NC-2 - Complete Raw Mutation Data

Full TSV data with all sample columns and abundance information
← Back to Dashboard

Complete Mutations Data

This table shows the complete data from the mutations.tsv file exactly as it appears in the source. Scroll horizontally to see all columns.

SRR36738672(773498) SRR36738675(752332) SRR36738681(789205) SRR36738687(718384) SRR36738688(757507) SRR36738700(1009816) SRR36738701(749100) SRR36738703(675036) SRR36738704(991452) SRR36738714(886095) SRR36738719(1002887) SRR36738723(1020354) SRR36738728(831684) SRR36738735(898211) SRR36738737(1207345) SRR36752551(2215759) SRR36752556(715682) SRR36752558(1170415) SRR36752565(1415511) SRR36752566(1847632) SRR36763209(844065) SRR37039664(830559) SRR37039669(750730) SRR37039672(874477) SRR37039674(1306905) SRR37039686(929332) SRR37039687(895660) SRR37039690(812633) SRR37039700(699132) SRR37039703(930089)
('2025-09-11', '550000') ('2025-10-17', '178000') ('2025-10-30', '550000') ('2025-10-23', '550000') ('2025-10-21', '550000') ('2025-10-10', '178000') ('2025-10-09', '550000') ('2025-10-07', '550000') ('2025-09-09', '178000') ('2025-09-30', '178000') ('2025-09-25', '550000') ('2025-09-23', '178000') ('2025-09-18', '550000') ('2025-09-12', '178000') ('2025-09-05', '550000') ('2025-09-02', '178000') ('2025-11-25', '550000') ('2025-11-25', '178000') ('2025-08-28', '550000') ('2025-08-28', '182501') ('2025-08-26', '178000') ('2025-11-27', '550000') ('2025-12-19', '178000') ('2026-01-01', '550000') ('2025-12-30', '550000') ('2026-01-06', '178000') ('2025-12-18', '550000') ('2025-12-16', '550000') ('2025-12-08', '182501') ('2025-12-04', '550000')
Sequences Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Total samples Positives Sum Negatives Sum Total Sum
335 C335A|(ORF1ab_polyprotein:C70A(R24S))|(ORF1a_polyprotein:C70A(R24S)) 7 0.389 92 0.760 2 1.149 0 1.149
805 G805T|(ORF1ab_polyprotein:G540T(G180G))|(ORF1a_polyprotein:G540T(G180G)) 1 0.001 1 0.001 1 0.000 27 0.023 1 0.000 583 0.403 6 0.42600000000000005 0.002 0.42800000000000005
814 T814C|(ORF1ab_polyprotein:T549C(T183T))|(ORF1a_polyprotein:T549C(T183T)) 1 0.000 24 0.020 1 0.000 594 0.406 4 0.42600000000000005 0.0 0.42600000000000005
2611 A2611G|(ORF1ab_polyprotein:A2346G(P782P))|(ORF1a_polyprotein:A2346G(P782P)) 1 0.001 213 0.147 860 0.463 3 0.61 0.001 0.611
2720 G2720T|(ORF1ab_polyprotein:G2455T(A819S))|(ORF1a_polyprotein:G2455T(A819S)) 1 0.000 237 0.154 976 0.458 3 0.612 0.0 0.612
2786 A2786G|(ORF1ab_polyprotein:A2521G(I841V))|(ORF1a_polyprotein:A2521G(I841V)) 1 0.001 1 0.000 268 0.177 1 0.001 941 0.463 5 0.64 0.002 0.642
ubiq 3037 RATG13,Delta C3037T|(ORF1ab_polyprotein:C2772T(F924F))|(ORF1a_polyprotein:C2772T(F924F)) 1433 0.998 1080 0.999 1114 0.998 538 0.996 1112 0.999 1315 0.998 511 1.000 1853 0.999 1165 1.000 1174 0.997 2762 0.998 962 0.999 276 0.996 1776 0.998 1570 0.997 123 0.992 251 1.000 84 0.988 246 1.000 313 0.994 754 0.999 506 0.996 1109 0.999 331 0.997 101 0.990 721 0.999 938 0.998 27 1.999 24.924999999999994 26.923999999999992
5151 RATG13 T5151C|(ORF1ab_polyprotein:T4886C(V1629A))|(ORF1a_polyprotein:T4886C(V1629A)) 1 0.000 1 0.000 1 0.000 1 0.000 1450 0.394 538 0.263 1 0.000 7 0.657 0.0 0.657
5269 A5269G|(ORF1ab_polyprotein:A5004G(K1668K))|(ORF1a_polyprotein:A5004G(K1668K)) 1 0.001 1 0.000 1 0.000 1 0.000 1 0.000 764 0.241 1 0.000 400 0.236 8 0.477 0.001 0.478
6568 C6568A|(ORF1ab_polyprotein:C6303A(D2101E))|(ORF1a_polyprotein:C6303A(D2101E)) 1 0.003 1 0.002 5 0.038 37 1.000 4 1.038 0.005 1.043
6759 G6759T|(ORF1ab_polyprotein:G6494T(C2165F))|(ORF1a_polyprotein:G6494T(C2165F)) 12 0.058 39 0.975 2 1.033 0 1.033
7452 G7452T|(ORF1ab_polyprotein:G7187T(S2396I))|(ORF1a_polyprotein:G7187T(S2396I)) 125 0.064 249 1.000 2 1.064 0 1.064
