NE-1 - Complete Raw Mutation Data

Full TSV data with all sample columns and abundance information
← Back to Dashboard

Complete Mutations Data

This table shows the complete data from the mutations.tsv file exactly as it appears in the source. Scroll horizontally to see all columns.

SRR33682378.cut(123657) SRR33682378(123657) SRR33692036.cut(7764) SRR33692036(7764) SRR33692049.cut(6473) SRR33692049(6473) SRR35013258.cut(130134) SRR35013258(130134) SRR35013260.cut(40606) SRR35013260(40606) SRR35013263.cut(78663) SRR35013263(78663) SRR35013264.cut(527356) SRR35013264(527356) SRR35013269.cut(56034) SRR35013269(56034) SRR35013271.cut(126526) SRR35013271(126526) SRR35013272.cut(30849) SRR35013272(30849) SRR35013273.cut(136593) SRR35013273(136593) SRR35013274.cut(106875) SRR35013274(106875) SRR35013276.cut(67610) SRR35013276(67610) SRR35013277.cut(38368) SRR35013277(38368) SRR35013278.cut(32273) SRR35013278(32273) SRR35013279.cut(8485) SRR35013279(8485)
('2025-04-27', '52000') ('2025-04-27', '52000') ('2025-04-30', '52000') ('2025-04-30', '52000') ('2025-05-07', '52000') ('2025-05-07', '52000') ('2025-07-20', '52000') ('2025-07-20', '52000') ('2025-07-23', '600000') ('2025-07-23', '600000') ('2025-07-30', '100000') ('2025-07-30', '100000') ('2025-07-28', '100000') ('2025-07-28', '100000') ('2025-07-22', '600000') ('2025-07-22', '600000') ('2025-07-29', '200000') ('2025-07-29', '200000') ('2025-07-27', '200000') ('2025-07-27', '200000') ('2025-07-30', '600000') ('2025-07-30', '600000') ('2025-07-28', '600000') ('2025-07-28', '600000') ('2025-07-30', '200000') ('2025-07-30', '200000') ('2025-07-28', '200000') ('2025-07-28', '200000') ('2025-07-23', '100000') ('2025-07-23', '100000') ('2025-07-21', '100000') ('2025-07-21', '100000')
Sequences Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Total samples Positives Sum Negatives Sum Total Sum
21617 ACA21617-21619del|(surface_glycoprotein:55-57del(T19del)) 1416 0.907 1416 0.907 7548 0.953 7548 0.953 3 0.009 3 0.009 6 1.869 0 1.869
21633 T21633C|(surface_glycoprotein:T71C(L24S)) 866 0.844 866 0.844 5979 0.932 5979 0.932 3 0.009 3 0.009 6 1.785 0 1.785
21635 C21635T|(surface_glycoprotein:C73T(P25S)) 879 0.857 879 0.857 6012 0.938 6012 0.938 3 0.009 3 0.009 6 1.8039999999999998 0 1.8039999999999998
21642 C21642A|(surface_glycoprotein:C80A(A27E)) 884 0.862 884 0.862 5946 0.927 5946 0.927 3 0.009 3 0.009 6 1.798 0 1.798
21657 RATG13 T21657C|(surface_glycoprotein:T95C(F32S)) 1 0.000 1 0.000 880 0.858 880 0.858 5961 0.930 5961 0.930 1 0.001 1 0.001 1 0.001 1 0.001 1 0.001 1 0.001 3 0.009 3 0.009 14 1.797 0.003 1.7999999999999998
21707 C21707T|(surface_glycoprotein:C145T(H49Y)) 4 0.001 4 0.001 4 0.001 4 0.001 1801 0.796 1801 0.796 26150 0.942 26150 0.942 1 0.001 1 0.001 1 0.000 1 0.000 3 0.001 3 0.001 3 0.001 3 0.001 1372 0.460 1372 0.460 18 2.198 0.005 2.203
21761 21761-insertA|(surface_glycoprotein:GCT199-201AGCGinsert(A67Sinsert;fs)) 112 0.090 112 0.090 462 0.022 462 0.022 1306 0.487 1306 0.487 6 0.599 0 0.599
21761 GCTATACATGTCTCTGGGACCAATGG21761-21786del|(surface_glycoprotein:GCTATACATGTCTCTGGGACCAATGGTACT199-228TCTdel(AIHVSGTNGT67-76Sdel)) 723 0.596 723 0.596 17665 0.861 17665 0.861 4 1.4569999999999999 0 1.4569999999999999
21763 T21763G|(surface_glycoprotein:GCT199-201AGCGinsert(A67Sinsert;fs)) 112 0.090 112 0.090 462 0.022 462 0.022 1306 0.487 1306 0.487 6 0.599 0 0.599
21764 A21764C|(surface_glycoprotein:ATA202-204CTT(I68L)) 112 0.090 112 0.090 460 0.022 460 0.022 1301 0.485 1301 0.485 6 0.597 0 0.597
21766 A21766T|(surface_glycoprotein:ATA202-204CTT(I68L)) 112 0.092 112 0.092 460 0.022 460 0.022 1301 0.485 1301 0.485 6 0.599 0 0.599
21768 A21768-21768del|(surface_glycoprotein:206-206del(69fs)) 113 0.093 113 0.093 473 0.023 473 0.023 1325 0.494 1325 0.494 6 0.61 0 0.61
21770 G21770A|(surface_glycoprotein:G208A(V70I)) 116 0.096 116 0.096 468 0.023 468 0.023 1329 0.496 1329 0.496 6 0.615 0 0.615
21780 C21780A|(surface_glycoprotein:C218A(T73N)) 3 0.001 3 0.001 2 0.003 2 0.003 1 0.000 1 0.000 1 0.001 1 0.001 100 0.082 100 0.082 444 0.022 444 0.022 1 0.001 1 0.001 5 0.001 5 0.001 1 0.001 1 0.001 2 0.001 2 0.001 2 0.001 2 0.001 1284 0.479 1284 0.479 24 0.583 0.01 0.593
21788 A21788-21788del|(surface_glycoprotein:GCTATACATGTCTCTGGGACCAATGGTACT199-228TCTdel(AIHVSGTNGT67-76Sdel)) 723 0.605 723 0.605 17665 0.863 17665 0.863 4 1.468 0 1.468
21789 RATG13 C21789T|(surface_glycoprotein:C227T(T76I)) 1 0.000 1 0.000 113 0.094 113 0.094 477 0.023 477 0.023 2 0.000 2 0.000 1 0.000 1 0.000 1 0.001 1 0.001 1322 0.512 1322 0.512 14 0.629 0.001 0.63
