.198 8 1.422 0 1.422
26533 C26533T|(membrane_glycoprotein:C11T(S4F)) 495 0.072 106 0.030 207 0.028 3306 0.327 1026 0.088 1950 0.703 3817 0.328 733 0.090 2590 0.345 9 2.011 0 2.011
26767 Delta T26767C|(membrane_glycoprotein:T245C(I82T)) 4250 0.307 5354 0.281 17680 0.627 9701 0.355 32425 0.942 5054 0.188 9274 0.487 9115 0.639 8 3.826 0 3.826
26824 G26824A|(membrane_glycoprotein:G302A(R101K)) 3409 0.121 16067 0.467 891 0.033 5223 0.275 3643 0.255 5 1.151 0 1.151
27166 A27166G|(membrane_glycoprotein:A644G(D215G)) 264 0.023 415 0.029 6501 0.367 1816 0.096 688 0.021 11822 0.622 9159 0.222 3525 0.101 3574 0.288 9 1.769 0 1.769
27722 T27722C|(ORF7a_protein:T329C(I110T)) 1317 0.045 1553 0.056 11426 0.285 9181 0.193 16571 0.653 12989 0.258 5531 0.116 7040 0.326 8 1.932 0 1.932
27752 Delta C27752T|(ORF7a_protein:C359T(T120I)) 1324 0.046 1532 0.056 11375 0.284 9138 0.192 16537 0.652 12968 0.257 5486 0.115 7622 0.353 8 1.955 0 1.955
27763 A27763G|(ORF7b:A8G(E3G)) 968 0.033 1533 0.056 9080 0.227 6964 0.147 16145 0.637 12951 0.257 5501 0.116 7641 0.354 8 1.827 0 1.827
27874 C27874T|(ORF7b:C119T(T40I)) 2912 0.054 4209 0.066 16417 0.292 10545 0.165 646 0.008 28002 0.655 15081 0.230 12963 0.174 17175 0.437 9 2.081 0 2.081
28248 GATTTC28248-28253del|(ORF8_protein:355-360del(DF119-120del)) 4949 0.061 5220 0.035 37122 0.358 15737 0.133 54583 0.558 29257 0.221 29581 0.239 23288 0.417 8 2.0220000000000002 0 2.0220000000000002
28382 RATG13 T28382C|(nucleocapsid_phosphoprotein:T109C(S37P)) 5040 0.062 5225 0.035 36618 0.353 15828 0.134 54746 0.560 29531 0.223 29725 0.240 23361 0.418 8 2.025 0 2.025
28461 Delta A28461G|(nucleocapsid_phosphoprotein:A188G(D63G)) 4869 0.061 5221 0.035 36761 0.358 15552 0.132 55887 0.567 29053 0.221 29280 0.239 23132 0.419 8 2.032 0 2.032
28916 G28916T|(nucleocapsid_phosphoprotein:G643T(G215C)) 1855 0.094 1112 0.028 8807 0.332 4310 0.123 15556 0.626 5321 0.149 9230 0.240 9115 0.549 771 0.024 9 2.165 0 2.165
29402 Delta G29402T|(nucleocapsid_phosphoprotein:G1129T(D377Y)) 6737 0.075 7632 0.044 2311 0.015 31199 0.276 13788 0.113 66784 0.670 31207 0.216 36238 0.273 42820 0.555 9 2.237 0 2.237
29429 C29429G|(nucleocapsid_phosphoprotein:C1156G(Q386E)) 6734 0.075 7599 0.043 2341 0.015 30288 0.268 13760 0.112 66672 0.669 31090 0.215 36129 0.272 42724 0.554 9 2.2230000000000003 0 2.2230000000000003
29498 C29498A|(nucleocapsid_phosphoprotein:C1225A(Q409K)) 1781 0.006 19509 0.098 7863 0.037 43887 0.222 40257 0.147 27404 0.111 43166 0.286 7 0.907 0 0.907
29698 T29698C 1923 0.027 3893 0.036 10317 0.117 9084 0.100 1366 0.012 38469 0.393 27174 0.205 28483 0.247 26808 0.359 9 1.496 0 1.496
29717 G29717A 708 0.010 2487 0.023 2384 0.017 15072 0.171 6693 0.073 1196 0.011 23484 0.240 14196 0.107 13105 0.114 13460 0.180 10 0.946 0 0.946
29730 CACCGAGGCCACGCGGAGTACGATCGAGTGTACAGTGAA29730-29768del 700 0.010 2464 0.023 14450 0.166 6659 0.073 1182 0.011 23089 0.237 12833 0.097 13038 0.114 13330 0.181 9 0.912 0 0.912
29735 AGGCCACGCGGAGT29735-29748del 2984 0.043 3095 0.029 14462 0.166 10077 0.111 1336 0.012 38480 0.395 24095 0.183 25712 0.224 26615 0.360 9 1.523 0 1.523
29742 Delta G29742T 4513 0.064 3188 0.030 16118 0.185 9947 0.109 19316 0.198 19114 0.145 17873 0.156 18572 0.251 1600 0.020 9 1.158 0 1.158
29756 AGTGT29756-29760del 2427 0.035 3107 0.029 14558 0.167 10076 0.111 1340 0.012 35657 0.366 24086 0.183 19191 0.167 25429 0.344 9 1.414 0 1.414
29782 A29782G 699 0.010 2478 0.023 14939 0.171 6910 0.076 1192 0.011 24496 0.252 18780 0.143 16489 0.144 16578 0.225 9 1.055 0 1.055
29835 C29835A 2395 0.029 7765 0.111 8595 0.080 45746 0.526 27137 0.299 2443 0.022 82034 0.844 58188 0.444 54609 0.476 59407 0.806 1552 0.020 11 3.628 0.029 3.657