linked 7764 C7764T|(ORF1ab_polyprotein:C7499T(S2500F))|(ORF1a_polyprotein:C7499T(S2500F)) 1 0.001 1 0.000 778 0.155 814 0.366 1 0.001 1102 0.998 6 1.153 0.368 1.521
7783 T7783C|(ORF1ab_polyprotein:T7518C(D2506D))|(ORF1a_polyprotein:T7518C(D2506D)) 1 0.000 1 0.000 2 0.001 1 0.000 2 0.000 1 0.000 1042 0.154 1 0.000 1 0.001 1484 0.995 10 1.149 0.002 1.151
7919 T7919C|(ORF1ab_polyprotein:T7654C(S2552P))|(ORF1a_polyprotein:T7654C(S2552P)) 1 0.000 1 0.000 1 0.000 1 0.000 2 0.001 2 0.000 1 0.000 1 0.000 1 0.000 1 0.000 1342 1.000 11 1.0 0.001 1.001
7937 T7937G|(ORF1ab_polyprotein:T7672G(S2558A))|(ORF1a_polyprotein:T7672G(S2558A)) 1 0.000 2 0.001 1 0.000 2 0.000 1 0.000 1 0.000 1 0.000 2 0.000 1 0.000 1 0.000 2 0.000 3 0.001 1001 0.150 1 0.000 1 0.000 1 0.000 2 0.000 1 0.000 1251 0.998 19 1.148 0.002 1.15
8386 C8386T|(ORF1ab_polyprotein:C8121T(H2707H))|(ORF1a_polyprotein:C8121T(H2707H)) 1 0.000 1 0.000 1 0.000 1 0.000 1 0.000 1 0.000 2 0.000 1 0.000 7703 0.690 9 0.69 0.0 0.69
8582 T8582C|(ORF1ab_polyprotein:T8317C(L2773L))|(ORF1a_polyprotein:T8317C(L2773L)) 1 0.000 1 0.000 1 0.000 3 0.000 1 0.000 2 0.000 1 0.000 2657 0.250 1 0.000 1 0.000 1 0.000 1 0.000 2 0.000 1 0.000 1 0.000 13713 0.999 16 1.249 0.0 1.249
9251 G9251A|(ORF1ab_polyprotein:G8986A(V2996I))|(ORF1a_polyprotein:G8986A(V2996I)) 1 0.001 1 0.000 1 0.002 24 0.039 2 0.500 5 0.539 0.003 0.542
9377 A9377G|(ORF1ab_polyprotein:A9112G(I3038V))|(ORF1a_polyprotein:A9112G(I3038V)) 1 0.005 35 0.071 4 0.571 3 0.6419999999999999 0.005 0.6469999999999999
9389 G9389A|(ORF1ab_polyprotein:G9124A(D3042N))|(ORF1a_polyprotein:G9124A(D3042N)) 31 0.070 4 0.500 2 0.5700000000000001 0 0.5700000000000001
9440 T9440A|(ORF1ab_polyprotein:T9175A(C3059S))|(ORF1a_polyprotein:T9175A(C3059S)) 37 0.066 7 0.500 2 0.5660000000000001 0 0.5660000000000001
9693 RATG13 C9693T|(ORF1ab_polyprotein:C9428T(A3143V))|(ORF1a_polyprotein:C9428T(A3143V)) 1 0.000 1 0.000 1 0.000 2 0.000 2 0.000 1 0.000 1 0.000 1 0.000 1 0.000 1 0.000 2 0.000 1 0.000 1 0.000 3233 0.998 14 0.998 0.0 0.998
ubiq 10029 C10029T|(ORF1ab_polyprotein:C9764T(T3255I))|(ORF1a_polyprotein:C9764T(T3255I)) 1917 0.998 893 1.000 1309 0.997 607 0.997 79 0.988 2207 0.998 1010 1.000 1026 0.998 1722 0.998 910 1.000 719 1.000 1969 0.998 2307 0.998 904 0.996 1634 0.995 734 0.999 1578 0.997 653 0.998 330 0.997 1100 0.999 286 0.997 601 0.997 1171 0.998 23 1.995 20.948 22.943
10421 T10421G|(ORF1ab_polyprotein:T10156G(S3386A))|(ORF1a_polyprotein:T10156G(S3386A)) 3 0.000 1 0.000 2 0.000 3 0.001 1 0.000 4 0.001 1 0.000 3 0.000 2 0.000 3 0.000 1 0.000 2 0.000 1 0.000 3 0.000 2 0.000 1 0.000 11 0.733 17 0.733 0.002 0.735
10553 T10553C|(ORF1ab_polyprotein:T10288C(L3430L))|(ORF1a_polyprotein:T10288C(L3430L)) 2 0.000 2 0.001 1 0.000 1 0.000 1 0.000 1 0.003 3 0.000 4 0.000 2 0.000 3 0.000 1 0.000 3 0.000 3272 0.316 13 0.316 0.004 0.32
10702 C10702T|(ORF1ab_polyprotein:C10437T(D3479D))|(ORF1a_polyprotein:C10437T(D3479D)) 1 0.000 1 0.001 1 0.000 5 0.000 1 0.000 1 0.000 1 0.000 3339 0.322 8 0.322 0.001 0.323
11095 C11095T|(ORF1ab_polyprotein:C10830T(A3610A))|(ORF1a_polyprotein:C10830T(A3610A)) 1 0.000 2 0.000 1 0.000 2 0.000 1 1.000 5 1.0 0.0 1.0
11930 G11930A|(ORF1ab_polyprotein:G11665A(A3889T))|(ORF1a_polyprotein:G11665A(A3889T)) 1 0.031 11 0.212 2 0.243 0 0.243
12034 T12034C|(ORF1ab_polyprotein:T11769C(G3923G))|(ORF1a_polyprotein:T11769C(G3923G)) 3 0.000 1 0.000 1 0.000 1 0.000 1 0.000 1 0.000 1 0.000 61 0.052 1 0.000 1040 0.564 10 0.616 0.0 0.616
14032 RATG13 A14032G|(ORF1ab_polyprotein:A13768G(N4590D)) 3 0.000 1 0.000 1 0.000 1 0.000 1 0.000 2 0.000 1 0.000 2 0.000 2 0.000 1 0.000 2 0.000 2 0.000 1 0.000 2 0.000 2 0.001 1 0.000 1 0.000 3 0.001 3907 0.662 19 0.662 0.002 0.664