21793 G21793C|(surface_glycoprotein:G231C(K77N)) 1 0.000 1 0.000 7 0.002 7 0.002 755 0.631 755 0.631 18507 0.899 18507 0.899 4 0.003 4 0.003 2 0.000 2 0.000 5 0.001 5 0.001 2 0.001 2 0.001 1 0.001 1 0.001 3 0.002 3 0.002 1 0.000 1 0.000 22 1.53 0.01 1.54
21811 C21811A|(surface_glycoprotein:C249A(V83V)) 7 0.001 7 0.001 2 0.005 2 0.005 9 0.001 9 0.001 4 0.001 4 0.001 2380 0.757 2380 0.757 30794 0.879 30794 0.879 2 0.001 2 0.001 8 0.001 8 0.001 9 0.001 9 0.001 7 0.001 7 0.001 4 0.001 4 0.001 2 0.001 2 0.001 1696 0.418 1696 0.418 26 2.054 0.014 2.0679999999999996
21823 T21823A|(surface_glycoprotein:T261A(N87K)) 7 0.001 7 0.001 4 0.005 4 0.005 2 0.000 2 0.000 3 0.001 3 0.001 2509 0.844 2509 0.844 32390 0.932 32390 0.932 1 0.000 1 0.000 7 0.001 7 0.001 7 0.001 7 0.001 11 0.001 11 0.001 3 0.001 3 0.001 1352 0.379 1352 0.379 24 2.1550000000000002 0.011 2.1660000000000004
21973 T21973A|(surface_glycoprotein:T411A(N137K)) 2 0.000 2 0.000 2 0.001 2 0.001 1 0.002 1 0.002 87 0.232 87 0.232 42 0.035 42 0.035 1 0.001 1 0.001 1 0.000 1 0.000 3 0.002 3 0.002 1 0.001 1 0.001 7 0.006 7 0.006 4 0.006 4 0.006 22 0.273 0.013000000000000001 0.28600000000000003
21984 TGGGTGTTTATTACCACAAAA21984-22004del|(surface_glycoprotein:TTGGGTGTTTATTACCACAAAAAC421-444TACdel(LGVYYHKN141-148Ydel)) 779 0.498 779 0.498 3224 0.782 3224 0.782 4 1.28 0 1.28
22012 A22012T|(surface_glycoprotein:A450T(K150N)) 3 0.000 3 0.000 4 0.000 4 0.000 2 0.001 2 0.001 850 0.559 850 0.559 3331 0.811 3331 0.811 3 0.001 3 0.001 1 0.000 1 0.000 1 0.001 1 0.001 3 0.000 3 0.000 2 0.000 2 0.000 1 0.000 1 0.000 5 0.002 5 0.002 27 0.009 27 0.009 26 1.379 0.005 1.384
22054 T22054G|(surface_glycoprotein:T492G(N164K)) 1 0.000 1 0.000 13 0.002 13 0.002 4 0.002 4 0.002 775 0.621 775 0.621 2584 0.802 2584 0.802 5 0.002 5 0.002 11 0.003 11 0.003 1 0.001 1 0.001 17 0.002 17 0.002 13 0.002 13 0.002 7 0.002 7 0.002 1 0.000 1 0.000 30 0.012 30 0.012 26 1.435 0.016 1.451
22086 T22086C|(surface_glycoprotein:T524C(F175S)) 1 0.000 1 0.000 51 0.007 51 0.007 11 0.006 11 0.006 732 0.589 732 0.589 2455 0.720 2455 0.720 29 0.010 29 0.010 26 0.006 26 0.006 3 0.002 3 0.002 88 0.012 88 0.012 58 0.008 58 0.008 28 0.008 28 0.008 36 0.015 36 0.015 28 0.011 28 0.011 3 0.007 3 0.007 28 1.327 0.074 1.401
22088 C22088T|(surface_glycoprotein:C526T(L176F)) 1 0.000 1 0.000 2 0.000 2 0.000 739 0.595 739 0.595 2477 0.727 2477 0.727 1 0.000 1 0.000 2 0.000 2 0.000 1 0.000 1 0.000 1 0.000 1 0.000 1 0.000 1 0.000 18 1.322 0.0 1.322
22104 G22104T|(surface_glycoprotein:G542T(G181V)) 6 0.002 6 0.002 1 0.003 1 0.003 760 0.904 760 0.904 2552 0.859 2552 0.859 1 0.002 1 0.002 1 0.000 1 0.000 12 1.763 0.007 1.7699999999999998
linked 22108 A22108C|(surface_glycoprotein:A546C(K182N)) 689 0.183 689 0.183 750 0.895 750 0.895 2546 0.876 2546 0.876 73 0.124 73 0.124 1 0.000 1 0.000 1 0.001 1 0.001 2 0.003 2 0.003 1 0.002 1 0.002 16 1.771 0.313 2.084
22181 C22181T|(surface_glycoprotein:C619T(H207Y)) 7 0.001 7 0.001 1 0.000 1 0.000 1 0.001 1 0.001 2386 0.817 2386 0.817 12976 0.938 12976 0.938 5 0.002 5 0.002 3 0.001 3 0.001 1 0.000 1 0.000 49 0.029 49 0.029 119 0.054 119 0.054 20 1.809 0.034 1.843
22189 TAT22189-22191del|(surface_glycoprotein:CCTATT625-630CCTdel(PI209-210Pdel)) 6 0.001 6 0.001 2 0.001 2 0.001 1 0.001 1 0.001 2230 0.764 2230 0.764 12600 0.911 12600 0.911 2 0.001 2 0.001 4 0.001 4 0.001 1 0.001 1 0.001 4 0.001 4 0.001 4 0.001 4 0.001 20 1.675 0.008 1.683
22199 G22199T|(surface_glycoprotein:GTG637-639TCG(V213S)) 2262 0.789 2262 0.789 12649 0.931 12649 0.931 1 0.001 1 0.001 6 1.721 0 1.721
22200 T22200C|(surface_glycoprotein:GTG637-639TCG(V213S)) 2262 0.789 2262 0.789 12649 0.931 12649 0.931 1 0.001 1 0.001 6 1.721 0 1.721
22202 C22202G|(surface_glycoprotein:C640G(R214G)) 1 0.000 1 0.000 11 0.004 11 0.004 3 0.003 3 0.003 2268 0.791 2268 0.791 12784 0.941 12784 0.941 11 0.008 11 0.008 12 0.004 12 0.004 5 0.007 5 0.007 25 0.006 25 0.006 26 0.007 26 0.007 3 0.002 3 0.002 10 0.007 10 0.007 6 0.003 6 0.003 2 0.018 2 0.018 28 1.753 0.048 1.801
22264 C22264T|(surface_glycoprotein:C702T(N234N)) 4 0.000 4 0.000 4 0.000 4 0.000 2 0.001 2 0.001 963 0.121 963 0.121 69942 0.910 69942 0.910 2 0.000 2 0.000 4 0.000 4 0.000 2 0.001 2 0.001 3 0.000 3 0.000 5 0.001 5 0.001 1 0.000 1 0.000 3 0.001 3 0.001 5 0.001 5 0.001 26 1.032 0.004 1.036
22273 G22273T|(surface_glycoprotein:G711T(R237S)) 7 0.001 7 0.001 1 0.003 1 0.003 7 0.001 7 0.001 5 0.002 5 0.002 450 0.057 450 0.057 511 0.007 511 0.007 3 0.001 3 0.001 2 0.001 2 0.001 14 0.001 14 0.001 8 0.001 8 0.001 10 0.002 10 0.002 1 0.000 1 0.000 1447 0.241 1447 0.241 26 0.305 0.013000000000000001 0.318
