MO-3 - Complete Raw Mutation Data

Full TSV data with all sample columns and abundance information
← Back to Dashboard

Complete Mutations Data

This table shows the complete data from the mutations.tsv file exactly as it appears in the source. Scroll horizontally to see all columns.

01-WW-2-23-26_S57_L007(5852183) SRR37335446(5979446) SRR37412627(3294189) SRR37412634(2641189) SRR37460650(1980739) SRR37460916(134733) SRR37494380(7557903) SRR37540925(1849011) SRR37703207(2321151)
Meta not found "('2026-02-17', '48000')" "('2026-02-24', '13000')" "('2026-02-24', '48000')" "('2026-01-26', '43768')" "('2026-02-03', '10445')" "('2026-02-25', '240000')" "('2026-03-03', '48000')" Meta not found
Sequences Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Total samples Positives Sum Negatives Sum Total Sum
35 A35C 2 0.051 1 0.051 0 0.051
38 A38C 3 0.077 1 0.077 0 0.077
39 A39C 2 0.051 1 0.051 0 0.051
100 C100A 3596 0.056 23 0 3 0 8 0.001 52 0.001 5 0.056 0.002 0.058
111 T111C 3763 0.059 4 0 2 0 8 0 4 0.059 0 0.059
223 A223C 9103 0.075 4 0 4 0.001 3 0 22 0 47 0.001 6 0.075 0.002 0.077
325 T325A|(ORF1ab_polyprotein:T60A(V20V))|(ORF1a_polyprotein:T60A(V20V)) 52397 0.538 25 0.001 8 0.001 5 0 52 0.001 5 0.538 0.003 0.541
376 G376A|(ORF1ab_polyprotein:G111A(E37E))|(ORF1a_polyprotein:G111A(E37E)) 26201 0.645 1 0 1 0 4 0 7 0 5 0.645 0 0.645
378 RATG13 T378C|(ORF1ab_polyprotein:T113C(V38A))|(ORF1a_polyprotein:T113C(V38A)) 26622 0.655 12 0 2 0 3 0 17 0 16 0 6 0.655 0 0.655
508 TGGTCATGTTATGGT508-522del|(ORF1ab_polyprotein:CATGGTCATGTTATGGTT241-258CATdel(HGHVMV81-86Hdel))|(ORF1a_polyprotein:CATGGTCATGTTATGGTT241-258CATdel(HGHVMV81-86Hdel)) 421 0.056 1 0.056 0 0.056
545 G545A|(ORF1ab_polyprotein:G280A(G94S))|(ORF1a_polyprotein:G280A(G94S)) 428 0.057 1 0 2 0.057 0 0.057
569 G569A|(ORF1ab_polyprotein:G304A(E102K))|(ORF1a_polyprotein:G304A(E102K)) 4321 0.581 1 0.581 0 0.581
771 T771C|(ORF1ab_polyprotein:T506C(V169A))|(ORF1a_polyprotein:T506C(V169A)) 1572 0.701 6 0 11 0 7 0 1 0.001 42 0 6 0.701 0.001 0.702
774 C774A|(ORF1ab_polyprotein:C509A(T170N))|(ORF1a_polyprotein:C509A(T170N)) 1566 0.699 67 0.001 110 0.001 63 0.001 8 0.005 616 0.001 6 0.699 0.009 0.708
826 T826C|(ORF1ab_polyprotein:T561C(D187D))|(ORF1a_polyprotein:T561C(D187D)) 15429 0.571 5 0 7 0 5 0 5 0 61 0 6 0.571 0 0.571
936 C936T|(ORF1ab_polyprotein:C671T(T224I))|(ORF1a_polyprotein:C671T(T224I)) 13935 0.556 1 0 4 0 3 0 1 0 21 0 6 0.556 0 0.556
1039 A1039G|(ORF1ab_polyprotein:A774G(K258K))|(ORF1a_polyprotein:A774G(K258K)) 2575 0.246 3 0 6 0 1 0 1 0 1 0 6 0.246 0 0.246
1082 T1082C|(ORF1ab_polyprotein:T817C(F273L))|(ORF1a_polyprotein:T817C(F273L)) 580 0.055 4 0 3 0 2 0 4 0.055 0 0.055
1103 A1103G|(ORF1ab_polyprotein:A838G(I280V))|(ORF1a_polyprotein:A838G(I280V)) 13561 0.29 2 0 13 0 1 0 1 0 7 0 6 0.29 0 0.29
1161 G1161A|(ORF1ab_polyprotein:G896A(R299K))|(ORF1a_polyprotein:G896A(R299K)) 4409 0.094 2 0 4 0 2 0 4 0.094 0 0.094
1191 Delta C1191T|(ORF1ab_polyprotein:C926T(P309L))|(ORF1a_polyprotein:C926T(P309L)) 11307 0.306 8 0 1 0 1 0 2 0 5 0.306 0 0.306
1419 C1419T|(ORF1ab_polyprotein:C1154T(A385V))|(ORF1a_polyprotein:C1154T(A385V)) 32688 0.573 17 0 1 0 3 0.573 0 0.573
1620 A1620G|(ORF1ab_polyprotein:A1355G(E452G))|(ORF1a_polyprotein:A1355G(E452G)) 3137 0.123 16 0 62 0 14 0 4 0 97 0 6 0.123 0 0.123
1812 C1812A|(ORF1ab_polyprotein:GCT1546-1548GAA(A516E))|(ORF1a_polyprotein:GCT1546-1548GAA(A516E)) 37760 0.381 1 0 2 0.381 0 0.381
1813 RATG13 T1813A|(ORF1ab_polyprotein:GCT1546-1548GAA(A516E))|(ORF1a_polyprotein:GCT1546-1548GAA(A516E)) 37760 0.381 1 0 2 0.381 0 0.381
1820 G1820A|(ORF1ab_polyprotein:G1555A(G519S))|(ORF1a_polyprotein:G1555A(G519S)) 5998 0.084 2 0 10 0 3 0 3 0.001 16 0 6 0.084 0.001 0.085
1825 RATG13 C1825T|(ORF1ab_polyprotein:C1560T(A520A))|(ORF1a_polyprotein:C1560T(A520A)) 5709 0.08 6 0 6 0 4 0 12 0 5 0.08 0 0.08
1889 C1889T|(ORF1ab_polyprotein:C1624T(R542C))|(ORF1a_polyprotein:C1624T(R542C)) 14949 0.208 7 0 21 0 1 0 32 0 5 0.208 0 0.208
1912 C1912T|(ORF1ab_polyprotein:C1647T(S549S))|(ORF1a_polyprotein:C1647T(S549S)) 37682 0.26 7 0 9 0 2 0 1 0.028 39 0 6 0.26 0.028 0.288
1921 T1921C|(ORF1ab_polyprotein:T1656C(L552L))|(ORF1a_polyprotein:T1656C(L552L)) 9397 0.065 103 0.001 43 0 6 0 33 0 179 0 6 0.065 0.001 0.066
2134 A2134C|(ORF1ab_polyprotein:A1869C(K623N))|(ORF1a_polyprotein:A1869C(K623N)) 351 0.068 51 0.001 21 0.001 505 0.001 4 0.068 0.003 0.071
2258 G2258A|(ORF1ab_polyprotein:G1993A(V665I))|(ORF1a_polyprotein:G1993A(V665I)) 23422 0.112 2 0 2 0.112 0 0.112
2281 G2281T|(ORF1ab_polyprotein:G2016T(K672N))|(ORF1a_polyprotein:G2016T(K672N)) 18736 0.084 17 0.001 89 0.001 35 0.002 65 0.001 133 0.001 6 0.084 0.006 0.09
2390 T2390C|(ORF1ab_polyprotein:T2125C(F709L))|(ORF1a_polyprotein:T2125C(F709L)) 5312 0.414 1 0 5 0 2 0 17 0 5 0.414 0 0.414
2467 A2467G|(ORF1ab_polyprotein:A2202G(K734K))|(ORF1a_polyprotein:A2202G(K734K)) 39305 0.457 7 0 11 0 3 0 2 0 22 0 6 0.457 0 0.457
2592 C2592T|(ORF1ab_polyprotein:C2327T(A776V))|(ORF1a_polyprotein:C2327T(A776V)) 5918 0.079 3 0 2 0 6 0 5 0 5 0.079 0 0.079
2628 T2628C|(ORF1ab_polyprotein:T2363C(L788P))|(ORF1a_polyprotein:T2363C(L788P)) 395 0.227 1 0 3 0.001 3 0.227 0.001 0.228
2644 RATG13 C2644T|(ORF1ab_polyprotein:C2379T(I793I))|(ORF1a_polyprotein:C2379T(I793I)) 1300 0.989 1 0 2 0.989 0 0.989