ubiq 14408 Delta C14408T|(ORF1ab_polyprotein:C14144T(P4715L)) 1046 0.997 83 1.000 1408 0.998 133 1.000 2482 0.998 5140 0.998 87 1.000 2852 0.998 2893 0.997 4786 0.998 2059 0.999 3111 0.998 2482 0.998 3850 0.999 6100 0.997 2127 0.995 2964 0.995 5885 0.995 9154 0.997 1022 0.994 6864 0.999 1853 0.998 3522 0.999 2850 0.999 3781 0.998 2552 0.998 139 1.000 622 1.000 28 1.9969999999999999 25.945 27.942
15165 A15165G|(ORF1ab_polyprotein:A14901G(L4967L)) 2 0.001 1 0.000 1 0.000 1 0.000 1 0.000 2 0.000 1 0.002 1 0.000 3 0.000 2 0.000 1 0.000 1 0.000 1 0.000 5 0.001 1 0.000 2 0.000 2 0.001 1583 0.475 1 0.000 19 0.475 0.005 0.48
15715 T15715C|(ORF1ab_polyprotein:T15451C(S5151P)) 3 0.000 4 0.000 1 0.000 4 0.000 3 0.000 4 0.000 4 0.000 2 0.000 1 0.000 3 0.000 1 0.000 1 0.000 9 0.000 9 0.000 6 0.000 8 0.000 4 0.000 3 0.000 1 0.000 1 0.000 3 0.000 2 0.000 2969 0.415 3 0.000 24 0.415 0.0 0.415
15784 T15784G|(ORF1ab_polyprotein:T15520G(F5174V)) 5 0.000 12 0.001 4 0.001 7 0.000 5 0.001 9 0.001 6 0.000 5 0.000 4 0.000 3 0.000 3 0.000 4 0.000 33 0.001 31 0.001 21 0.001 20 0.001 12 0.001 2 0.000 11 0.001 1 0.000 3 0.001 3 0.000 5 0.001 4 0.000 2750 0.393 11 0.001 26 0.394 0.012000000000000004 0.406
15839 G15839C|(ORF1ab_polyprotein:G15575C(W5192S)) 1 0.000 1 0.000 1 0.000 1 0.000 2 0.000 1 0.000 2146 0.322 7 0.322 0.0 0.322
15873 A15873G|(ORF1ab_polyprotein:A15609G(E5203E)) 5 0.000 1 0.000 1 0.000 2 0.000 1 0.000 3 0.000 1 0.000 1 0.000 4 0.000 8 0.000 1 0.000 4 0.000 582 0.046 2 0.000 1 0.000 2 0.000 1345 0.281 1 0.000 18 0.281 0.046 0.327
15960 C15960A|(ORF1ab_polyprotein:C15696A(A5232A)) 8 0.001 12 0.002 19 0.001 21 0.002 6 0.000 10 0.001 3 0.001 35 0.001 38 0.002 26 0.001 28 0.002 17 0.001 28 0.002 102 0.003 53 0.003 95 0.004 95 0.004 71 0.003 48 0.003 18 0.001 22 0.001 10 0.001 30 0.002 14 0.001 16 0.001 4682 0.274 24 0.001 27 0.277 0.042000000000000016 0.31900000000000006
16071 T16071C|(ORF1ab_polyprotein:T15807C(Y5269Y)) 3 0.000 1 0.000 1 0.000 3 0.000 1 0.000 2 0.000 2 0.000 1 0.000 1 0.000 2 0.000 5 0.000 1 0.000 2 0.000 1 0.000 3 0.000 1 0.000 1 0.000 4262 0.273 18 0.273 0.0 0.273
16466 C16466T|(ORF1ab_polyprotein:C16202T(P5401L)) 1 0.000 399 0.076 1 0.000 1415 0.294 4 0.37 0.0 0.37
16726 C16726T|(ORF1ab_polyprotein:C16462T(H5488Y)) 1 0.001 1 0.001 146 0.055 1 0.001 1 0.000 1179 0.468 6 0.523 0.003 0.526
17032 G17032A|(ORF1ab_polyprotein:G16768A(V5590I)) 1 0.000 1 0.000 1 0.000 2 0.000 1 0.000 1 0.000 2608 0.101 2 0.000 4 0.000 1 0.000 3 0.000 2 0.000 3731 0.455 13 0.556 0.0 0.556
17050 G17050A|(ORF1ab_polyprotein:G16786A(V5596I)) 1 0.000 1 0.000 1 0.000 2 0.000 1 0.000 2 0.000 5 0.000 2208 0.094 1 0.000 1 0.000 2 0.000 1 0.000 2696 0.336 1 0.000 14 0.43000000000000005 0.0 0.43000000000000005
17373 RATG13 C17373T|(ORF1ab_polyprotein:C17109T(A5703A)) 1 0.000 1 0.000 1 0.000 759 0.055 61 0.004 1 0.000 1 0.000 1 0.000 2978 0.591 9 0.595 0.055 0.65
17497 T17497C|(ORF1ab_polyprotein:T17233C(Y5745H)) 2 0.000 3 0.000 2 0.000 5 0.000 2 0.000 3 0.000 1 0.000 4 0.000 1 0.000 1 0.000 3 0.000 7 0.000 8 0.000 4 0.000 4 0.000 159 0.005 1 0.000 3 0.000 2 0.000 2 0.000 1 0.000 3 0.000 7090 0.600 23 0.605 0.0 0.605
17826 T17826G|(ORF1ab_polyprotein:T17562G(T5854T)) 2 0.000 1 0.000 1 0.000 3 0.000 2 0.000 1 0.000 2 0.000 5 0.000 4 0.000 13 0.001 6 0.001 2 0.000 19 0.001 8 0.000 4 0.000 2 0.000 4 0.000 4 0.000 3 0.000 1 0.000 6 0.000 3681 0.999 3 0.000 23 0.999 0.003 1.002
18411 T18411C|(ORF1ab_polyprotein:T18147C(Y6049Y)) 1 0.001 1 0.000 293 0.199 1 0.001 1 0.001 5 0.2 0.002 0.202
19018 C19018T|(ORF1ab_polyprotein:C18754T(P6252S)) 1 0.000 2 0.000 2 0.000 1 0.000 1 0.000 2 0.000 1 0.000 1 0.000 1 0.000 1 0.000 4563 0.451 11 0.451 0.0 0.451