22278 A22278G|(surface_glycoprotein:A716G(Q239R)) 3 0.000 3 0.000 31 0.004 31 0.004 11 0.005 11 0.005 4965 0.738 4965 0.738 70577 0.966 70577 0.966 18 0.005 18 0.005 43 0.006 43 0.006 15 0.010 15 0.010 70 0.007 70 0.007 34 0.005 34 0.005 16 0.004 16 0.004 15 0.005 15 0.005 1429 0.289 1429 0.289 5 0.011 5 0.011 28 2.004 0.051000000000000004 2.055
22301 A22301G|(surface_glycoprotein:AGT739-741GAT(S247D)) 369 0.072 369 0.072 419 0.007 419 0.007 1407 0.297 1407 0.297 6 0.376 0 0.376
22302 G22302A|(surface_glycoprotein:AGT739-741GAT(S247D)) 369 0.072 369 0.072 419 0.007 419 0.007 1407 0.297 1407 0.297 6 0.376 0 0.376
22305 A22305C|(surface_glycoprotein:A743C(Y248S)) 2 0.000 2 0.000 5 0.003 5 0.003 2960 0.574 2960 0.574 61431 0.962 61431 0.962 4 0.001 4 0.001 2 0.000 2 0.000 6 0.004 6 0.004 13 0.001 13 0.001 10 0.002 10 0.002 9 0.003 9 0.003 2 0.001 2 0.001 1386 0.292 1386 0.292 24 1.8279999999999998 0.015 1.8429999999999997
22311 C22311A|(surface_glycoprotein:C749A(T250N)) 5 0.000 5 0.000 1 0.001 1 0.001 10 0.001 10 0.001 2 0.001 2 0.001 3773 0.630 3773 0.630 60687 0.950 60687 0.950 1 0.000 1 0.000 4 0.001 4 0.001 7 0.001 7 0.001 3 0.001 3 0.001 1 0.000 1 0.000 1 0.000 1 0.000 2 0.000 2 0.000 26 1.58 0.006 1.586
22313 C22313T|(surface_glycoprotein:C751T(P251S)) 4 0.000 4 0.000 3 0.000 3 0.000 4133 0.691 4133 0.691 60659 0.950 60659 0.950 1 0.000 1 0.000 2 0.000 2 0.000 1 0.001 1 0.001 2 0.000 2 0.000 1 0.000 1 0.000 2 0.001 2 0.001 1 0.000 1 0.000 1367 0.288 1367 0.288 24 1.9289999999999998 0.002 1.9309999999999998
22316 G22316A|(surface_glycoprotein:G754A(G252S)) 2 0.000 2 0.000 1 0.001 1 0.001 4 0.001 4 0.001 3 0.002 3 0.002 3810 0.636 3810 0.636 60876 0.953 60876 0.953 1 0.000 1 0.000 3 0.000 3 0.000 1 0.001 1 0.001 1 0.000 1 0.000 1 0.000 1 0.000 3 0.001 3 0.001 24 1.589 0.006 1.595
22320 A22320-22320del|(surface_glycoprotein:GATTCT757-762GTTCTT(DS253-254VL)) 1731 0.289 1731 0.289 57460 0.901 57460 0.901 4 1.19 0 1.19
22320 A22320-22320del|(surface_glycoprotein:GATTCTTCT757-765GTTCTTdel(DSS253-255VLdel)) 1890 0.315 1890 0.315 204 0.003 204 0.003 4 0.318 0 0.318
22320 ATTCTTCTT22320-22328del|(surface_glycoprotein:GATTCTTCTTCAGGT757-771GCTdel(DSSSG253-257Adel)) 406 0.068 406 0.068 540 0.008 540 0.008 1624 0.354 1624 0.354 6 0.43 0 0.43
22324 22324-insertT|(surface_glycoprotein:GATTCT757-762GTTCTT(DS253-254VL)) 1731 0.289 1731 0.289 57460 0.901 57460 0.901 4 1.19 0 1.19
22325 TC22325-22326del|(surface_glycoprotein:GATTCTTCT757-765GTTCTTdel(DSS253-255VLdel)) 1890 0.315 1890 0.315 204 0.003 204 0.003 4 0.318 0 0.318
22330 AGG22330-22332del|(surface_glycoprotein:GATTCTTCTTCAGGT757-771GCTdel(DSSSG253-257Adel)) 406 0.057 406 0.057 540 0.006 540 0.006 1624 0.309 1624 0.309 6 0.372 0 0.372
22330 AGG22330-22332del|(surface_glycoprotein:TCAGGT766-771TCTdel(SG256-257Sdel)) 1874 0.264 1874 0.264 204 0.002 204 0.002 12 0.002 12 0.002 6 0.268 0 0.268
22332 G22332A|(surface_glycoprotein:G770A(G257D)) 1 0.000 1 0.000 2 0.000 2 0.000 2451 0.345 2451 0.345 78411 0.931 78411 0.931 6 0.001 6 0.001 2 0.001 2 0.001 5 0.000 5 0.000 2 0.000 2 0.000 2 0.001 2 0.001 18 1.276 0.003 1.279
linked 22335 GGACAGCTGGTGCTG22335-22349del|(surface_glycoprotein:TGGACAGCTGGTGCTGCA772-789TCAdel(WTAGAA258-263Sdel)) 1862 0.263 1862 0.263 201 0.002 201 0.002 4 0.265 0 0.265
22347 C22347A|(surface_glycoprotein:C785A(A262D)) 12 0.001 12 0.001 1 0.001 1 0.001 10 0.001 10 0.001 1 0.000 1 0.000 2522 0.348 2522 0.348 79830 0.947 79830 0.947 5 0.001 5 0.001 18 0.002 18 0.002 2 0.001 2 0.001 13 0.001 13 0.001 8 0.001 8 0.001 3 0.001 3 0.001 2 0.001 2 0.001 2 0.000 2 0.000 28 1.295 0.011 1.3059999999999998
22359 A22359T|(surface_glycoprotein:A797T(Y266F)) 4 0.001 4 0.001 2 0.000 2 0.000 4077 0.759 4077 0.759 52239 0.957 52239 0.957 2 0.001 2 0.001 2 0.000 2 0.000 4 0.001 4 0.001 2 0.001 2 0.001 1 0.001 1 0.001 1729 0.442 1729 0.442 20 2.158 0.005 2.163
22458 C22458T|(surface_glycoprotein:C896T(T299I)) 1 0.000 1 0.000 6 0.001 6 0.001 1 0.001 1 0.001 2292 0.526 2292 0.526 23920 0.932 23920 0.932 1 0.001 1 0.001 3 0.001 3 0.001 4 0.001 4 0.001 4 0.001 4 0.001 1 0.001 1 0.001 5 0.003 5 0.003 1 0.002 1 0.002 24 1.463 0.007 1.47
linked 22556 A22556G|(surface_glycoprotein:A994G(I332V)) 3775 0.997 3775 0.997 115 0.983 115 0.983 154 0.994 154 0.994 1747 0.984 1747 0.984 827 0.992 827 0.992 786 0.660 786 0.660 338 0.056 338 0.056 834 0.987 834 0.987 2693 0.984 2693 0.984 97 0.990 97 0.990 2525 0.985 2525 0.985 1729 0.982 1729 0.982 851 0.979 851 0.979 1038 0.981 1038 0.981 32 0.244 32 0.244 15 1.000 15 1.000 32 1.96 11.838 13.797999999999998