2656 A2656C|(ORF1ab_polyprotein:A2391C(E797D))|(ORF1a_polyprotein:A2391C(E797D)) 1300 0.989 10 0.002 1 0.002 43 0.004 4 0.989 0.008 0.997
2725 A2725G|(ORF1ab_polyprotein:A2460G(P820P))|(ORF1a_polyprotein:A2460G(P820P)) 3618 0.126 1 0.002 1 0 7 0.001 4 0.126 0.003 0.129
linked 2790 C2790T|(ORF1ab_polyprotein:C2525T(T842I))|(ORF1a_polyprotein:C2525T(T842I)) 20518 0.73 108 1 4134 0.996 436 1 34976 0.999 8 1 9555 0.996 1 1 502 0.998 9 0.73 7.989 8.719
2827 RATG13 T2827C|(ORF1ab_polyprotein:T2562C(N854N))|(ORF1a_polyprotein:T2562C(N854N)) 5490 0.196 2 0 1 0 3 0.196 0 0.196
2881 RATG13 C2881T|(ORF1ab_polyprotein:C2616T(A872A))|(ORF1a_polyprotein:C2616T(A872A)) 44 0.128 1 0.128 0 0.128
linkedubiq 3037 "RATG13,Delta" C3037T|(ORF1ab_polyprotein:C2772T(F924F))|(ORF1a_polyprotein:C2772T(F924F)) 61745 0.989 47989 0.991 6909 0.989 995 0.99 29761 0.999 304 0.99 31631 0.982 1738 0.995 8 0.989 6.936 7.925
3086 T3086C|(ORF1ab_polyprotein:T2821C(F941L))|(ORF1a_polyprotein:T2821C(F941L)) 6095 0.09 13 0 1 0 1 0.001 5 0 24 0.001 1 0.001 7 0.09 0.003 0.093
3096 C3096T|(ORF1ab_polyprotein:C2831T(S944L))|(ORF1a_polyprotein:C2831T(S944L)) 26704 0.392 2 0 1 0 3 0.392 0 0.392
3140 RATG13 C3140T|(ORF1ab_polyprotein:CCT2875-2877TCG(P959S))|(ORF1a_polyprotein:CCT2875-2877TCG(P959S)) 6004 0.788 1 0.788 0 0.788
3142 T3142G|(ORF1ab_polyprotein:CCT2875-2877TCG(P959S))|(ORF1a_polyprotein:CCT2875-2877TCG(P959S)) 6004 0.788 1 0.788 0 0.788
linked 3176 C3176T|(ORF1ab_polyprotein:C2911T(P971S))|(ORF1a_polyprotein:C2911T(P971S)) 5981 0.807 3 0 1836 0.268 2 0 1 0.001 5 0.807 0.269 1.076
3198 A3198G|(ORF1ab_polyprotein:A2933G(D978G))|(ORF1a_polyprotein:A2933G(D978G)) 695 0.097 4 0 1 0 1 0 4 0.097 0 0.097
linked 3231 RATG13 G3231T|(ORF1ab_polyprotein:G2966T(G989V))|(ORF1a_polyprotein:G2966T(G989V)) 1350 0.018 5 0 8 0.002 2 0.125 4 0.018 0.127 0.145
3258 A3258T|(ORF1ab_polyprotein:A2993T(Q998L))|(ORF1a_polyprotein:A2993T(Q998L)) 5475 0.082 1 0.082 0 0.082
3320 G3320T|(ORF1ab_polyprotein:G3055T(V1019F))|(ORF1a_polyprotein:G3055T(V1019F)) 29011 0.419 5 0.001 9 0.002 3 0.419 0.003 0.422
3325 T3325C|(ORF1ab_polyprotein:T3060C(V1020V))|(ORF1a_polyprotein:T3060C(V1020V)) 28942 0.42 1 0 1 0 3 0.42 0 0.42
3331 T3331C|(ORF1ab_polyprotein:T3066C(T1022T))|(ORF1a_polyprotein:T3066C(T1022T)) 28958 0.422 2 0 2 0.422 0 0.422
3337 A3337G|(ORF1ab_polyprotein:A3072G(E1024E))|(ORF1a_polyprotein:A3072G(E1024E)) 26023 0.379 1 0 3 0.001 3 0.379 0.001 0.38
3379 A3379G|(ORF1ab_polyprotein:A3114G(V1038V))|(ORF1a_polyprotein:A3114G(V1038V)) 28742 0.417 5 0.001 2 0.417 0.001 0.418
linked 3565 T3565C|(ORF1ab_polyprotein:T3300C(G1100G))|(ORF1a_polyprotein:T3300C(G1100G)) 3032 0.229 35839 0.997 17306 0.742 3658 0.999 97 0.99 34223 0.483 31637 0.988 7 0.229 5.199 5.428
3566 G3566A|(ORF1ab_polyprotein:G3301A(G1101S))|(ORF1a_polyprotein:G3301A(G1101S)) 1403 0.106 4 0 1 0 1 0 6 0 5 0.106 0 0.106
3570 G3570A|(ORF1ab_polyprotein:G3305A(S1102N))|(ORF1a_polyprotein:G3305A(S1102N)) 1113 0.084 5 0 2 0.084 0 0.084
3590 A3590G|(ORF1ab_polyprotein:A3325G(N1109D))|(ORF1a_polyprotein:A3325G(N1109D)) 2108 0.16 10 0 4 0 1 0.004 17 0 5 0 6 0.16 0.004 0.164
3606 G3606T|(ORF1ab_polyprotein:G3341T(C1114F))|(ORF1a_polyprotein:G3341T(C1114F)) 7770 0.588 20 0.001 26 0.001 1 0 49 0.001 28 0.001 6 0.588 0.004 0.592
3740 RATG13 A3740G|(ORF1ab_polyprotein:A3475G(I1159V))|(ORF1a_polyprotein:A3475G(I1159V)) 19552 0.511 3 0 4 0 9 0 5 0 5 0.511 0 0.511
3811 C3811G|(ORF1ab_polyprotein:C3546G(L1182L))|(ORF1a_polyprotein:C3546G(L1182L)) 197 0.079 8 0 10 0 20 0 5 0 5 0.079 0 0.079
3849 G3849T|(ORF1ab_polyprotein:G3584T(S1195I))|(ORF1a_polyprotein:G3584T(S1195I)) 1172 0.501 41 0.001 40 0.001 24 0.001 135 0.001 51 0.001 6 0.501 0.005 0.506
3867 AA3867-3868del|(ORF1ab_polyprotein:3602-3603del(1201fs))|(ORF1a_polyprotein:3602-3603del(1201fs)) 197 0.085 1 0.085 0 0.085
3871 G3871T|(ORF1ab_polyprotein:G3606T(K1202N))|(ORF1a_polyprotein:G3606T(K1202N)) 196 0.084 73 0.001 56 0.002 50 0.002 275 0.002 49 0.001 6 0.084 0.008 0.092
3875 G3875A|(ORF1ab_polyprotein:G3610A(A1204T))|(ORF1a_polyprotein:G3610A(A1204T)) 233 0.1 1 0 2 0 1 0 10 0 8 0 6 0.1 0 0.1
3883 T3883C|(ORF1ab_polyprotein:T3618C(I1206I))|(ORF1a_polyprotein:T3618C(I1206I)) 433 0.186 10 0 6 0 5 0 27 0 11 0 6 0.186 0 0.186
3898 T3898C|(ORF1ab_polyprotein:T3633C(V1211V))|(ORF1a_polyprotein:T3633C(V1211V)) 22597 0.448 6 0 3 0 4 0 1 0 11 0 1 0 7 0.448 0 0.448
4217 A4217C|(ORF1ab_polyprotein:A3952C(R1318R))|(ORF1a_polyprotein:A3952C(R1318R)) 24114 0.912 9 0 2 0 23 0 4 0.912 0 0.912
4228 4228-insertA|(ORF1ab_polyprotein:3963insertA(1321fs))|(ORF1a_polyprotein:3963insertA(1321fs)) 10695 0.402 1 0 2 0.402 0 0.402
4230 C4230T|(ORF1ab_polyprotein:C3965T(T1322I))|(ORF1a_polyprotein:C3965T(T1322I)) 24133 0.909 8 0 1 0 6 0 4 0.909 0 0.909
4285 G4285T|(ORF1ab_polyprotein:G4020T(E1340D))|(ORF1a_polyprotein:G4020T(E1340D)) 32798 0.798 155 0.001 37 0.001 386 0.003 4 0.798 0.005 0.803
4423 RATG13 C4423T|(ORF1ab_polyprotein:C4158T(R1386R))|(ORF1a_polyprotein:C4158T(R1386R)) 1938 0.067 10 0 2 0 10 0 4 0.067 0 0.067
4442 RATG13 G4442A|(ORF1ab_polyprotein:G4177A(V1393M))|(ORF1a_polyprotein:G4177A(V1393M)) 1934 0.067 12 0 2 0 28 0 4 0.067 0 0.067