19220 C19220T|(ORF1ab_polyprotein:C18956T(A6319V)) 1 0.000 2 0.000 1 0.000 2 0.000 1 0.000 1 0.000 3 0.000 1 0.000 4 0.000 1 0.000 1323 0.075 2 0.000 2 0.000 1 0.000 1 0.000 1 0.000 1 0.000 1 0.000 6456 0.999 19 1.074 0.0 1.074
21384 T21384C|(ORF1ab_polyprotein:T21120C(Y7040Y)) 1 0.001 2 0.001 3 0.000 3 0.000 1 0.000 375 0.073 1022 0.335 7 0.40800000000000003 0.002 0.41000000000000003
21602 CAGTGTGTTAATCTTACAACCAGA21602-21625del|(surface_glycoprotein:40-63del(QCVNLTTR14-21del)) 94 0.026 31 0.344 2 0.37 0 0.37
21642 C21642T|(surface_glycoprotein:C80T(A27V)) 202 0.026 31 0.344 2 0.37 0 0.37
21651 A21651C|(surface_glycoprotein:A89C(N30T)) 3 0.002 2 0.001 3 0.001 3 0.001 7 0.001 3 0.001 4 0.001 6 0.002 6 0.001 6 0.001 2 0.001 4 0.001 1 0.000 13 0.002 6 0.001 326 0.036 6 0.001 2 0.001 4 0.000 2 0.001 2 0.001 31 0.344 1 0.000 23 0.37999999999999995 0.021000000000000005 0.40099999999999997
ubiq 21711 RATG13 C21711T|(surface_glycoprotein:C149T(S50L)) 2894 0.993 3289 0.996 4134 0.996 6032 0.996 8078 0.994 2526 0.996 5518 0.994 3867 0.996 7298 0.997 12514 0.996 2859 0.995 5288 0.996 6115 0.996 12058 0.994 2816 0.991 11763 0.990 13252 0.935 6371 0.996 4046 0.993 11988 0.994 3590 0.999 3014 0.994 1713 0.994 4215 0.991 1 1.000 3845 0.978 26 1.935 23.854999999999997 25.789999999999996
ubiq 21765 TACATG21765-21770del|(surface_glycoprotein:ATACATGTC202-210ATCdel(IHV68-70Idel)) 2095 0.999 2330 0.997 3049 0.999 4310 0.998 5737 0.998 1745 1.000 4012 0.999 2870 0.999 5339 0.999 9039 0.999 2170 0.999 3314 0.891 3858 0.902 7977 0.918 2027 1.000 8668 0.998 10018 0.998 4595 0.999 2850 0.998 8490 0.999 2500 0.999 2137 0.999 1145 1.000 2884 1.000 1 1.000 2946 0.998 26 1.998 23.686999999999998 25.685
ubiq 21941 G21941T|(surface_glycoprotein:G379T(V127F)) 265 1.000 697 1.000 611 1.000 448 1.000 1077 1.000 253 1.000 584 1.000 1724 1.000 914 1.000 760 1.000 1037 1.000 415 1.000 1031 0.999 865 0.999 378 1.000 854 1.000 1250 1.000 509 0.977 517 1.000 4237 1.000 1299 1.000 2887 0.999 1676 0.999 3144 1.000 2677 1.000 1073 0.993 26 1.97 23.996 25.965999999999998
ubiq 21987 G21987A|(surface_glycoprotein:G425A(G142D)) 440 0.998 1101 0.998 971 1.000 734 0.999 1736 0.999 402 1.000 925 0.997 2769 0.999 1452 0.999 1150 0.997 1640 0.999 704 1.000 1591 1.000 1388 0.999 695 1.000 1353 0.998 1944 0.997 830 0.990 790 0.999 6640 0.998 2009 0.998 4505 0.998 2622 0.999 4889 0.999 4102 0.999 1767 0.995 26 1.9849999999999999 23.968999999999994 25.953999999999994
ubiq 22194 ATT22194-22196del|(surface_glycoprotein:AATTTA631-636ATAdel(NL211-212Idel)) 258 1.000 582 0.998 475 1.000 428 1.000 975 0.999 243 1.000 537 1.000 1576 0.999 864 0.999 558 1.000 935 1.000 369 1.000 846 0.999 728 1.000 474 1.000 708 1.000 1107 1.000 492 0.967 344 1.000 3547 0.999 1055 1.000 2537 0.999 1434 0.999 2638 0.998 2337 0.999 1000 0.997 26 1.964 23.988 25.951999999999998
ubiq 22200 T22200G|(surface_glycoprotein:T638G(V213G)) 258 1.000 579 0.993 474 0.998 427 0.998 969 0.993 241 0.992 536 0.998 1574 0.998 861 0.995 557 0.998 933 0.997 368 0.997 846 0.999 721 0.990 468 0.987 698 0.986 1100 0.993 485 0.953 343 0.997 3540 0.997 1050 0.995 2531 0.996 1429 0.996 2636 0.998 2336 0.997 999 0.996 26 1.9489999999999998 23.888 25.837000000000003
ubiq 22208 C22208T|(surface_glycoprotein:C646T(L216F)) 205 1.000 480 0.996 398 0.997 371 1.000 804 1.000 213 1.000 453 0.998 1313 0.999 694 1.000 449 1.000 781 0.999 284 1.000 680 1.000 599 0.998 394 1.000 613 1.000 975 1.000 410 0.962 277 1.000 3112 0.998 895 0.999 2163 0.998 1244 0.998 2283 1.000 2061 1.000 872 0.997 26 1.959 23.98 25.939
22566 T22566G|(surface_glycoprotein:T1004G(L335W)) 6 0.025 1435 0.984 2 1.009 0 1.009