22573 T22573C|(surface_glycoprotein:T1011C(P337P)) 10 0.003 10 0.003 2 0.001 2 0.001 1 0.001 1 0.001 1 0.001 1 0.001 5 0.001 5 0.001 4 0.001 4 0.001 2 0.001 2 0.001 2 0.001 2 0.001 2 0.002 2 0.002 15 1.000 15 1.000 20 1.002 0.01 1.012
22577 G22577A|(surface_glycoprotein:GGT1015-1017AAT(G339N)) 5 0.001 5 0.001 1 0.006 1 0.006 3 0.002 3 0.002 1 0.001 1 0.001 350 0.294 350 0.294 5468 0.906 5468 0.906 8 0.003 8 0.003 4 0.002 4 0.002 4 0.002 4 0.002 3 0.003 3 0.003 21 0.160 21 0.160 22 1.36 0.02 1.3800000000000001
linked 22577 G22577C|(surface_glycoprotein:GGT1015-1017CAT(G339H)) 3770 0.996 3770 0.996 117 1.000 117 1.000 153 0.987 153 0.987 1720 0.969 1720 0.969 815 0.977 815 0.977 776 0.652 776 0.652 296 0.049 296 0.049 818 0.968 818 0.968 2659 0.972 2659 0.972 95 0.969 95 0.969 2499 0.975 2499 0.975 1704 0.968 1704 0.968 846 0.974 846 0.974 1020 0.964 1020 0.964 33 0.252 33 0.252 14 0.933 14 0.933 32 1.8860000000000001 11.719 13.605
22578 G22578A|(surface_glycoprotein:GGT1015-1017AAT(G339N)) 5 0.001 5 0.001 1 0.006 1 0.006 3 0.002 3 0.002 1 0.001 1 0.001 350 0.294 350 0.294 5468 0.906 5468 0.906 8 0.003 8 0.003 4 0.002 4 0.002 4 0.002 4 0.002 3 0.003 3 0.003 21 0.160 21 0.160 22 1.36 0.02 1.3800000000000001
linked 22578 G22578A|(surface_glycoprotein:GGT1015-1017CAT(G339H)) 3770 0.996 3770 0.996 117 1.000 117 1.000 153 0.987 153 0.987 1720 0.969 1720 0.969 815 0.977 815 0.977 776 0.652 776 0.652 296 0.049 296 0.049 818 0.968 818 0.968 2659 0.972 2659 0.972 95 0.969 95 0.969 2499 0.975 2499 0.975 1704 0.968 1704 0.968 846 0.974 846 0.974 1020 0.964 1020 0.964 33 0.252 33 0.252 14 0.933 14 0.933 32 1.8860000000000001 11.719 13.605
22593 C22593T|(surface_glycoprotein:C1031T(A344V)) 1 0.000 1 0.000 384 0.322 384 0.322 5633 0.933 5633 0.933 1 0.000 1 0.000 98 0.748 98 0.748 10 2.003 0.0 2.003
22598 A22598G|(surface_glycoprotein:AGA1036-1038GAA(R346E)) 379 0.318 379 0.318 5491 0.910 5491 0.910 2 0.002 2 0.002 94 0.718 94 0.718 8 1.946 0.002 1.948
22599 G22599A|(surface_glycoprotein:AGA1036-1038GAA(R346E)) 379 0.318 379 0.318 5491 0.910 5491 0.910 2 0.002 2 0.002 94 0.718 94 0.718 8 1.946 0.002 1.948
linked 22599 RATG13 G22599C|(surface_glycoprotein:G1037C(R346T)) 3770 0.996 3770 0.996 97 0.829 97 0.829 127 0.819 127 0.819 1610 0.907 1610 0.907 518 0.621 518 0.621 620 0.521 620 0.521 238 0.039 238 0.039 791 0.936 791 0.936 2465 0.901 2465 0.901 90 0.918 90 0.918 2390 0.932 2390 0.932 712 0.404 712 0.404 790 0.909 790 0.909 963 0.910 963 0.910 32 0.244 32 0.244 15 1.000 15 1.000 32 1.804 10.082 11.886000000000001
linked 22629 A22629C|(surface_glycoprotein:A1067C(K356T)) 8010 0.995 8010 0.995 412 0.995 412 0.995 371 0.966 371 0.966 4253 0.934 4253 0.934 1376 0.963 1376 0.963 1711 0.509 1711 0.509 831 0.070 831 0.070 1904 0.947 1904 0.947 5861 0.941 5861 0.941 495 0.930 495 0.930 6548 0.951 6548 0.951 4803 0.959 4803 0.959 2907 0.944 2907 0.944 2111 0.953 2111 0.953 261 0.649 261 0.649 234 0.911 234 0.911 32 2.1390000000000002 11.478 13.617
22632 G22632A|(surface_glycoprotein:G1070A(R357K)) 4 0.000 4 0.000 2 0.000 2 0.000 1531 0.455 1531 0.455 10587 0.890 10587 0.890 6 0.001 6 0.001 1 0.000 1 0.000 1 0.000 1 0.000 120 0.299 120 0.299 16 1.6440000000000001 0.001 1.645
22674 C22674A|(surface_glycoprotein:C1112A(S371Y)) 2 0.000 2 0.000 2 0.001 2 0.001 2 0.002 2 0.002 1445 0.552 1445 0.552 9199 0.913 9199 0.913 7 0.001 7 0.001 2 0.000 2 0.000 4 0.001 4 0.001 6 0.002 6 0.002 5 0.003 5 0.003 95 0.262 95 0.262 22 1.727 0.01 1.737
linked 22674 C22674T|(surface_glycoprotein:C1112T(S371F)) 5351 0.996 5351 0.996 373 0.992 373 0.992 317 1.000 317 1.000 3220 0.983 3220 0.983 787 0.976 787 0.976 1130 0.431 1130 0.431 672 0.067 672 0.067 1750 0.974 1750 0.974 5224 0.982 5224 0.982 492 0.982 492 0.982 5773 0.979 5773 0.979 3634 0.976 3634 0.976 2519 0.974 2519 0.974 1550 0.982 1550 0.982 255 0.704 255 0.704 252 0.984 252 0.984 32 2.186 11.796 13.982
linked 22679 T22679C|(surface_glycoprotein:T1117C(S373P)) 5360 0.997 5360 0.997 375 0.997 375 0.997 315 0.994 315 0.994 3229 0.986 3229 0.986 788 0.978 788 0.978 1122 0.428 1122 0.428 732 0.073 732 0.073 1764 0.982 1764 0.982 5239 0.985 5239 0.985 489 0.976 489 0.976 5787 0.981 5787 0.981 3641 0.977 3641 0.977 2523 0.976 2523 0.976 1555 0.985 1555 0.985 258 0.713 258 0.713 252 0.984 252 0.984 32 2.198 11.814 14.012
linked 22686 C22686T|(surface_glycoprotein:C1124T(S375F)) 5351 0.995 5351 0.995 373 0.992 373 0.992 316 0.997 316 0.997 3239 0.989 3239 0.989 791 0.981 791 0.981 1116 0.426 1116 0.426 678 0.067 678 0.067 1762 0.981 1762 0.981 5238 0.985 5238 0.985 491 0.980 491 0.980 5498 0.932 5498 0.932 3615 0.970 3615 0.970 2528 0.978 2528 0.978 1556 0.986 1556 0.986 257 0.710 257 0.710 252 0.984 252 0.984 32 2.187 11.766 13.953