4540 RATG13 C4540T|(ORF1ab_polyprotein:C4275T(Y1425Y))|(ORF1a_polyprotein:C4275T(Y1425Y)) 2384 0.058 1 0 6 0 13 0 4 0.058 0 0.058
4568 A4568G|(ORF1ab_polyprotein:A4303G(I1435V))|(ORF1a_polyprotein:A4303G(I1435V)) 2996 0.068 3 0 9 0 1 0.001 53 0 5 0.068 0.001 0.069
4574 A4574G|(ORF1ab_polyprotein:A4309G(T1437A))|(ORF1a_polyprotein:A4309G(T1437A)) 5188 0.117 8 0 5 0 1 0 66 0 5 0.117 0 0.117
4776 C4776A|(ORF1ab_polyprotein:C4511A(T1504N))|(ORF1a_polyprotein:C4511A(T1504N)) 3030 0.087 263 0.001 32 0.001 93 0.001 8 0.004 578 0.001 100 0.001 7 0.087 0.009 0.096
4778 A4778G|(ORF1ab_polyprotein:A4513G(I1505V))|(ORF1a_polyprotein:A4513G(I1505V)) 14940 0.431 53 0 5 0 10 0 102 0 18 0 6 0.431 0 0.431
4784 C4784T|(ORF1ab_polyprotein:C4519T(L1507F))|(ORF1a_polyprotein:C4519T(L1507F)) 14829 0.428 8 0 1 0 17 0 3 0 5 0.428 0 0.428
4788 C4788T|(ORF1ab_polyprotein:C4523T(A1508V))|(ORF1a_polyprotein:C4523T(A1508V)) 3099 0.09 16 0 1 0 1 0 21 0 7 0 6 0.09 0 0.09
4828 A4828G|(ORF1ab_polyprotein:A4563G(T1521T))|(ORF1a_polyprotein:A4563G(T1521T)) 7344 0.209 42 0 5 0 7 0 57 0 24 0 6 0.209 0 0.209
4851 A4851G|(ORF1ab_polyprotein:A4586G(K1529R))|(ORF1a_polyprotein:A4586G(K1529R)) 3219 0.092 92 0 19 0.001 29 0 1 0 142 0 77 0 7 0.092 0.001 0.093
4859 G4859A|(ORF1ab_polyprotein:G4594A(D1532N))|(ORF1a_polyprotein:G4594A(D1532N)) 14821 0.423 31 0 2 0 12 0 54 0 13 0 6 0.423 0 0.423
4860 A4860G|(ORF1ab_polyprotein:A4595G(D1532G))|(ORF1a_polyprotein:A4595G(D1532G)) 3124 0.089 53 0 5 0 16 0 1 0.001 126 0 54 0 7 0.089 0.001 0.09
4890 RATG13 C4890T|(ORF1ab_polyprotein:C4625T(T1542I))|(ORF1a_polyprotein:C4625T(T1542I)) 3167 0.09 17 0 5 0 8 0 29 0 15 0 6 0.09 0 0.09
5038 A5038C|(ORF1ab_polyprotein:A4773C(G1591G))|(ORF1a_polyprotein:A4773C(G1591G)) 18644 0.601 31 0 9 0 26 0 34 0.007 99 0 30 0 7 0.601 0.007 0.608
5098 T5098C|(ORF1ab_polyprotein:T4833C(N1611N))|(ORF1a_polyprotein:T4833C(N1611N)) 2589 0.08 1 0 3 0 3 0.08 0 0.08
5134 T5134C|(ORF1ab_polyprotein:T4869C(N1623N))|(ORF1a_polyprotein:T4869C(N1623N)) 2665 0.082 2 0 1 0 1 0 3 0 5 0.082 0 0.082
5180 G5180A|(ORF1ab_polyprotein:G4915A(D1639N))|(ORF1a_polyprotein:G4915A(D1639N)) 30309 0.715 1 0 2 0.715 0 0.715
5184 Delta C5184T|(ORF1ab_polyprotein:C4919T(P1640L))|(ORF1a_polyprotein:C4919T(P1640L)) 1263 0.112 1 0 1 0 1 0 4 0.112 0 0.112
linked 5239 C5239T|(ORF1ab_polyprotein:C4974T(Y1658Y))|(ORF1a_polyprotein:C4974T(Y1658Y)) 1277 0.117 3272 0.426 4223 0.995 1064 0.893 9 0.12 23384 0.469 2 1 4996 0.993 8 0.117 4.896 5.013
5463 RATG13 G5463A|(ORF1ab_polyprotein:G5198A(S1733N))|(ORF1a_polyprotein:G5198A(S1733N)) 16120 0.66 19 0 3 0 1 0.001 10 0 2 0 6 0.66 0.001 0.661
5536 A5536G|(ORF1ab_polyprotein:A5271G(Q1757Q))|(ORF1a_polyprotein:A5271G(Q1757Q)) 1310 0.099 34 0 2 0 31 0 34 0 5 0.099 0 0.099
5600 RATG13 T5600C|(ORF1ab_polyprotein:T5335C(F1779L))|(ORF1a_polyprotein:T5335C(F1779L)) 8391 0.466 30 0 3 0 25 0 17 0 5 0.466 0 0.466
5648 RATG13 A5648C|(ORF1ab_polyprotein:A5383C(K1795Q))|(ORF1a_polyprotein:A5383C(K1795Q)) 1824 0.375 79 0 10 0 86 0.001 24 0 5 0.375 0.001 0.376
5717 C5717T|(ORF1ab_polyprotein:C5452T(H1818Y))|(ORF1a_polyprotein:C5452T(H1818Y)) 310 0.225 1 0 3 0 3 0.225 0 0.225
5730 RATG13 C5730T|(ORF1ab_polyprotein:C5465T(T1822I))|(ORF1a_polyprotein:C5465T(T1822I)) 513 0.374 1 0 2 0.374 0 0.374
5878 RATG13 C5878T|(ORF1ab_polyprotein:C5613T(N1871N))|(ORF1a_polyprotein:C5613T(N1871N)) 5502 0.28 3 0 2 0.28 0 0.28
5902 A5902T|(ORF1ab_polyprotein:A5637T(P1879P))|(ORF1a_polyprotein:A5637T(P1879P)) 2493 0.126 1 0 3 0.001 7 0.001 6 0.001 5 0.126 0.003 0.129
6283 RATG13 T6283C|(ORF1ab_polyprotein:T6018C(N2006N))|(ORF1a_polyprotein:T6018C(N2006N)) 1790 0.5 7 0 4 0 9 0 4 0.5 0 0.5
6286 C6286A|(ORF1ab_polyprotein:C6021A(T2007T))|(ORF1a_polyprotein:C6021A(T2007T)) 445 0.124 150 0.002 116 0.002 315 0.002 4 0.124 0.006 0.13
6352 RATG13 G6352A|(ORF1ab_polyprotein:G6087A(K2029K))|(ORF1a_polyprotein:G6087A(K2029K)) 241 0.086 7 0 1 0 6 0 4 0.086 0 0.086
6481 A6481G|(ORF1ab_polyprotein:A6216G(V2072V))|(ORF1a_polyprotein:A6216G(V2072V)) 3424 0.077 18 0 13 0 5 0 27 0 5 0.077 0 0.077
6501 C6501A|(ORF1ab_polyprotein:C6236A(P2079Q))|(ORF1a_polyprotein:C6236A(P2079Q)) 16794 0.386 64 0.001 67 0.001 6 0 261 0.002 5 0.386 0.004 0.39
6526 A6526G|(ORF1ab_polyprotein:A6261G(T2087T))|(ORF1a_polyprotein:A6261G(T2087T)) 273 0.135 14 0 9 0 29 0 4 0.135 0 0.135
6536 G6536A|(ORF1ab_polyprotein:G6271A(G2091S))|(ORF1a_polyprotein:G6271A(G2091S)) 732 0.363 8 0 9 0 26 0 4 0.363 0 0.363
6613 A6613G|(ORF1ab_polyprotein:A6348G(V2116V))|(ORF1a_polyprotein:A6348G(V2116V)) 7516 0.436 1 0 1 0 1 0 4 0.436 0 0.436
6618 G6618T|(ORF1ab_polyprotein:G6353T(G2118V))|(ORF1a_polyprotein:G6353T(G2118V)) 1347 0.078 14 0.002 16 0.003 25 0.003 62 0.002 5 0.078 0.01 0.088
6709 A6709C|(ORF1ab_polyprotein:A6444C(K2148N))|(ORF1a_polyprotein:A6444C(K2148N)) 4741 0.294 4 0 3 0.001 7 0.001 22 0.001 5 0.294 0.003 0.297
7000 C7000T|(ORF1ab_polyprotein:C6735T(Y2245Y))|(ORF1a_polyprotein:C6735T(Y2245Y)) 1656 0.18 2 0 6 0 14 0 4 0.18 0 0.18
7012 T7012G|(ORF1ab_polyprotein:T6747G(A2249A))|(ORF1a_polyprotein:T6747G(A2249A)) 5387 0.585 218 0.002 721 0.003 391 0.001 4 0.585 0.006 0.591
7285 A7285G|(ORF1ab_polyprotein:A7020G(V2340V))|(ORF1a_polyprotein:A7020G(V2340V)) 10671 0.571 6 0.001 35 0.002 3 0.571 0.003 0.574