linkedubiq 22599 RATG13 G22599C|(surface_glycoprotein:G1037C(R346T)) 86 1.000 76 1.000 1 1.000 2 0.133 3 1.000 6 1.000 3 0.375 3 1.000 6 0.500 1 1.000 3 0.167 22 1.000 5 1.000 25 0.455 177 0.967 13 1.000 8 1.000 2 1.000 7 1.000 1182 0.991 20 1.958 14.629999999999999 16.587999999999997
22622 A22622G|(surface_glycoprotein:A1060G(N354D)) 109 0.807 954 0.986 2 1.7930000000000001 0 1.7930000000000001
22633 A22633C|(surface_glycoprotein:A1071C(R357S)) 115 0.827 1023 0.977 2 1.8039999999999998 0 1.8039999999999998
22661 G22661T|(surface_glycoprotein:G1099T(V367F)) 131 0.873 1227 0.986 2 1.859 0 1.859
ubiq 22813 G22813T|(surface_glycoprotein:G1251T(K417N)) 59 1.000 11 1.000 38 1.000 1 1.000 5 1.000 5 1.000 4 1.000 2 1.000 30 1.000 33 1.000 3 1.000 16 1.000 11 1.000 27 1.000 5 1.000 7 1.000 5 1.000 6 1.000 5 1.000 6 1.000 1 1.000 1 1.000 22 2.0 20.0 22.0
ubiq 22882 T22882G|(surface_glycoprotein:T1320G(N440K)) 41 1.000 10 1.000 53 0.964 1 1.000 1 1.000 7 1.000 3 1.000 4 1.000 7 1.000 33 1.000 37 1.000 9 1.000 11 1.000 10 1.000 34 0.971 3 1.000 17 1.000 6 1.000 5 1.000 7 1.000 7 1.000 1 1.000 2 1.000 23 1.971 20.964 22.935
ubiq 22898 G22898A|(surface_glycoprotein:G1336A(G446S)) 22 1.000 6 1.000 57 1.000 1 1.000 1 1.000 6 0.857 3 1.000 4 1.000 6 1.000 23 1.000 31 1.000 7 1.000 11 0.917 10 1.000 24 0.960 1 1.000 17 1.000 6 1.000 1 1.000 5 1.000 2 1.000 2 1.000 2 1.000 23 1.96 20.774 22.734
ubiq 22910 A22910G|(surface_glycoprotein:A1348G(N450D)) 22 1.000 7 1.000 58 1.000 1 1.000 1 1.000 5 1.000 3 1.000 5 1.000 4 1.000 21 1.000 28 1.000 6 1.000 12 1.000 12 1.000 23 0.958 1 1.000 20 1.000 6 1.000 1 1.000 5 1.000 5 1.000 2 1.000 2 1.000 23 1.958 21.0 22.958
ubiq 22926 T22926C|(surface_glycoprotein:T1364C(L455S)) 9 1.000 9 1.000 49 1.000 1 1.000 3 1.000 2 1.000 4 1.000 3 1.000 14 1.000 33 1.000 3 1.000 8 1.000 9 1.000 22 0.957 1 1.000 21 1.000 3 1.000 2 1.000 7 1.000 5 1.000 3 1.000 1 1.000 22 1.9569999999999999 20.0 21.957
ubiq 22928 T22928C|(surface_glycoprotein:T1366C(F456L)) 9 1.000 9 1.000 49 1.000 1 1.000 2 1.000 4 1.000 3 1.000 9 0.643 32 0.970 3 1.000 8 1.000 7 0.778 22 1.000 3 1.000 2 1.000 7 1.000 5 1.000 3 1.000 1 1.000 19 2.0 16.391000000000002 18.391000000000002
ubiq 22942 T22942A|(surface_glycoprotein:T1380A(N460K)) 9 1.000 8 1.000 59 1.000 1 1.000 1 1.000 2 1.000 5 1.000 5 1.000 16 1.000 34 1.000 3 1.000 10 1.000 9 1.000 19 1.000 2 1.000 21 1.000 5 1.000 3 1.000 9 1.000 5 1.000 4 1.000 1 1.000 22 2.0 20.0 22.0
linkedubiq 22992 G22992A|(surface_glycoprotein:G1430A(S477N)) 34 1.000 108 1.000 38 1.000 47 1.000 39 1.000 113 1.000 91 1.000 38 0.974 66 1.000 50 1.000 118 1.000 60 1.000 23 1.000 15 1.000 53 1.000 152 0.993 80 1.000 71 1.000 162 1.000 199 1.000 17 1.000 21 1.000 15 1.000 184 0.963 23 0.575 7 1.000 62 1.000 105 1.000 28 2.0 25.505 27.505
23039 C23039A|(surface_glycoprotein:C1477A(Q493K)) 1 0.001 1 0.001 335 0.800 3 0.801 0.001 0.802
23054 RATG13 C23054T|(surface_glycoprotein:CAA1492-1494TAC(Q498Y)) 342 0.161 415 0.669 2 0.8300000000000001 0 0.8300000000000001
23056 RATG13 A23056C|(surface_glycoprotein:CAA1492-1494TAC(Q498Y)) 342 0.157 415 0.664 2 0.8210000000000001 0 0.8210000000000001
23060 A23060T|(surface_glycoprotein:A1498T(T500S)) 1 0.001 193 0.088 430 0.670 3 0.758 0.001 0.759
23073 G23073A|(surface_glycoprotein:G1511A(G504D)) 410 0.150 481 0.644 2 0.794 0 0.794
ubiq 23403 Delta A23403G|(surface_glycoprotein:A1841G(D614G)) 1081 0.999 4307 0.998 4083 0.999 3299 0.999 3442 1.000 613 1.000 2163 0.999 374 1.000 3870 0.999 2543 1.000 3113 0.999 10868 0.999 2208 0.999 4785 0.999 7699 0.999 12649 0.999 4697 0.998 5709 0.999 7866 0.998 2330 0.998 2457 1.000 5969 0.999 5577 0.999 1383 1.000 1620 0.999 1477 0.999 1853 1.000 5977 0.999 5295 0.999 29 1.9969999999999999 26.976999999999997 28.973999999999997