linked 22688 A22688G|(surface_glycoprotein:A1126G(T376A)) 8726 0.994 8726 0.994 409 0.995 409 0.995 381 0.992 381 0.992 4388 0.978 4388 0.978 1427 0.981 1427 0.981 1933 0.562 1933 0.562 872 0.085 872 0.085 2069 0.976 2069 0.976 5708 0.982 5708 0.982 513 0.970 513 0.970 6941 0.976 6941 0.976 5383 0.970 5383 0.970 3166 0.979 3166 0.979 2239 0.982 2239 0.982 315 0.752 315 0.752 250 0.977 250 0.977 32 2.376 11.775 14.151
22696 G22696T|(surface_glycoprotein:G1134T(K378N)) 6 0.001 6 0.001 3 0.001 3 0.001 1 0.001 1 0.001 1457 0.424 1457 0.424 9255 0.900 9255 0.900 2 0.000 2 0.000 2 0.000 2 0.000 2 0.000 2 0.000 1 0.000 1 0.000 97 0.232 97 0.232 1 0.004 1 0.004 22 1.56 0.003 1.563
22799 G22799A|(surface_glycoprotein:GGG1237-1239AAG(G413K)) 448 0.352 448 0.352 1675 0.863 1675 0.863 4 1.2149999999999999 0 1.2149999999999999
22800 G22800A|(surface_glycoprotein:GGG1237-1239AAG(G413K)) 448 0.352 448 0.352 1675 0.863 1675 0.863 4 1.2149999999999999 0 1.2149999999999999
22812 A22812G|(surface_glycoprotein:A1250G(K417R)) 447 0.991 447 0.991 1716 0.990 1716 0.990 4 1.9809999999999999 0 1.9809999999999999
22893 AGGTTG22893-22898del|(surface_glycoprotein:AAGGTTGGT1330-1338AGTdel(KVG444-446Sdel)) 1335 0.452 1335 0.452 451 0.332 451 0.332 4 0.784 0 0.784
22901 G22901C|(surface_glycoprotein:GGTAATTATAAT1339-1350CGTATGdel(GNYN447-450RMdel)) 1208 0.409 1208 0.409 472 0.348 472 0.348 2 0.005 2 0.005 3 0.006 3 0.006 8 0.7679999999999999 0 0.7679999999999999
22903 TAAT22903-22906del|(surface_glycoprotein:GGTAATTATAAT1339-1350CGTATGdel(GNYN447-450RMdel)) 1208 0.409 1208 0.409 472 0.348 472 0.348 2 0.005 2 0.005 3 0.006 3 0.006 8 0.7679999999999999 0 0.7679999999999999
22910 AA22910-22911del|(surface_glycoprotein:GGTAATTATAAT1339-1350CGTATGdel(GNYN447-450RMdel)) 1208 0.409 1208 0.409 472 0.348 472 0.348 2 0.005 2 0.005 3 0.006 3 0.006 8 0.7679999999999999 0 0.7679999999999999
22912 T22912G|(surface_glycoprotein:GGTAATTATAAT1339-1350CGTATGdel(GNYN447-450RMdel)) 1208 0.409 1208 0.409 472 0.348 472 0.348 2 0.005 2 0.005 3 0.006 3 0.006 8 0.7679999999999999 0 0.7679999999999999
22917 T22917A|(surface_glycoprotein:T1355A(L452Q)) 1365 0.463 1365 0.463 480 0.354 480 0.354 2 0.005 2 0.005 3 0.006 3 0.006 8 0.828 0 0.828
linked 22925 T22925G|(surface_glycoprotein:TTG1363-1365GCG(L455A)) 5 0.001 5 0.001 48 0.012 48 0.012 30 0.010 30 0.010 1391 0.472 1391 0.472 496 0.366 496 0.366 55 0.018 55 0.018 95 0.014 95 0.014 31 0.013 31 0.013 64 0.010 64 0.010 42 0.017 42 0.017 44 0.012 44 0.012 36 0.016 36 0.016 11 0.029 11 0.029 20 0.038 20 0.038 28 0.9049999999999999 0.123 1.028
linked 22926 T22926C|(surface_glycoprotein:TTG1363-1365GCG(L455A)) 5 0.001 5 0.001 48 0.012 48 0.012 30 0.010 30 0.010 1391 0.472 1391 0.472 496 0.366 496 0.366 55 0.018 55 0.018 95 0.014 95 0.014 31 0.013 31 0.013 64 0.010 64 0.010 42 0.017 42 0.017 44 0.012 44 0.012 36 0.016 36 0.016 11 0.029 11 0.029 20 0.038 20 0.038 28 0.9049999999999999 0.123 1.028
22936 G22936T|(surface_glycoprotein:G1374T(K458N)) 1 0.000 1 0.000 1384 0.469 1384 0.469 477 0.352 477 0.352 1 0.000 1 0.000 3 0.008 3 0.008 3 0.006 3 0.006 12 0.835 0.0 0.835
linked 22942 T22942G|(surface_glycoprotein:T1380G(N460K)) 37 0.009 37 0.009 32 0.011 32 0.011 1375 0.466 1375 0.466 452 0.334 452 0.334 25 0.008 25 0.008 71 0.010 71 0.010 29 0.012 29 0.012 62 0.010 62 0.010 30 0.012 30 0.012 30 0.008 30 0.008 22 0.009 22 0.009 4 0.011 4 0.011 12 0.023 12 0.023 26 0.8340000000000001 0.089 0.923
22979 T22979C|(surface_glycoprotein:T1417C(Y473H)) 1 0.000 1 0.000 1 0.000 1 0.000 1 0.000 1 0.000 1330 0.369 1330 0.369 493 0.284 493 0.284 1 0.000 1 0.000 4 0.000 4 0.000 2 0.000 2 0.000 3 0.001 3 0.001 2 0.003 2 0.003 4 0.007 4 0.007 22 0.6629999999999999 0.001 0.6639999999999999
linked 22991 A22991G|(surface_glycoprotein:AGC1429-1431GAC(S477D)) 4 0.001 4 0.001 28 0.006 28 0.006 20 0.005 20 0.005 1369 0.382 1369 0.382 564 0.327 564 0.327 17 0.004 17 0.004 58 0.006 58 0.006 21 0.007 21 0.007 48 0.006 48 0.006 18 0.005 18 0.005 20 0.004 20 0.004 11 0.004 11 0.004 6 0.009 6 0.009 6 0.011 6 0.011 28 0.729 0.048 0.777
linked 22992 G22992A|(surface_glycoprotein:AGC1429-1431GAC(S477D)) 4 0.001 4 0.001 28 0.006 28 0.006 20 0.005 20 0.005 1369 0.382 1369 0.382 564 0.328 564 0.328 17 0.005 17 0.005 58 0.006 58 0.006 21 0.007 21 0.007 48 0.006 48 0.006 18 0.005 18 0.005 20 0.004 20 0.004 11 0.004 11 0.004 6 0.009 6 0.009 6 0.011 6 0.011 28 0.73 0.049 0.779