7348 T7348G|(ORF1ab_polyprotein:T7083G(N2361K))|(ORF1a_polyprotein:T7083G(N2361K)) 6886 0.566 15 0.002 55 0.003 3 0.566 0.005 0.571
7403 A7403G|(ORF1ab_polyprotein:A7138G(M2380V))|(ORF1a_polyprotein:A7138G(M2380V)) 981 0.081 1 0 2 0 3 0.081 0 0.081
7429 A7429T|(ORF1ab_polyprotein:A7164T(A2388A))|(ORF1a_polyprotein:A7164T(A2388A)) 9128 0.09 8 0.001 13 0.001 3 0.09 0.002 0.092
7452 G7452T|(ORF1ab_polyprotein:G7187T(S2396I))|(ORF1a_polyprotein:G7187T(S2396I)) 14380 0.161 5 0.001 4 0 19 0.001 4 0.161 0.002 0.163
7457 G7457T|(ORF1ab_polyprotein:G7192T(V2398L))|(ORF1a_polyprotein:G7192T(V2398L)) 5055 0.056 5 0.001 3 0 7 0 4 0.056 0.001 0.057
7504 C7504T|(ORF1ab_polyprotein:C7239T(Y2413Y))|(ORF1a_polyprotein:C7239T(Y2413Y)) 28685 0.32 2 0 2 0.32 0 0.32
8040 A8040C|(ORF1ab_polyprotein:A7775C(D2592A))|(ORF1a_polyprotein:A7775C(D2592A)) 6567 0.083 67 0.001 161 0.001 6 0 588 0.002 86 0.001 6 0.083 0.005 0.088
8092 C8092T|(ORF1ab_polyprotein:C7827T(L2609L))|(ORF1a_polyprotein:C7827T(L2609L)) 34800 0.442 3 0 14 0 1 0 26 0 5 0 6 0.442 0 0.442
8099 C8099T|(ORF1ab_polyprotein:C7834T(L2612L))|(ORF1a_polyprotein:C7834T(L2612L)) 4159 0.053 2 0 4 0 16 0 1 0 5 0.053 0 0.053
8169 CAG8169-8171del|(ORF1ab_polyprotein:TCAGCA7903-7908TCAdel(SA2635-2636Sdel))|(ORF1a_polyprotein:TCAGCA7903-7908TCAdel(SA2635-2636Sdel)) 539 0.154 1 0.154 0 0.154
8352 C8352T|(ORF1ab_polyprotein:C8087T(A2696V))|(ORF1a_polyprotein:C8087T(A2696V)) 2839 0.114 16 0 5 0 1 0 8 0 5 0.114 0 0.114
8548 G8548A|(ORF1ab_polyprotein:G8283A(K2761K))|(ORF1a_polyprotein:G8283A(K2761K)) 1751 0.196 1 0 1 0 3 0.196 0 0.196
8752 C8752T|(ORF1ab_polyprotein:C8487T(N2829N))|(ORF1a_polyprotein:C8487T(N2829N)) 1071 0.148 1 0 2 0.148 0 0.148
linked 8818 RATG13 C8818T|(ORF1ab_polyprotein:C8553T(C2851C))|(ORF1a_polyprotein:C8553T(C2851C)) 2825 0.395 1467 0.999 6021 0.996 2396 0.995 3665 0.998 86 0.426 39106 0.995 12245 0.996 8 0.395 6.405 6.8
9042 C9042T|(ORF1ab_polyprotein:C8777T(S2926F))|(ORF1a_polyprotein:C8777T(S2926F)) 5258 0.444 3 0 1 0.005 6 0 2 0 5 0.444 0.005 0.449
9130 G9130T|(ORF1ab_polyprotein:G8865T(V2955V))|(ORF1a_polyprotein:G8865T(V2955V)) 230 0.087 15 0.001 55 0.002 3 0.087 0.003 0.09
9257 G9257T|(ORF1ab_polyprotein:G8992T(V2998L))|(ORF1a_polyprotein:G8992T(V2998L)) 4027 0.305 6 0 1 0 16 0.001 4 0.305 0.001 0.306
9328 A9328G|(ORF1ab_polyprotein:A9063G(V3021V))|(ORF1a_polyprotein:A9063G(V3021V)) 713 0.055 3 0 2 0 3 0.055 0 0.055
9419 A9419G|(ORF1ab_polyprotein:A9154G(I3052V))|(ORF1a_polyprotein:A9154G(I3052V)) 286 0.624 5 0 4 0 7 0 3 0 5 0.624 0 0.624
9634 A9634G|(ORF1ab_polyprotein:A9369G(L3123L))|(ORF1a_polyprotein:A9369G(L3123L)) 12397 0.598 2 0 27 0 1 0 20 0 2 0 6 0.598 0 0.598
9750 A9750G|(ORF1ab_polyprotein:A9485G(K3162R))|(ORF1a_polyprotein:A9485G(K3162R)) 5524 0.364 29 0 32 0 3 0.364 0 0.364
10354 G10354A|(ORF1ab_polyprotein:G10089A(K3363K))|(ORF1a_polyprotein:G10089A(K3363K)) 10561 0.133 2 0 3 0 11 0 4 0.133 0 0.133
10427 G10427A|(ORF1ab_polyprotein:G10162A(V3388I))|(ORF1a_polyprotein:G10162A(V3388I)) 3110 0.074 2 0 3 0 5 0 17 0 5 0.074 0 0.074
10594 C10594A|(ORF1ab_polyprotein:C10329A(N3443K))|(ORF1a_polyprotein:C10329A(N3443K)) 14180 0.482 16 0.001 46 0.001 11 0.001 102 0.001 5 0.482 0.004 0.486
10612 T10612C|(ORF1ab_polyprotein:T10347C(V3449V))|(ORF1a_polyprotein:T10347C(V3449V)) 14301 0.482 8 0.001 16 0 1 0 21 0 5 0.482 0.001 0.483
10696 T10696C|(ORF1ab_polyprotein:T10431C(N3477N))|(ORF1a_polyprotein:T10431C(N3477N)) 5982 0.399 1 0 3 0 2 0 10 0 5 0.399 0 0.399
10795 T10795G|(ORF1ab_polyprotein:T10530G(V3510V))|(ORF1a_polyprotein:T10530G(V3510V)) 8914 0.449 2 0 9 0 6 0 2 0.001 17 0 6 0.449 0.001 0.45
10895 A10895G|(ORF1ab_polyprotein:A10630G(I3544V))|(ORF1a_polyprotein:A10630G(I3544V)) 272 0.055 15 0 8 0 1 0 41 0 17 0 6 0.055 0 0.055
10898 T10898C|(ORF1ab_polyprotein:T10633C(L3545L))|(ORF1a_polyprotein:T10633C(L3545L)) 2861 0.579 11 0 4 0 24 0 6 0 5 0.579 0 0.579
10954 C10954T|(ORF1ab_polyprotein:C10689T(C3563C))|(ORF1a_polyprotein:C10689T(C3563C)) 1003 0.362 5 0 1 0 11 0 3 0 5 0.362 0 0.362
11062 A11062G|(ORF1ab_polyprotein:A10797G(Q3599Q))|(ORF1a_polyprotein:A10797G(Q3599Q)) 74640 0.71 6 0 6 0 2 0 20 0 16 0 6 0.71 0 0.71
11081 RATG13 T11081G|(ORF1ab_polyprotein:T10816G(L3606V))|(ORF1a_polyprotein:T10816G(L3606V)) 75262 0.716 38 0 1 0 179 0.001 21 0 5 0.716 0.001 0.717
11109 C11109T|(ORF1ab_polyprotein:C10844T(A3615V))|(ORF1a_polyprotein:C10844T(A3615V)) 75221 0.728 11 0 7 0 1 0 37 0 5 0 6 0.728 0 0.728
11117 A11117G|(ORF1ab_polyprotein:A10852G(I3618V))|(ORF1a_polyprotein:A10852G(I3618V)) 75152 0.729 11 0 10 0 1 0 1 0.001 33 0 13 0 7 0.729 0.001 0.73
11306 G11306T|(ORF1ab_polyprotein:G11041T(D3681Y))|(ORF1a_polyprotein:G11041T(D3681Y)) 686 0.057 14 0 8 0.001 23 0.001 2 0.001 16 0.001 21 0 7 0.057 0.004 0.061
11471 C11471T|(ORF1ab_polyprotein:C11206T(L3736F))|(ORF1a_polyprotein:C11206T(L3736F)) 13225 0.454 2 0 2 0 2 0 8 0 5 0.454 0 0.454
11542 T11542A|(ORF1ab_polyprotein:T11277A(V3759V))|(ORF1a_polyprotein:T11277A(V3759V)) 4282 0.442 1 0 2 0.001 5 0.001 4 0.442 0.002 0.444
11600 A11600G|(ORF1ab_polyprotein:A11335G(I3779V))|(ORF1a_polyprotein:A11335G(I3779V)) 16291 0.508 2 0.001 2 0 1 0 4 0.508 0.001 0.509
11671 RATG13 C11671T|(ORF1ab_polyprotein:C11406T(R3802R))|(ORF1a_polyprotein:C11406T(R3802R)) 12115 0.538 1 0.538 0 0.538