ubiq 23525 C23525T|(surface_glycoprotein:C1963T(H655Y)) 910 0.999 4053 0.999 3701 0.998 3025 0.999 3211 0.999 576 1.000 2005 0.999 336 0.997 3377 0.999 2163 0.998 2701 0.999 9973 0.999 1951 0.999 4135 0.999 6686 0.999 11800 0.999 4210 0.997 5225 0.998 6666 0.999 1901 0.996 2342 0.998 5731 0.998 5115 0.998 1292 0.999 1557 0.997 1432 0.999 1938 0.998 5397 0.998 5228 0.998 29 1.9969999999999999 26.956999999999997 28.953999999999997
23610 G23610A|(surface_glycoprotein:G2048A(R683Q)) 27 0.197 63 0.887 2 1.084 0 1.084
24486 G24486A|(surface_glycoprotein:G2924A(S975N)) 1 0.000 1 0.000 2 0.000 1 0.000 1 0.000 1 0.000 149 0.043 1 0.000 227 0.150 9 0.193 0.0 0.193
25020 A25020C|(surface_glycoprotein:A3458C(D1153A)) 1 0.000 2 0.001 1 0.000 106 0.027 1 0.001 1 0.000 2292 0.611 7 0.638 0.002 0.64
25038 A25038G|(surface_glycoprotein:A3476G(H1159R)) 1 0.000 297 0.048 87 0.023 1 0.000 1 0.000 1 0.000 3 0.002 1813 0.573 8 0.596 0.05 0.646
25057 T25057G|(surface_glycoprotein:T3495G(D1165E)) 1 0.001 3 0.001 3 0.002 2 0.001 2 0.000 2 0.001 3 0.002 2 0.000 80 0.024 1 0.001 3 0.001 2 0.001 3 0.001 2 0.001 1 0.000 1568 0.573 16 0.597 0.013000000000000001 0.61
25094 A25094G|(surface_glycoprotein:A3532G(N1178D)) 1 0.000 358 0.088 1 0.001 1 0.000 1 0.001 524 0.414 1 0.000 7 0.502 0.002 0.504
linked 25163 C25163A|(surface_glycoprotein:C3601A(Q1201K)) 2 0.000 8 0.001 5 0.001 1366 0.998 1 0.000 6 0.000 7 0.001 3 0.001 3 0.000 5 0.000 1 0.000 2 0.001 2 0.000 20 0.001 4 0.002 14 0.002 3081 0.198 6 0.001 4 0.001 1 0.000 6 0.001 570 1.000 7 0.000 23 1.198 1.0109999999999992 2.208999999999999
25208 A25208G|(surface_glycoprotein:A3646G(I1216V)) 1 0.000 1 0.000 1 0.000 2676 0.214 1 0.000 1 0.000 491 1.000 1 0.000 8 1.214 0.0 1.214
25254 C25254T|(surface_glycoprotein:C3692T(T1231I)) 2 0.000 1 0.000 3 0.000 1 0.000 1 0.000 1 0.000 1 0.000 4005 0.229 3 0.000 609 1.000 10 1.229 0.0 1.229
ubiq 25584 C25584T|(ORF3a_protein:C192T(T64T)) 70 0.986 928 0.999 256 1.000 180 0.994 344 1.000 189 1.000 580 1.000 213 1.000 55 1.000 85 1.000 36 1.000 305 1.000 158 1.000 2661 0.997 59 1.000 138 1.000 220 0.995 748 0.999 215 1.000 994 1.000 963 1.000 867 0.999 1968 0.998 1768 0.999 190 0.995 249 0.996 26 1.995 23.962 25.957
25991 G25991A|(ORF3a_protein:G599A(C200Y)) 1 0.004 1 0.001 31 0.012 1 0.000 11 1.000 5 1.012 0.005 1.017
26036 A26036C|(ORF3a_protein:A644C(Y215S)) 8 0.001 2 0.001 34 0.003 14 0.002 13 0.002 19 0.003 3 0.001 4 0.001 18 0.002 9 0.001 7 0.002 4 0.001 5 0.001 10 0.002 8 0.001 43 0.003 29 0.004 9 0.003 22 0.003 1659 0.111 20 0.003 6 0.001 5 0.001 8 0.001 4 0.001 12 0.001 5 0.001 15 0.002 1038 1.000 10 0.002 30 1.111 0.050000000000000024 1.161
26054 C26054A|(ORF3a_protein:C662A(T221K)) 1 0.000 1 0.000 1 0.000 1 0.000 2 0.000 2 0.000 2 0.000 2 0.000 6 0.000 4 0.000 1 0.000 1 0.000 1358 0.996 1 0.000 14 0.996 0.0 0.996
26057 A26057G|(ORF3a_protein:A665G(D222G)) 5 0.001 4 0.000 2 0.000 2 0.000 1 0.000 1 0.000 2 0.000 1 0.000 2 0.000 3 0.000 2 0.001 1 0.000 2163 0.115 2 0.000 3 0.001 3 0.000 1 0.000 1 0.000 1362 0.999 19 1.114 0.003 1.117
26066 T26066G|(ORF3a_protein:T674G(V225G)) 1 0.000 1 0.000 1 0.000 1 0.000 1 0.000 1 0.000 1 0.000 3 0.000 4 0.000 3 0.000 3 0.000 1 0.000 2 0.000 1 0.000 1829 1.000 15 1.0 0.0 1.0
26150 C26150T|(ORF3a_protein:C758T(S253F)) 3 0.000 1 0.000 1 0.000 1 0.000 2 0.000 1 0.000 2835 0.118 1 0.000 2018 1.000 9 1.1179999999999999 0.0 1.1179999999999999
26159 TTA26159-26161del|(ORF3a_protein:GTTAAT766-771GATdel(VN256-257Ddel)) 2626 0.114 1946 0.994 2 1.108 0 1.108