22997 C22997T|(surface_glycoprotein:CCT1435-1437TTT(P479F)) 1358 0.379 1358 0.379 547 0.318 547 0.318 2 0.003 2 0.003 4 0.007 4 0.007 8 0.707 0 0.707
22998 C22998T|(surface_glycoprotein:CCT1435-1437TTT(P479F)) 1358 0.379 1358 0.379 547 0.318 547 0.318 2 0.003 2 0.003 4 0.007 4 0.007 8 0.707 0 0.707
23004 A23004G|(surface_glycoprotein:A1442G(N481S)) 19 0.008 19 0.008 553 0.437 553 0.437 4 0.445 0 0.445
23006 G23006A|(surface_glycoprotein:G1444A(G482S)) 1318 0.596 1318 0.596 10 0.008 10 0.008 2 0.006 2 0.006 4 0.093 4 0.093 8 0.703 0 0.703
linked 23012 G23012C|(surface_glycoprotein:G1450C(E484Q)) 6 0.003 6 0.003 4 0.002 4 0.002 8 0.009 8 0.009 93 0.117 93 0.117 4 0.002 4 0.002 8 0.002 8 0.002 7 0.003 7 0.003 5 0.002 5 0.002 3 0.002 3 0.002 3 0.003 3 0.003 1 0.025 1 0.025 22 0.151 0.019 0.16999999999999998
linked 23015 G23015-23015del|(surface_glycoprotein:1453-1453del(485fs)) 6 0.007 6 0.007 93 0.117 93 0.117 1 0.025 1 0.025 6 0.14900000000000002 0 0.14900000000000002
linked 23019 T23019C|(surface_glycoprotein:T1457C(F486S)) 1 0.000 1 0.000 7 0.008 7 0.008 95 0.120 95 0.120 4 0.002 4 0.002 3 0.001 3 0.001 2 0.001 2 0.001 1 0.001 1 0.001 1 0.025 1 0.025 16 0.153 0.005 0.158
linked 23022 A23022G|(surface_glycoprotein:A1460G(N487S)) 5 0.006 5 0.006 92 0.116 92 0.116 2 0.001 2 0.001 1 0.001 1 0.001 1 0.025 1 0.025 10 0.14700000000000002 0.002 0.14900000000000002
linked 23027 23027-insertA|(surface_glycoprotein:TAC1465-1467ATCCCAACGCAAGCTCTCinsert(Y489IPTQALinsert)) 4 0.005 4 0.005 93 0.117 93 0.117 1 0.025 1 0.025 6 0.14700000000000002 0 0.14700000000000002
linked 23028 23028-insertCCCAACGCA|(surface_glycoprotein:TAC1465-1467ATCCCAACGCAAGCTCTCinsert(Y489IPTQALinsert)) 4 0.005 4 0.005 93 0.117 93 0.117 1 0.025 1 0.025 6 0.14700000000000002 0 0.14700000000000002
linked 23029 23029-insertGCTCT|(surface_glycoprotein:TAC1465-1467ATCCCAACGCAAGCTCTCinsert(Y489IPTQALinsert)) 4 0.005 4 0.005 93 0.117 93 0.117 1 0.025 1 0.025 6 0.14700000000000002 0 0.14700000000000002
linked 23031 T23031C|(surface_glycoprotein:T1469C(F490S)) 1 0.000 1 0.000 3 0.001 3 0.001 1 0.000 1 0.000 7 0.008 7 0.008 96 0.121 96 0.121 2 0.001 2 0.001 13 0.003 13 0.003 1 0.001 1 0.001 5 0.002 5 0.002 1 0.000 1 0.000 1 0.001 1 0.001 2 0.002 2 0.002 1 0.003 1 0.003 1 0.025 1 0.025 28 0.157 0.011 0.168
linked 23048 G23048A|(surface_glycoprotein:G1486A(G496S)) 2 0.001 2 0.001 1 0.016 1 0.016 2 0.001 2 0.001 8 0.009 8 0.009 96 0.121 96 0.121 1 0.000 1 0.000 1 0.000 1 0.000 1 0.001 1 0.001 1 0.025 1 0.025 18 0.155 0.019 0.174
linked 23054 RATG13 C23054T|(surface_glycoprotein:CAA1492-1494TGT(Q498C)) 7 0.008 7 0.008 97 0.122 97 0.122 1 0.025 1 0.025 6 0.155 0 0.155
linked 23055 A23055G|(surface_glycoprotein:CAA1492-1494TGT(Q498C)) 7 0.008 7 0.008 97 0.122 97 0.122 1 0.025 1 0.025 6 0.155 0 0.155
linked 23056 A23056T|(surface_glycoprotein:CAA1492-1494TGT(Q498C)) 7 0.008 7 0.008 97 0.122 97 0.122 1 0.025 1 0.025 6 0.155 0 0.155
linked 23057 C23057T|(surface_glycoprotein:C1495T(P499S)) 8 0.004 8 0.004 20 0.010 20 0.010 13 0.015 13 0.015 101 0.128 101 0.128 9 0.005 9 0.005 29 0.006 29 0.006 18 0.021 18 0.021 18 0.007 18 0.007 13 0.006 13 0.006 7 0.004 7 0.004 7 0.006 7 0.006 3 0.010 3 0.010 1 0.025 1 0.025 26 0.178 0.069 0.247
linked 23060 ACT23060-23062del|(surface_glycoprotein:1498-1500del(T500del)) 5 0.006 5 0.006 97 0.122 97 0.122 1 0.025 1 0.025 6 0.153 0 0.153
linked 23066 G23066A|(surface_glycoprotein:G1504A(G502S)) 1 0.005 1 0.005 5 0.006 5 0.006 97 0.122 97 0.122 1 0.001 1 0.001 1 0.000 1 0.000 1 0.000 1 0.000 1 0.000 1 0.000 1 0.003 1 0.003 1 0.025 1 0.025 18 0.156 0.006 0.162
23072 G23072A|(surface_glycoprotein:G1510A(G504S)) 2 0.003 2 0.003 1 0.001 1 0.001 3 0.005 3 0.005 95 0.249 95 0.249 1 0.001 1 0.001 1 0.001 1 0.001 4 0.004 4 0.004 1 0.001 1 0.001 1 0.059 1 0.059 18 0.313 0.011 0.324
23076 A23076G|(surface_glycoprotein:A1514G(Y505C)) 14 0.021 14 0.021 316 0.511 316 0.511 1 0.004 1 0.004 1 0.056 1 0.056 8 0.592 0 0.592
23084 T23084C|(surface_glycoprotein:TAC1522-1524CAT(Y508H)) 1687 0.563 1687 0.563 19516 0.953 19516 0.953 170 0.226 170 0.226 17 0.032 17 0.032 8 1.774 0 1.774
23086 RATG13 C23086T|(surface_glycoprotein:TAC1522-1524CAT(Y508H)) 1687 0.563 1687 0.563 19516 0.953 19516 0.953 170 0.226 170 0.226 17 0.032 17 0.032 8 1.774 0 1.774
23119 T23119A|(surface_glycoprotein:T1557A(H519Q)) 1 0.001 1 0.001 1717 0.726 1717 0.726 19618 0.967 19618 0.967 1 0.001 1 0.001 1 0.001 1 0.001 5 0.002 5 0.002 3 0.002 3 0.002 170 0.343 170 0.343 19 0.037 19 0.037 18 2.073 0.007 2.08