11833 C11833T|(ORF1ab_polyprotein:C11568T(A3856A))|(ORF1a_polyprotein:C11568T(A3856A)) 621 0.157 1 0 2 0 1 0 4 0 5 0.157 0 0.157
12244 T12244C|(ORF1ab_polyprotein:T11979C(R3993R))|(ORF1a_polyprotein:T11979C(R3993R)) 1978 0.087 9 0 3 0 1 0 1 0 1 0.001 2 0 7 0.087 0.001 0.088
12477 T12477C|(ORF1ab_polyprotein:T12212C(M4071T))|(ORF1a_polyprotein:T12212C(M4071T)) 3804 0.09 3 0 7 0 2 0 2 0 2 0 6 0.09 0 0.09
12484 C12484T|(ORF1ab_polyprotein:C12219T(V4073V))|(ORF1a_polyprotein:C12219T(V4073V)) 29346 0.698 1 0.698 0 0.698
12520 T12520A|(ORF1ab_polyprotein:T12255A(D4085E))|(ORF1a_polyprotein:T12255A(D4085E)) 28998 0.697 3 0.001 1 0.002 1 0.001 1 0.001 5 0.697 0.005 0.702
12566 G12566A|(ORF1ab_polyprotein:G12301A(V4101I))|(ORF1a_polyprotein:G12301A(V4101I)) 29784 0.681 1 0.681 0 0.681
12715 A12715G|(ORF1ab_polyprotein:A12450G(R4150R))|(ORF1a_polyprotein:A12450G(R4150R)) 5821 0.105 2 0 2 0.105 0 0.105
12717 AG12717-12718del|(ORF1ab_polyprotein:12452-12453del(4151fs))|(ORF1a_polyprotein:12452-12453del(4151fs)) 8336 0.15 1 0.15 0 0.15
12756 C12756A|(ORF1ab_polyprotein:C12491A(T4164N))|(ORF1a_polyprotein:C12491A(T4164N)) 52266 0.932 2 0.001 1 0.002 4 0 1 0.001 5 0.932 0.004 0.936
12761 G12761T|(ORF1ab_polyprotein:G12496T(D4166Y))|(ORF1a_polyprotein:G12496T(D4166Y)) 52357 0.933 1 0 1 0.002 1 0 1 0.001 5 0.933 0.003 0.936
12772 A12772G|(ORF1ab_polyprotein:A12507G(L4169L))|(ORF1a_polyprotein:A12507G(L4169L)) 3692 0.066 1 0.066 0 0.066
12970 C12970T|(ORF1ab_polyprotein:C12705T(N4235N))|(ORF1a_polyprotein:C12705T(N4235N)) 1666 0.073 1 0 1 0 1 0.002 4 0.073 0.002 0.075
13009 RATG13 C13009T|(ORF1ab_polyprotein:C12744T(A4248A))|(ORF1a_polyprotein:C12744T(A4248A)) 1678 0.074 1 0 3 0 1 0 1 0 5 0.074 0 0.074
13093 T13093A|(ORF1ab_polyprotein:T12828A(A4276A))|(ORF1a_polyprotein:T12828A(A4276A)) 2290 0.066 1 0 2 0 3 0 4 0.066 0 0.066
13126 G13126A|(ORF1ab_polyprotein:G12861A(G4287G))|(ORF1a_polyprotein:G12861A(G4287G)) 4693 0.377 1 0 6 0 3 0 2 0 5 0.377 0 0.377
13219 A13219G|(ORF1ab_polyprotein:A12954G(Q4318Q))|(ORF1a_polyprotein:A12954G(Q4318Q)) 25575 0.591 9 0 13 0 2 0 1 0 32 0.001 5 0 7 0.591 0.001 0.592
13222 A13222C|(ORF1ab_polyprotein:A12957C(E4319D))|(ORF1a_polyprotein:A12957C(E4319D)) 29217 0.675 13 0 22 0 5 0.001 14 0.001 44 0.001 19 0.001 7 0.675 0.004 0.679
13227 T13227A|(ORF1ab_polyprotein:T12962A(F4321Y))|(ORF1a_polyprotein:T12962A(F4321Y)) 3866 0.089 66 0.002 114 0.002 20 0.003 120 0.002 37 0.002 4 0.002 7 0.089 0.013 0.102
13326 C13326T|(ORF1ab_polyprotein:C13061T(T4354I))|(ORF1a_polyprotein:C13061T(T4354I)) 23423 0.732 2 0 6 0 1 0 4 0.732 0 0.732
13335 C13335T|(ORF1ab_polyprotein:C13070T(A4357V))|(ORF1a_polyprotein:C13070T(A4357V)) 2943 0.092 1 0 2 0 4 0 4 0.092 0 0.092
13743 C13743T|(ORF1ab_polyprotein:C13479T(F4493F)) 2856 0.486 7 0 29 0 10 0 28 0 1 0.001 6 0.486 0.001 0.487
13995 T13995C|(ORF1ab_polyprotein:T13731C(A4577A)) 455 0.085 21 0.001 24 0.001 19 0.001 59 0.001 80 0.001 6 0.085 0.005 0.09
13996 T13996C|(ORF1ab_polyprotein:T13732C(L4578L)) 1911 0.357 22 0.001 14 0 12 0 53 0.001 68 0.001 6 0.357 0.003 0.36
14955 A14955G|(ORF1ab_polyprotein:A14691G(P4897P)) 1681 0.6 3 0 1 0 2 0 4 0.6 0 0.6
15656 C15656T|(ORF1ab_polyprotein:C15392T(T5131I)) 17341 0.928 3 0 2 0 3 0.928 0 0.928
15756 T15756G|(ORF1ab_polyprotein:T15492G(S5164S)) 19112 0.361 1 0 1 0 4 0 4 0.361 0 0.361
15951 C15951T|(ORF1ab_polyprotein:C15687T(I5229I)) 644 0.076 1 0 2 0 1 0 2 0 5 0.076 0 0.076
15963 C15963T|(ORF1ab_polyprotein:C15699T(G5233G)) 5463 0.649 1 0 1 0 4 0 4 0.649 0 0.649
15970 G15970T|(ORF1ab_polyprotein:G15706T(V5236L)) 564 0.067 8 0.001 22 0.002 11 0.002 11 0.001 24 0.001 6 0.067 0.007 0.074
16065 G16065A|(ORF1ab_polyprotein:G15801A(Q5267Q)) 3256 0.335 10 0 17 0 1 0 4 0.335 0 0.335
16403 A16403G|(ORF1ab_polyprotein:A16139G(D5380G)) 4904 0.582 4 0.001 2 0.582 0.001 0.583
16413 T16413G|(ORF1ab_polyprotein:T16149G(D5383E)) 4904 0.582 2 0.001 2 0.001 2 0.003 10 0.002 3 0.001 6 0.582 0.008 0.59
16869 C16869T|(ORF1ab_polyprotein:C16605T(Y5535Y)) 76 0.161 21 0 1 0 4 0 4 0.161 0 0.161
16891 RATG13 T16891C|(ORF1ab_polyprotein:T16627C(L5543L)) 70 0.147 38 0 13 0 8 0 4 0.147 0 0.147
17140 G17140-17140del|(ORF1ab_polyprotein:16876-16876del(5626fs)) 2523 0.06 2 0 2 0.06 0 0.06
17178 T17178A|(ORF1ab_polyprotein:T16914A(V5638V)) 115 0.054 33 0 25 0.001 19 0 8 0.001 5 0.054 0.002 0.056
17288 C17288T|(ORF1ab_polyprotein:C17024T(T5675I)) 9770 0.183 7 0 5 0 2 0 8 0 5 0.183 0 0.183
17385 T17385C|(ORF1ab_polyprotein:T17121C(D5707D)) 7222 0.099 59 0.001 31 0.001 8 0.001 17 0.002 1 0.002 86 0.001 7 0.099 0.008 0.107
17391 T17391C|(ORF1ab_polyprotein:T17127C(S5709S)) 6910 0.333 37 0 25 0.001 5 0 2 0 25 0 6 0.333 0.001 0.334
17406 A17406G|(ORF1ab_polyprotein:A17142G(R5714R)) 6428 0.312 9 0 3 0 6 0 4 0.312 0 0.312
linked 17410 C17410T|(ORF1ab_polyprotein:C17146T(R5716C)) 13532 0.657 113656 0.995 40452 0.997 15394 0.997 9062 0.999 479 0.998 70205 0.995 3 0.75 8 0.657 6.731 7.388
17454 T17454C|(ORF1ab_polyprotein:T17190C(P5730P)) 2975 0.147 115 0.001 50 0.001 8 0.001 1 0 1 0.002 73 0.001 7 0.147 0.006 0.153
17499 T17499C|(ORF1ab_polyprotein:T17235C(Y5745Y)) 80346 0.507 21 0 5 0 2 0 11 0 15 0 6 0.507 0 0.507
17596 G17596T|(ORF1ab_polyprotein:G17332T(A5778S)) 12157 0.088 46 0 41 0 24 0 18 0 1 0.001 25 0 7 0.088 0.001 0.089