26187 T26187G|(ORF3a_protein:T795G(D265E)) 2 0.000 5 0.000 4 0.000 6 0.001 4 0.000 2 0.000 2 0.000 4 0.000 3 0.001 5 0.001 1 0.000 5 0.001 8 0.000 4 0.000 5 0.001 6 0.001 2147 0.102 8 0.001 3 0.000 5 0.000 2 0.000 2 0.000 1 0.000 3 0.000 1876 0.990 2 0.000 26 1.092 0.007 1.099
26216 T26216C|(ORF3a_protein:T824C(L275S)) 1 0.000 2 0.000 1 0.000 1 0.000 2 0.000 2 0.000 1 0.000 3 0.000 1 0.000 1 0.000 2 0.000 2 0.000 1 0.000 2 0.000 2090 0.109 1 0.000 1 0.000 1 0.000 1 0.000 1719 0.999 20 1.108 0.0 1.108
26406 T26406C|(envelope_protein:T162C(P54P)) 1 0.001 1 0.000 2 0.003 1187 0.238 1 0.001 1 0.001 2 0.001 203 0.995 8 1.233 0.007 1.24
26424 T26424G|(envelope_protein:T180G(S60S)) 1 0.000 1 0.000 1227 0.243 1 0.000 203 1.000 5 1.2429999999999999 0.0 1.2429999999999999
26479 T26479C 1 0.001 1 0.001 1 0.001 1 0.001 1 0.000 1330 0.234 1 0.001 1 0.001 1 0.001 186 0.989 10 1.223 0.007 1.23
26509 C26509T 1 0.001 1 0.000 1 0.000 1 0.000 1 0.001 230 1.000 6 1.0 0.002 1.002
26526 GCA26526-26528del|(membrane_glycoprotein:4-6del(A2del)) 1053 0.271 176 1.000 2 1.271 0 1.271
26571 C26571G|(membrane_glycoprotein:C49G(L17V)) 1 0.001 1 0.000 163 1.000 3 1.0 0.001 1.001
26618 T26618C|(membrane_glycoprotein:T96C(I32I)) 1 0.003 45 0.086 43 0.977 3 1.063 0.003 1.0659999999999998
ubiq 26681 C26681T|(membrane_glycoprotein:C159T(F53F)) 1205 0.999 2186 0.998 1870 0.998 2238 1.000 2224 0.999 777 1.000 954 0.996 293 1.000 1516 0.998 2661 0.999 924 1.000 1573 0.999 451 1.000 3343 1.000 2428 1.000 836 1.000 349 1.000 2936 0.999 3437 0.997 2217 1.000 700 1.000 738 0.672 1625 0.999 955 1.000 367 1.000 203 0.953 2009 1.000 27 1.95 24.656000000000002 26.606
ubiq 26709 G26709A|(membrane_glycoprotein:G187A(A63T)) 1387 0.998 2519 1.000 2131 0.997 2517 0.997 2584 0.997 866 0.997 1121 0.994 345 0.997 1700 0.997 3024 0.998 957 0.997 1777 0.998 518 0.996 3761 0.996 2841 0.994 942 0.997 398 0.995 3298 0.996 3923 0.993 2577 0.998 792 0.999 1290 0.998 1796 0.999 1038 0.996 402 0.998 214 0.951 2236 0.995 27 1.944 24.924 26.868
ubiq 26833 C26833T|(membrane_glycoprotein:C311T(A104V)) 1352 1.000 2468 0.999 1206 0.584 2166 0.887 2532 0.999 860 0.998 1158 0.998 274 1.000 1673 0.999 3112 0.999 826 0.998 1702 0.999 484 1.000 3664 0.999 2618 0.998 977 0.999 3324 0.999 3714 0.998 2434 0.999 580 0.681 672 0.521 1750 1.000 1007 0.999 248 0.965 1539 0.686 25 1.963 21.341000000000005 23.304000000000006
ubiq 26858 C26858T|(membrane_glycoprotein:C336T(F112F)) 1326 0.999 2334 0.998 1954 0.997 2340 0.997 2394 0.997 879 0.999 1078 0.997 263 0.992 1655 0.998 2900 0.998 774 0.999 1649 0.997 456 1.000 3468 0.996 2627 0.997 984 0.997 429 0.998 3405 0.998 3774 0.996 2367 0.996 818 0.999 1301 0.997 1765 0.998 1015 0.987 451 1.000 255 0.970 2203 0.999 27 1.966 24.93 26.896
27199 C27199T 1 0.000 1 0.000 1 0.000 1 0.000 254 0.034 2 0.001 1 0.000 662 0.292 8 0.32599999999999996 0.001 0.32699999999999996
27294 C27294T|(ORF6_protein:C93T(Y31Y)) 1 0.000 3 0.000 1 0.000 4 0.001 1 0.000 1275 0.038 2 0.000 1 0.000 1 0.000 2 0.000 2 0.000 1729 0.242 12 0.242 0.039 0.28099999999999997
27303 C27303A|(ORF6_protein:C102A(N34K)) 6 0.000 6 0.000 3 0.000 1 0.000 3 0.000 5 0.000 2 0.000 1 0.000 2 0.000 1 0.005 4 0.000 3 0.000 11 0.000 16 0.000 4 0.000 1174 0.048 6 0.001 3 0.000 2 0.000 1 0.000 6 0.000 1701 0.249 8 0.000 23 0.297 0.006 0.303
27318 T27318G|(ORF6_protein:T117G(N39K)) 4 0.000 5 0.000 2 0.000 4 0.000 1 0.000 1 0.000 4 0.000 4 0.000 3 0.000 2 0.000 2 0.000 7 0.000 17 0.000 6 0.001 1049 0.046 2 0.000 1 0.000 2 0.000 1 0.000 2 0.000 5 0.000 1493 0.242 3 0.000 23 0.288 0.001 0.289
27322 T27322C|(ORF6_protein:T121C(S41P)) 3 0.000 4 0.000 2 0.000 1 0.000 1 0.000 2 0.000 1 0.000 1 0.000 5 0.000 5 0.000 1 0.000 1042 0.049 2 0.000 2 0.000 1 0.000 1 0.000 1565 0.261 2 0.000 18 0.31 0.0 0.31