23130 C23130A|(surface_glycoprotein:C1568A(T523N)) 1 0.001 1 0.001 1 0.001 1 0.001 1732 0.733 1732 0.733 19793 0.975 19793 0.975 1 0.001 1 0.001 1 0.001 1 0.001 1 0.000 1 0.000 1 0.001 1 0.001 169 0.341 169 0.341 19 0.037 19 0.037 20 2.086 0.005 2.0909999999999997
23149 G23149T|(surface_glycoprotein:G1587T(K529N)) 1 0.001 1 0.001 1734 0.734 1734 0.734 19875 0.979 19875 0.979 2 0.001 2 0.001 178 0.114 178 0.114 171 0.345 171 0.345 19 0.037 19 0.037 14 2.0949999999999998 0.116 2.211
linked 23277 C23277T|(surface_glycoprotein:C1715T(T572I)) 2606 0.507 2606 0.507 170 0.231 170 0.231 3735 0.340 3735 0.340 2745 0.652 2745 0.652 5256 0.422 5256 0.422 39719 0.546 39719 0.546 3916 0.676 3916 0.676 7357 0.717 7357 0.717 4524 0.804 4524 0.804 8520 0.795 8520 0.795 2848 0.355 2848 0.355 3452 0.513 3452 0.513 1915 0.663 1915 0.663 325 0.336 325 0.336 140 0.282 140 0.282 30 1.586 6.253 7.839
23280 C23280T|(surface_glycoprotein:C1718T(T573I)) 2 0.000 2 0.000 3569 0.612 3569 0.612 39138 0.950 39138 0.950 1 0.000 1 0.000 5 0.001 5 0.001 1 0.000 1 0.000 1 0.000 1 0.000 20 0.026 20 0.026 84 0.592 84 0.592 18 2.1799999999999997 0.001 2.1809999999999996
23336 T23336G|(surface_glycoprotein:T1774G(F592V)) 1 0.000 1 0.000 13 0.003 13 0.003 2 0.001 2 0.001 3577 0.729 3577 0.729 39148 0.956 39148 0.956 14 0.004 14 0.004 23 0.003 23 0.003 15 0.004 15 0.004 15 0.002 15 0.002 27 0.005 27 0.005 18 0.004 18 0.004 7 0.004 7 0.004 21 0.030 21 0.030 88 0.533 88 0.533 28 2.2479999999999998 0.03 2.2779999999999996
linkedubiq 23403 Delta A23403G|(surface_glycoprotein:A1841G(D614G)) 6000 0.993 6000 0.993 750 0.988 750 0.988 897 0.982 897 0.982 14194 0.978 14194 0.978 3284 0.980 3284 0.980 4530 0.979 4530 0.979 28923 0.977 28923 0.977 5179 0.977 5179 0.977 11273 0.980 11273 0.980 1332 0.979 1332 0.979 13313 0.980 13313 0.980 6282 0.979 6282 0.979 5767 0.981 5767 0.981 2514 0.980 2514 0.980 1367 0.986 1367 0.986 146 1.000 146 1.000 32 3.942 11.777 15.719
23427 T23427A|(surface_glycoprotein:GTT1864-1866GAC(V622D)) 2005 0.434 2005 0.434 27843 0.944 27843 0.944 16 0.012 16 0.012 2 0.014 2 0.014 8 1.404 0 1.404
23428 T23428C|(surface_glycoprotein:GTT1864-1866GAC(V622D)) 2005 0.434 2005 0.434 27843 0.944 27843 0.944 16 0.012 16 0.012 2 0.014 2 0.014 8 1.404 0 1.404
23429 G23429A|(surface_glycoprotein:G1867A(A623T)) 3 0.000 3 0.000 1 0.001 1 0.001 6 0.000 6 0.000 2 0.001 2 0.001 1986 0.429 1986 0.429 27710 0.939 27710 0.939 1 0.000 1 0.000 2 0.000 2 0.000 4 0.000 4 0.000 1 0.000 1 0.000 7 0.001 7 0.001 18 0.013 18 0.013 2 0.014 2 0.014 26 1.395 0.003 1.398
23487 T23487G|(surface_glycoprotein:T1925G(V642G)) 1 0.000 1 0.000 8 0.003 8 0.003 1 0.001 1 0.001 1265 0.534 1265 0.534 17187 0.914 17187 0.914 2 0.001 2 0.001 9 0.004 9 0.004 5 0.008 5 0.008 9 0.003 9 0.003 7 0.003 7 0.003 2 0.001 2 0.001 2 0.002 2 0.002 5 0.006 5 0.006 1 0.009 1 0.009 28 1.463 0.026000000000000002 1.489
linkedubiq 23525 C23525T|(surface_glycoprotein:C1963T(H655Y)) 2722 0.995 2722 0.995 201 1.000 201 1.000 499 1.000 499 1.000 2849 0.978 2849 0.978 1461 0.974 1461 0.974 2308 0.974 2308 0.974 18401 0.978 18401 0.978 1781 0.981 1781 0.981 2465 0.977 2465 0.977 651 0.982 651 0.982 2880 0.984 2880 0.984 2176 0.981 2176 0.981 1655 0.981 1655 0.981 832 0.971 832 0.971 848 0.983 848 0.983 104 0.963 104 0.963 32 3.8979999999999997 11.804 15.702
23592 A23592T|(surface_glycoprotein:A2030T(Q677L)) 4 0.001 4 0.001 11 0.001 11 0.001 2 0.001 2 0.001 1576 0.539 1576 0.539 10780 0.889 10780 0.889 8 0.002 8 0.002 8 0.001 8 0.001 2 0.001 2 0.001 16 0.002 16 0.002 4 0.001 4 0.001 5 0.001 5 0.001 15 0.017 15 0.017 24 1.445 0.011 1.456
23690 A23690C|(surface_glycoprotein:A2128C(N710H)) 2 0.001 2 0.001 1 0.001 1 0.001 1107 0.586 1107 0.586 10576 0.946 10576 0.946 8 0.003 8 0.003 2 0.004 2 0.004 4 0.002 4 0.002 4 0.002 4 0.002 5 0.005 5 0.005 158 0.246 158 0.246 20 1.778 0.018000000000000002 1.796
23843 A23843G|(surface_glycoprotein:A2281G(T761A)) 3 0.001 3 0.001 1 0.001 1 0.001 577 0.544 577 0.544 9879 0.945 9879 0.945 6 0.003 6 0.003 2 0.008 2 0.008 1 0.001 1 0.001 6 0.004 6 0.004 2 0.002 2 0.002 2 0.006 2 0.006 53 0.055 53 0.055 22 1.544 0.026000000000000002 1.57
23945 A23945G|(surface_glycoprotein:A2383G(K795E)) 8 0.005 8 0.005 8 0.010 8 0.010 903 0.749 903 0.749 11639 0.960 11639 0.960 2 0.004 2 0.004 19 0.008 19 0.008 6 0.016 6 0.016 7 0.004 7 0.004 7 0.008 7 0.008 4 0.006 4 0.006 1 0.003 1 0.003 93 0.383 93 0.383 14 0.583 14 0.583 26 2.675 0.064 2.739
24023 RATG13 C24023T|(surface_glycoprotein:C2461T(L821L)) 1 0.001 1 0.001 70 0.107 70 0.107 3429 0.943 3429 0.943 1 0.001 1 0.001 1 0.001 1 0.001 10 1.05 0.003 1.053