17664 T17664C|(ORF1ab_polyprotein:T17400C(Y5800Y)) 66536 0.443 10 0 7 0 4 0 8 0 5 0.443 0 0.443
17856 A17856G|(ORF1ab_polyprotein:A17592G(E5864E)) 3657 0.088 11 0 1 0 1 0 1 0 5 0.088 0 0.088
17895 T17895C|(ORF1ab_polyprotein:T17631C(A5877A)) 3361 0.081 14 0 1 0 2 0 1 0 5 0.081 0 0.081
18246 C18246T|(ORF1ab_polyprotein:C17982T(Y5994Y)) 1781 0.347 2 0 1 0 3 0.347 0 0.347
18251 A18251G|(ORF1ab_polyprotein:A17987G(N5996S)) 293 0.057 1 0 2 0 3 0.057 0 0.057
18570 C18570T|(ORF1ab_polyprotein:C18306T(L6102L)) 2360 0.051 12 0 2 0 4 0 4 0 5 0.051 0 0.051
18855 T18855C|(ORF1ab_polyprotein:T18591C(C6197C)) 6215 0.349 5 0 1 0 3 0 1 0 5 0.349 0 0.349
18890 A18890T|(ORF1ab_polyprotein:A18626T(E6209V)) 1180 0.066 3 0 3 0 8 0 4 0.066 0 0.066
19027 C19027T|(ORF1ab_polyprotein:C18763T(H6255Y)) 89 0.082 1 0 1 0 1 0 1 0.001 5 0.082 0.001 0.083
19269 C19269T|(ORF1ab_polyprotein:C19005T(N6335N)) 1509 0.211 1 0 1 0 3 0.211 0 0.211
19401 T19401A|(ORF1ab_polyprotein:T19137A(S6379S)) 16635 0.748 2 0 1 0 11 0 3 0 5 0.748 0 0.748
19839 T19839C|(ORF1ab_polyprotein:T19575C(N6525N)) 1608 0.441 1 0 4 0 2 0 3 0 5 0.441 0 0.441
19881 C19881T|(ORF1ab_polyprotein:C19617T(D6539D)) 7782 0.052 1 0 3 0 3 0.052 0 0.052
19947 G19947T|(ORF1ab_polyprotein:G19683T(K6561N)) 8718 0.06 32 0.001 29 0.002 2 0 67 0.001 9 0.001 6 0.06 0.005 0.065
19983 C19983T|(ORF1ab_polyprotein:C19719T(V6573V)) 12979 0.088 3 0 2 0 19 0.001 7 0 1 0 6 0.088 0.001 0.089
20297 AATT20297-20300del|(ORF1ab_polyprotein:20033-20036del(6678fs)) 6474 0.078 1 0.078 0 0.078
20401 T20401A|(ORF1ab_polyprotein:T20137A(S6713T)) 12966 0.382 3 0 1 0.001 11 0 11 0.001 5 0.382 0.002 0.384
20407 T20407G|(ORF1ab_polyprotein:T20143G(F6715V)) 13426 0.396 3 0 1 0.001 48 0.001 14 0.001 5 0.396 0.003 0.399
20451 RATG13 C20451T|(ORF1ab_polyprotein:C20187T(N6729N)) 25310 0.278 2 0 2 0.278 0 0.278
20697 T20697C|(ORF1ab_polyprotein:T20433C(N6811N)) 75123 0.531 5 0 4 0 8 0 5 0 4 0 6 0.531 0 0.531
20762 C20762T|(ORF1ab_polyprotein:C20498T(T6833I)) 31803 0.233 2 0 2 0 2 0 9 0 5 0 6 0.233 0 0.233
20844 C20844T|(ORF1ab_polyprotein:C20580T(P6860P)) 73419 0.541 2 0 1 0 9 0 2 0 7 0 6 0.541 0 0.541
20883 T20883C|(ORF1ab_polyprotein:T20619C(D6873D)) 1177 0.454 13 0 8 0 55 0 15 0 5 0.454 0 0.454
20946 C20946T|(ORF1ab_polyprotein:C20682T(V6894V)) 434 0.379 6 0 2 0 1 0.005 12 0 6 0 6 0.379 0.005 0.384
21179 A21179G|(ORF1ab_polyprotein:A20915G(H6972R)) 300 0.097 31 0 10 0 111 0 26 0 3 0 6 0.097 0 0.097
21306 RATG13 C21306T|(ORF1ab_polyprotein:C21042T(R7014R)) 22144 0.166 14 0 4 0 3 0 35 0 7 0 3 0 7 0.166 0 0.166
21361 A21361G|(ORF1ab_polyprotein:A21097G(N7033D)) 13032 0.097 40 0 7 0 2 0 6 0 60 0 16 0 2 0 8 0.097 0 0.097
21410 C21410A|(ORF1ab_polyprotein:C21146A(P7049H)) 23811 0.173 8 0.003 6 0.001 2 0 2 0.003 17 0.002 6 0.173 0.009 0.182
21609 21609-insertTCATGCCACTGT|(surface_glycoprotein:GTT46-48GTCATGCCACTGTTTinsert(V16VMPLF)) 184 0.054 1 0 2 0.054 0 0.054
21612 A21612G|(surface_glycoprotein:A50G(N17S)) 417 0.125 3 0 2 0.125 0 0.125
21652 T21652A|(surface_glycoprotein:T90A(N30K)) 28354 0.896 1 0.001 2 0.896 0.001 0.897
21694 A21694G|(surface_glycoprotein:A132G(R44R)) 3258 0.086 1 0.086 0 0.086
linkedubiq 21711 RATG13 C21711T|(surface_glycoprotein:C149T(S50L)) 36965 0.994 580 0.995 36 0.973 626 0.998 13 1 841 0.991 66 0.022 7 0.994 4.979 5.973
21760 T21760A|(surface_glycoprotein:T198A(H66Q)) 33951 0.975 2 0.003 3 0.003 3 0.975 0.006 0.981
linkedubiq 21765 TACATG21765-21770del|(surface_glycoprotein:ATACATGTC202-210ATCdel(IHV68-70Idel)) 34377 0.993 587 0.969 40 0.976 43 1 8 1 862 0.97 97 0.032 7 0.993 4.947 5.94
21789 RATG13 C21789T|(surface_glycoprotein:C227T(T76I)) 33750 0.974 1 0.974 0 0.974
21802 T21802A|(surface_glycoprotein:T240A(D80E)) 33686 0.972 1 0.972 0 0.972
21859 RATG13 C21859T|(surface_glycoprotein:C297T(N99N)) 1345 0.066 1 0.066 0 0.066
21940 T21940G|(surface_glycoprotein:T378G(V126V)) 4510 0.074 17 0.001 262 0.003 379 0.003 140 0.001 5 0.074 0.008 0.082
linkedubiq 21991 TTA21991-21993del|(surface_glycoprotein:GTTTAT427-432GTTdel(VY143-144Vdel)) 59989 0.985 3 1 13320 0.988 96798 0.989 263 0.992 897 0.963 146173 0.986 102252 0.992 8 0.985 6.91 7.895
22012 A22012T|(surface_glycoprotein:A450T(K150N)) 12379 0.859 7 0.001 39 0 92 0.001 21 0 5 0.859 0.002 0.861
22077 C22077T|(surface_glycoprotein:C515T(S172F)) 718 0.054 1 0 1 0 6 0 1 0 5 0.054 0 0.054
22104 G22104A|(surface_glycoprotein:G542A(G181E)) 11573 0.671 6 0 4 0 1 0 4 0.671 0 0.671
22155 A22155G|(surface_glycoprotein:A593G(D198G)) 520 0.058 4 0 9 0 17 0 11 0 5 0.058 0 0.058
22309 G22309T|(surface_glycoprotein:G747T(L249F)) 7475 0.818 53 0.001 23 0.001 19 0.001 83 0.001 53 0.001 6 0.818 0.005 0.823
22447 T22447G|(surface_glycoprotein:T885G(P295P)) 29451 0.646 11 0 4 0 6 0 4 0 15 0 11 0 7 0.646 0 0.646
22501 T22501C|(surface_glycoprotein:T939C(Y313Y)) 29820 0.646 19 0 8 0 3 0 2 0 21 0 4 0 14 0 8 0.646 0 0.646
22600 A22600C|(surface_glycoprotein:A1038C(R346S)) 1129 0.815 1 0 2 0.815 0 0.815
22661 G22661T|(surface_glycoprotein:G1099T(V367F)) 47666 0.728 2 0.001 12 0.001 8 0.001 41 0.001 7 0.001 6 0.728 0.005 0.733
22694 A22694G|(surface_glycoprotein:A1132G(K378E)) 8040 0.124 1 0 6 0 1 0 5 0 1 0 6 0.124 0 0.124