27353 A27353G|(ORF6_protein:A152G(Q51R)) 1 0.000 1 0.000 1 0.000 1 0.000 1 0.000 1 0.000 2 0.000 3 0.000 6 0.000 846 0.040 2 0.000 1 0.000 2 0.000 1 0.000 1160 0.208 2 0.000 16 0.248 0.0 0.248
ubiq 27807 C27807T|(ORF7b:C52T(L18L)) 6205 0.999 6341 0.998 4907 0.998 7106 0.997 9544 0.998 10904 0.999 12983 0.998 2004 1.000 9006 0.998 6008 0.999 8145 0.998 5533 0.998 11346 0.999 7411 0.999 9119 0.999 18865 0.997 146 1.000 20032 0.997 18422 0.997 12552 0.997 9795 0.998 7496 0.998 52 1.000 4927 0.997 202 1.000 9857 0.998 11691 0.999 6095 0.999 8593 0.999 19593 0.998 30 1.996 27.955000000000002 29.951
28143 T28143C|(ORF8_protein:T250C(L84L)) 2 0.000 6 0.000 1 0.000 3 0.001 6 0.001 1 0.000 8 0.000 2 0.000 4 0.000 1 0.000 2 0.000 3 0.000 2 0.000 4 0.000 5 0.000 2 0.000 5 0.000 6 0.001 2 0.000 2 0.000 1 0.000 2 0.000 1 0.000 4 0.000 2 0.000 4652 0.333 2 0.000 27 0.333 0.003 0.336
linked 28291 C28291T|(nucleocapsid_phosphoprotein:C18T(P6P)) 1 0.000 1 0.000 3 0.000 1 0.000 1 0.000 2 0.000 1 0.000 1 0.000 2 0.000 1573 0.060 2 0.000 1 0.000 3 0.000 3 0.000 3 0.000 1430 0.104 16 0.16399999999999998 0.0 0.16399999999999998
28300 RATG13 G28300A|(nucleocapsid_phosphoprotein:G27A(Q9Q)) 1 0.000 1 0.000 1 0.000 1 0.000 1 0.000 5 0.000 1 0.000 1 0.000 1945 0.080 2 0.000 6 0.000 1 0.000 1669 0.137 1 0.000 14 0.21700000000000003 0.0 0.21700000000000003
28435 C28435A|(nucleocapsid_phosphoprotein:C162A(T54T)) 1 0.000 1 0.000 2 0.000 1 0.000 1 0.000 2 0.000 1054 0.108 2 0.000 1 0.000 1 0.000 1 0.000 1863 0.950 12 1.058 0.0 1.058
28513 A28513C|(nucleocapsid_phosphoprotein:A240C(P80P)) 2 0.000 1 0.000 4 0.000 2 0.000 4 0.001 671 0.122 1 0.001 2 0.001 1 0.000 1 0.001 826 0.943 11 1.065 0.004 1.069
28522 A28522T|(nucleocapsid_phosphoprotein:A249T(Q83H)) 568 0.120 684 0.923 2 1.0430000000000001 0 1.0430000000000001
28693 T28693C|(nucleocapsid_phosphoprotein:T420C(N140N)) 3 0.000 1 0.000 2 0.000 2 0.000 4 0.000 2 0.000 5 0.000 5 0.000 2 0.000 1 0.000 1 0.000 4 0.000 2 0.000 3 0.000 868 0.033 5 0.000 4 0.000 1 0.000 1 0.000 2982 0.284 1 0.000 21 0.31699999999999995 0.0 0.31699999999999995
28791 C28791T|(nucleocapsid_phosphoprotein:C518T(A173V)) 2 0.000 1 0.000 1 0.000 1 0.000 3 0.000 6 0.000 6 0.000 2 0.000 5 0.000 1 0.000 3 0.000 3 0.000 1 0.000 2 0.000 1333 0.057 2 0.000 4 0.000 3 0.000 2 0.000 3305 0.322 20 0.379 0.0 0.379
28906 T28906G|(nucleocapsid_phosphoprotein:T633G(A211A)) 1 0.000 1 0.000 238 0.070 1 0.000 1 0.000 1488 0.621 6 0.6910000000000001 0.0 0.6910000000000001
linked 28916 G28916T|(nucleocapsid_phosphoprotein:G643T(G215C)) 1 0.000 1 0.000 1 0.000 1319 0.221 2 0.000 1 0.000 2770 0.636 1154 0.247 8 0.857 0.247 1.104
29035 T29035G|(nucleocapsid_phosphoprotein:T762G(A254A)) 1 0.000 1 0.001 2 0.001 2 0.000 1 0.000 3 0.000 1 0.000 1 0.000 1 0.000 4 0.001 6 0.001 6 0.001 4 0.001 1146 0.155 2 0.001 4 0.001 3 0.000 6 0.001 2 0.001 3706 0.662 2 0.000 21 0.8170000000000001 0.010000000000000002 0.8270000000000001
29084 A29084G|(nucleocapsid_phosphoprotein:ACA811-813GTA(T271V)) 759 0.144 2106 0.604 2 0.748 0 0.748
29085 C29085T|(nucleocapsid_phosphoprotein:ACA811-813GTA(T271V)) 759 0.143 2106 0.603 2 0.746 0 0.746
29171 C29171A|(nucleocapsid_phosphoprotein:C898A(H300N)) 1 0.000 1 0.001 293 0.118 1384 0.626 4 0.744 0.001 0.745
29700 A29700G 1 0.000 2 0.000 10 0.001 1 0.000 1 0.000 3 0.000 1 0.000 1 0.000 1 0.000 2 0.000 6 0.001 2 0.001 1 0.000 5 0.001 1702 0.271 1 0.000 1 0.000 1 0.000 4671 1.000 7 0.001 20 1.001 0.275 1.2759999999999998
29708 C29708T 1 0.000 1 0.000 2 0.001 3 0.001 1 0.000 1 0.000 713 0.110 1 0.000 6 0.000 1 0.000 2 0.000 3 0.000 2 0.000 3 0.001 1 0.000 3 0.000 3 0.000 4727 0.999 1 0.000 19 0.999 0.113 1.112