22725 A22725G|(surface_glycoprotein:A1163G(N388S)) 39362 0.605 3 0 3 0 3 0.605 0 0.605
22812 A22812C|(surface_glycoprotein:A1250C(K417T)) 10899 0.887 1 0.887 0 0.887
22898 G22898A|(surface_glycoprotein:GGT1336-1338AAT(G446N)) 3189 0.07 1 0 1 0 3 0.07 0 0.07
22899 G22899A|(surface_glycoprotein:GGT1336-1338AAT(G446N)) 3189 0.07 1 0 1 0 3 0.07 0 0.07
22907 T22907C|(surface_glycoprotein:TAT1345-1347CGT(Y449R)) 3655 0.08 1 0.08 0 0.08
22908 A22908G|(surface_glycoprotein:TAT1345-1347CGT(Y449R)) 3655 0.08 1 0.08 0 0.08
22991 A22991G|(surface_glycoprotein:AGC1429-1431GAC(S477D)) 2995 0.086 3 0 2 0.086 0 0.086
22992 G22992A|(surface_glycoprotein:AGC1429-1431GAC(S477D)) 2995 0.086 3 0 2 0.086 0 0.086
linked 22992 G22992A|(surface_glycoprotein:G1430A(S477N)) 31896 0.911 5734 0.998 1077 0.998 3 1 10032 1 49 1 16867 0.997 4 0.8 8 0.911 6.793 7.704
22995 C22995G|(surface_glycoprotein:C1433G(T478R)) 3008 0.086 1 0 1 0 1 0 4 0.086 0 0.086
23013 A23013C|(surface_glycoprotein:A1451C(E484A)) 8289 0.093 1 0.093 0 0.093
23040 A23040G|(surface_glycoprotein:A1478G(Q493R)) 48493 0.518 1 0.518 0 0.518
23048 G23048A|(surface_glycoprotein:G1486A(G496S)) 8295 0.089 1 0 2 0 3 0.089 0 0.089
23054 RATG13 C23054T|(surface_glycoprotein:CAA1492-1494TAC(Q498Y)) 56543 0.604 1 0.604 0 0.604
23056 RATG13 A23056C|(surface_glycoprotein:CAA1492-1494TAC(Q498Y)) 56543 0.604 1 0.604 0 0.604
23057 C23057G|(surface_glycoprotein:C1495G(P499A)) 48485 0.518 1 0 2 0 3 0.518 0 0.518
23064 A23064G|(surface_glycoprotein:A1502G(N501S)) 56776 0.605 1 0.605 0 0.605
linkedubiq 23075 RATG13 T23075C|(surface_glycoprotein:T1513C(Y505H)) 62925 0.996 5731 0.998 1078 0.998 9887 0.999 2 1 16854 0.997 6 0.996 4.992 5.988
23119 T23119A|(surface_glycoprotein:T1557A(H519Q)) 5251 0.089 30 0.001 76 0.001 82 0.001 321 0.001 43 0.001 6 0.089 0.005 0.094
23144 A23144-23144del|(surface_glycoprotein:1582-1582del(528fs)) 4611 0.078 4 0 13 0 16 0 52 0 5 0 6 0.078 0 0.078
23274 A23274G|(surface_glycoprotein:A1712G(D571G)) 17198 0.308 22 0 22 0 29 0 2 0 126 0 23 0 7 0.001 8 0.308 0.001 0.309
23382 A23382G|(surface_glycoprotein:A1820G(Q607R)) 18783 0.925 19 0 25 0 22 0 1 0.002 62 0 7 0 5 0.001 8 0.925 0.003 0.928
linkedubiq 23403 Delta A23403G|(surface_glycoprotein:A1841G(D614G)) 87361 0.995 83493 0.997 103988 0.997 117633 0.997 56 0.8 374 0.995 399861 0.996 70070 0.998 8282 0.995 9 0.995 7.775 8.77
23437 T23437A|(surface_glycoprotein:T1875A(H625Q)) 20766 0.236 25 0 39 0 11 0 68 0 7 0 7 0.001 7 0.236 0.001 0.237
23507 T23507C|(surface_glycoprotein:T1945C(C649R)) 4393 0.061 16 0.001 7 0 7 0 2 0 5 0.061 0.001 0.062
23586 A23586T|(surface_glycoprotein:A2024T(Q675L)) 2568 0.531 11 0 5 0 10 0.001 4 0.001 5 0.531 0.002 0.533
23594 A23594T|(surface_glycoprotein:A2032T(T678S)) 2540 0.527 10 0 5 0 11 0 3 0 5 0.527 0 0.527
23604 C23604A|(surface_glycoprotein:CCT2041-2043CAA(P681Q)) 2568 0.993 1 0.993 0 0.993
23605 T23605A|(surface_glycoprotein:CCT2041-2043CAA(P681Q)) 2568 0.993 1 0.993 0 0.993
23655 C23655T|(surface_glycoprotein:C2093T(S698L)) 2566 0.953 3 0 10 0 3 0.953 0 0.953
23756 A23756G|(surface_glycoprotein:A2194G(T732A)) 4715 0.091 1 0 16 0 43 0 4 0.091 0 0.091
23756 A23756G|(surface_glycoprotein:ACC2194-2196GCT(T732A)) 11901 0.231 1 0.231 0 0.231
23758 C23758T|(surface_glycoprotein:ACC2194-2196GCT(T732A)) 11901 0.231 1 0.231 0 0.231
23844 C23844T|(surface_glycoprotein:C2282T(T761I)) 4390 0.077 3 0 17 0 1 0 29 0 5 0.077 0 0.077
23845 A23845G|(surface_glycoprotein:A2283G(T761T)) 11810 0.209 3 0 13 0 28 0 4 0.209 0 0.209
23854 RATG13 C23854T|(surface_glycoprotein:C2292T(N764N)) 3996 0.174 56 0.002 125 0.001 403 0.002 4 0.174 0.005 0.179
23877 T23877C|(surface_glycoprotein:T2315C(V772A)) 2947 0.493 16 0 5 0 4 0 36 0 5 0.493 0 0.493
linked 24034 RATG13 C24034T|(surface_glycoprotein:C2472T(N824N)) 52538 0.543 43432 0.358 4 0 9 0 1 1 5 0.543 1.358 1.901
24044 C24044T|(surface_glycoprotein:C2482T(L828F)) 51754 0.54 6 0 5 0 3 0 4 0.54 0 0.54
24070 A24070C|(surface_glycoprotein:A2508C(Q836H)) 52050 0.542 542 0.005 137 0.005 2 0 602 0.008 5 0.542 0.018 0.56
24197 G24197A|(surface_glycoprotein:G2635A(A879T)) 11266 0.525 1 0 2 0 1 0 2 0 5 0.525 0 0.525
24374 24374-insertT|(surface_glycoprotein:CTT2812-2814TTT(L938F)) 881 0.067 1 0.067 0 0.067
24374 C24374T|(surface_glycoprotein:C2812T(L938F)) 3203 0.245 1 0.245 0 0.245
24374 C24374T|(surface_glycoprotein:CTT2812-2814TTT(L938F)) 887 0.068 1 0.068 0 0.068
linkedubiq 24378 C24378T|(surface_glycoprotein:C2816T(S939F)) 12909 0.988 382 0.997 1073 0.996 963 0.998 21 1 7620 0.988 6 0.988 4.979 5.967
24383 A24383T|(surface_glycoprotein:A2821T(T941S)) 6894 0.525 3 0 2 0.525 0 0.525
24424 A24424G|(surface_glycoprotein:A2862G(Q954Q)) 6962 0.527 1 0.003 5 0.005 2 0.002 18 0.002 5 0.527 0.012 0.539
24499 T24499C|(surface_glycoprotein:T2937C(D979D)) 7783 0.495 15 0 2 0 4 0 4 0.495 0 0.495
24544 RATG13 T24544C|(surface_glycoprotein:T2982C(D994D)) 839 0.191 13 0 3 0 14 0 4 0.191 0 0.191
24813 A24813G|(surface_glycoprotein:A3251G(D1084G)) 1605 0.063 4 0.001 4 0 3 0.063 0.001 0.064
24820 A24820G|(surface_glycoprotein:A3258G(K1086K)) 13918 0.546 1 0 16 0 3 0.546 0 0.546
24961 C24961T|(surface_glycoprotein:C3399T(V1133V)) 3852 0.703 1 0 3 0 3 0.703 0 0.703
linked 25207 C25207T|(surface_glycoprotein:C3645T(Y1215Y)) 14711 0.936 14315 0.994 227 1 2382 0.993 16391 0.999 83 1 6131 0.991 6498 0.995 8 0.936 6.972 7.908
25282 C25282T|(surface_glycoprotein:C3720T(C1240C)) 10984 0.706 5 0 1 0.004 1 0 3 0 1 0 3 0 7 0.706 0.004 0.71
25456 G25456A|(ORF3a_protein:G64A(D22N)) 20633 0.555 2 0 2 0.555 0 0.555
25497 A25497G|(ORF3a_protein:A105G(I35M)) 877 0.818 13 0 2 0.818 0 0.818
25549 C25549T|(ORF3a_protein:C157T(L53F)) 541 0.073 3 0 1 0.002 3 0.073 0.002 0.075
25566 C25566T|(ORF3a_protein:C174T(S58S)) 29190 0.507 5 0 2 0 1 0.002 4 0.507 0.002 0.509
25682 T25682C|(ORF3a_protein:T290C(V97A)) 27987 0.498 5 0 1 0 2 0.003 4 0.498 0.003 0.501
25687 G25687C|(ORF3a_protein:G295C(A99P)) 3667 0.065 7 0 5 0 3 0 1 0 5 0.065 0 0.065
25792 C25792T|(ORF3a_protein:C400T(R134C)) 2604 0.162 1 0.162 0 0.162
25827 25827-insertT|(ORF3a_protein:435insertT(145fs)) 1392 0.087 1 0 2 0.087 0 0.087
25915 A25915C|(ORF3a_protein:A523C(T175P)) 6833 0.115 2 0 61 0.002 1 0.002 4 0.115 0.004 0.119
26030 A26030T|(ORF3a_protein:A638T(Q213L)) 678 0.438 4 0 2 0.001 1 0 4 0.438 0.001 0.439
26093 A26093C|(ORF3a_protein:A701C(N234T)) 691 0.437 12 0.001 11 0.002 27 0.001 1 0.002 2 0.009 25 0.002 7 0.437 0.017 0.454
26195 C26195T|(ORF3a_protein:C803T(T268M)) 138 0.222 5 0 2 0.222 0 0.222
linked 26270 C26270T|(envelope_protein:C26T(T9I)) 1177 0.466 18725 0.994 6410 0.994 18471 0.993 2165 0.996 169 1 11067 0.994 1 1 8 0.466 6.971 7.437
26292 C26292T|(envelope_protein:C48T(S16S)) 203 0.106 2 0 3 0 6 0 1 0.001 2 0 6 0.106 0.001 0.107
26308 G26308A|(envelope_protein:G64A(A22T)) 1200 0.625 1 0 1 0.001 1 0 4 0.625 0.001 0.626
26314 G26314A|(envelope_protein:G70A(V24M)) 1204 0.627 1 0 1 0.001 3 0.627 0.001 0.628
26380 A26380G|(envelope_protein:A136G(I46V)) 1211 0.088 5 0 1 0 4 0 12 0 5 0.088 0 0.088
26483 T26483C 2052 0.186 10 0 5 0 1 0 4 0.186 0 0.186
linkedubiq 26529 G26529C|(membrane_glycoprotein:G7C(D3H)) 11145 0.991 142887 0.991 8583 0.991 85589 0.991 485 1 988 0.998 8 1 67808 0.989 1 1 9 0.991 7.96 8.951
26828 RATG13 G26828A|(membrane_glycoprotein:G306A(L102L)) 909 0.282 2 0 1 0 1 0 4 0.282 0 0.282
26894 C26894T|(membrane_glycoprotein:C372T(L124L)) 5441 0.061 3 0 3 0.001 9 0 1 0 4 0 5 0 7 0.061 0.001 0.062
26960 T26960C|(membrane_glycoprotein:T438C(R146R)) 34152 0.406 6 0 5 0 8 0 2 0 4 0 6 0.406 0 0.406
26972 T26972C|(membrane_glycoprotein:T450C(R150R)) 17562 0.192 5 0 1 0 6 0 1 0 1 0 6 0.192 0 0.192
27285 T27285G|(ORF6_protein:T84G(N28K)) 25735 0.604 15 0 11 0 21 0 27 0 2 0 17 0.001 7 0.604 0.001 0.605
27362 A27362G|(ORF6_protein:A161G(E54G)) 1085 0.125 17 0 1 0 9 0 19 0 9 0 6 0.125 0 0.125
27459 G27459A|(ORF7a_protein:G66A(E22E)) 21573 0.383 2 0 1 0 4 0 4 0.383 0 0.383
27499 T27499C|(ORF7a_protein:T106C(S36P)) 20901 0.388 28 0 10 0 13 0 6 0 5 0.388 0 0.388
27634 T27634C|(ORF7a_protein:T241C(S81P)) 449 0.765 20 0 2 0 2 0 1 0.003 19 0 11 0 7 0.765 0.003 0.768
27711 A27711T|(ORF7a_protein:A318T(A106A)) 2566 0.252 92 0 28 0 11 0 29 0 84 0.001 6 0.252 0.001 0.253
27714 A27714G|(ORF7a_protein:A321G(I107M)) 2562 0.252 58 0 8 0 3 0 1 0 22 0 16 0 7 0.252 0 0.252
27768 TCATTAATTGACTTCTATTTG27768-27788del|(ORF7b:13-33del(SLIDFYL5-11del)) 1358 0.147 1 0.147 0 0.147
linked 27792 TTT27792-27794del|(ORF7b:37-39del(F13del)) 1364 0.138 208 0.042 2 0.138 0.042 0.18
27824 T27824C|(ORF7b:T69C(I23I)) 880 0.056 40 0 37 0.001 12 0 50 0.001 18 0 6 0.056 0.002 0.058
27837 T27837A|(ORF7b:T82A(F28I)) 869 0.055 54 0 32 0 14 0 26 0 57 0.001 6 0.055 0.001 0.056
27864 C27864T|(ORF7b:C109T(H37Y)) 875 0.056 13 0 3 0 4 0 15 0 5 0.056 0 0.056
27983 AT27983-27984del|(ORF8_protein:90-91del(30fs)) 3872 0.162 1 0.162 0 0.162
28835 T28835C|(nucleocapsid_phosphoprotein:T562C(S188P)) 2929 0.079 16 0 25 0 1 0 11 0 34 0 16 0 17 0 8 0.079 0 0.079
29197 RATG13 C29197T|(nucleocapsid_phosphoprotein:C924T(A308A)) 4413 0.545 17 0 6 0 10 0 16 0 5 0.545 0 0.545
29203 C29203T|(nucleocapsid_phosphoprotein:C930T(S310S)) 4210 0.523 26 0 2 0 11 0 17 0 5 0.523 0 0.523
29236 C29236T|(nucleocapsid_phosphoprotein:C963T(G321G)) 4410 0.456 55 0 4 0 1 0 30 0 23 0 6 0.456 0 0.456
29254 G29254T|(nucleocapsid_phosphoprotein:G981T(S327S)) 847 0.088 300 0.001 115 0.002 6 0.001 1 0.001 431 0.001 348 0.002 7 0.088 0.008 0.096
29257 A29257G|(nucleocapsid_phosphoprotein:A984G(G328G)) 1510 0.156 72 0 14 0 65 0 45 0 5 0.156 0 0.156
29302 T29302C|(nucleocapsid_phosphoprotein:T1029C(D343D)) 283 0.15 43 0 8 0 1 0.001 21 0 22 0 6 0.15 0.001 0.151
29407 A29407G|(nucleocapsid_phosphoprotein:A1134G(E378E)) 652 0.05 82 0 10 0 1 0 51 0 39 0 6 0.05 0 0.05
29420 C29420T|(nucleocapsid_phosphoprotein:C1147T(P383S)) 1273 0.098 32 0 3 0 18 0 15 0 5 0.098 0 0.098
29421 C29421T|(nucleocapsid_phosphoprotein:C1148T(P383L)) 7049 0.541 34 0 8 0 2 0 2 0.001 1052 0.003 5 0 7 0.541 0.004 0.545
29458 T29458C|(nucleocapsid_phosphoprotein:T1185C(L395L)) 7431 0.554 83 0 15 0 1 0 77 0 29 0 6 0.554 0 0.554
29498 C29498A|(nucleocapsid_phosphoprotein:C1225A(Q409K)) 9775 0.698 249 0 71 0 14 0 1 0 139 0 160 0.001 7 0.698 0.001 0.699
29740 ACGCGGAGT29740-29748del 14616 0.696 1 0.696 0 0.696
29756 AGTGTAC29756-29762del 14446 0.688 1 0.688 0 0.688
29758 RATG13 T29758G 2045 0.097 1 0.097 0 0.097
linked 29846 T29846C 2 0.013 1 0.013 0 0.013
29855 T29855C 1 0.1 1 0.1 0 0.1
29859 T29859G 1 0.1 3 0.005 2 0.1 0.005 0.105