24044 C24044G|(surface_glycoprotein:C2482G(L828V)) 3 0.002 3 0.002 2 0.001 2 0.001 489 0.743 489 0.743 3630 0.966 3630 0.966 1 0.001 1 0.001 2 0.012 2 0.012 12 1.7209999999999999 0.004 1.7249999999999999
24079 T24079G|(surface_glycoprotein:T2517G(D839E)) 1 0.008 1 0.008 8 0.005 8 0.005 1 0.001 1 0.001 710 0.716 710 0.716 8550 0.948 8550 0.948 2 0.004 2 0.004 2 0.001 2 0.001 3 0.002 3 0.002 5 0.004 5 0.004 4 0.004 4 0.004 1 0.003 1 0.003 3 0.011 3 0.011 24 1.6749999999999998 0.032 1.7069999999999999
24090 A24090G|(surface_glycoprotein:A2528G(D843G)) 1 0.000 1 0.000 3 0.002 3 0.002 2 0.003 2 0.003 704 0.710 704 0.710 8423 0.934 8423 0.934 3 0.006 3 0.006 2 0.001 2 0.001 3 0.002 3 0.002 2 0.002 2 0.002 3 0.003 3 0.003 4 0.011 4 0.011 22 1.6440000000000001 0.03 1.6740000000000002
24111 T24111C|(surface_glycoprotein:T2549C(I850T)) 1 0.000 1 0.000 6 0.004 6 0.004 3 0.004 3 0.004 718 0.725 718 0.725 8636 0.958 8636 0.958 1 0.002 1 0.002 14 0.006 14 0.006 2 0.004 2 0.004 15 0.011 15 0.011 6 0.005 6 0.005 3 0.003 3 0.003 6 0.016 6 0.016 24 1.6829999999999998 0.055 1.7379999999999998
24433 A24433C|(surface_glycoprotein:A2871C(Q957H)) 3 0.001 3 0.001 2 0.001 2 0.001 2125 0.551 2125 0.551 20587 0.865 20587 0.865 6 0.002 6 0.002 6 0.002 6 0.002 3 0.003 3 0.003 7 0.001 7 0.001 8 0.001 8 0.001 2 0.001 2 0.001 5 0.003 5 0.003 79 0.045 79 0.045 138 0.204 138 0.204 26 1.665 0.015 1.68
24436 T24436G|(surface_glycoprotein:T2874G(A958A)) 13 0.003 13 0.003 11 0.003 11 0.003 5 0.004 5 0.004 2158 0.587 2158 0.587 20852 0.979 20852 0.979 9 0.003 9 0.003 6 0.002 6 0.002 2 0.002 2 0.002 21 0.004 21 0.004 16 0.003 16 0.003 12 0.004 12 0.004 8 0.006 8 0.006 85 0.050 85 0.050 144 0.215 144 0.215 28 1.831 0.034 1.865
24468 A24468G|(surface_glycoprotein:A2906G(N969S)) 1621 0.463 1621 0.463 19021 0.945 19021 0.945 1 0.000 1 0.000 1 0.001 1 0.001 1 0.002 1 0.002 10 1.411 0.0 1.411
24712 G24712A|(surface_glycoprotein:G3150A(M1050I)) 1 0.000 1 0.000 2 0.000 2 0.000 2768 0.568 2768 0.568 28339 0.857 28339 0.857 2 0.001 2 0.001 4 0.001 4 0.001 4 0.001 4 0.001 4 0.001 4 0.001 1 0.000 1 0.000 2 0.001 2 0.001 27 0.035 27 0.035 22 1.46 0.005 1.4649999999999999
24842 G24842A|(surface_glycoprotein:G3280A(V1094I)) 1 0.003 1 0.003 3 0.001 3 0.001 1 0.002 1 0.002 1910 0.600 1910 0.600 21834 0.946 21834 0.946 3 0.001 3 0.001 1 0.001 1 0.001 3 0.005 3 0.005 16 1.551 0.008 1.559
24964 C24964T|(surface_glycoprotein:C3402T(N1134N)) 3 0.001 3 0.001 2 0.000 2 0.000 297 0.195 297 0.195 16277 0.908 16277 0.908 5 0.001 5 0.001 2 0.000 2 0.000 1 0.000 1 0.000 14 1.103 0.002 1.105
24966 A24966T|(surface_glycoprotein:A3404T(N1135I)) 5 0.001 5 0.001 6 0.001 6 0.001 1 0.001 1 0.001 481 0.316 481 0.316 16565 0.924 16565 0.924 3 0.000 3 0.000 1 0.001 1 0.001 1 0.000 1 0.000 4 0.001 4 0.001 2 0.001 2 0.001 2 0.001 2 0.001 1 0.001 1 0.001 112 0.159 112 0.159 26 1.4000000000000001 0.007 1.407
25011 A25011C|(surface_glycoprotein:A3449C(E1150A)) 12 0.003 12 0.003 6 0.006 6 0.006 222 0.220 222 0.220 13465 0.918 13465 0.918 5 0.004 5 0.004 31 0.006 31 0.006 2 0.004 2 0.004 7 0.002 7 0.002 9 0.004 9 0.004 7 0.004 7 0.004 1 0.001 1 0.001 2 0.003 2 0.003 2 0.004 2 0.004 26 1.145 0.034 1.179
25020 A25020C|(surface_glycoprotein:A3458C(D1153A)) 1 0.005 1 0.005 6 0.002 6 0.002 4 0.004 4 0.004 369 0.366 369 0.366 13729 0.936 13729 0.936 5 0.004 5 0.004 12 0.002 12 0.002 10 0.003 10 0.003 5 0.002 5 0.002 1 0.001 1 0.001 1 0.001 1 0.001 2 0.004 2 0.004 24 1.306 0.024 1.33
25067 A25067T|(surface_glycoprotein:A3505T(I1169F)) 6 0.001 6 0.001 3 0.001 3 0.001 1 0.001 1 0.001 720 0.321 720 0.321 21064 0.886 21064 0.886 6 0.001 6 0.001 4 0.001 4 0.001 3 0.001 3 0.001 1 0.000 1 0.000 2 0.001 2 0.001 20 1.207 0.007 1.214
25169 C25169T|(surface_glycoprotein:C3607T(L1203F)) 1 0.000 1 0.000 1 0.000 1 0.000 550 0.317 550 0.317 7595 0.514 7595 0.514 1 0.000 1 0.000 3 0.001 3 0.001 7 0.037 7 0.037 14 0.868 0.001 0.869
25216 A25216G|(surface_glycoprotein:A3654G(L1218L)) 1 0.006 1 0.006 8 0.004 8 0.004 4 0.010 4 0.010 125 0.246 125 0.246 5123 0.961 5123 0.961 5 0.003 5 0.003 2 0.005 2 0.005 7 0.004 7 0.004 3 0.003 3 0.003 18 1.2069999999999999 0.035 1.2419999999999998
25254 C25254T|(surface_glycoprotein:C3692T(T1231I)) 4 0.001 4 0.001 1 0.002 1 0.002 1 0.000 1 0.000 2 0.001 2 0.001 1012 0.496 1012 0.496 20427 0.938 20427 0.938 1 0.000 1 0.000 2 0.000 2 0.000 2 0.000 2 0.000 1 0.000 1 0.000 106 0.089 106 0.089 192 0.649 192 0.649 24 2.172 0.004 2.176
25276 C25276T|(surface_glycoprotein:C3714T(T1238T)) 1 0.002 1 0.002 3 0.001 3 0.001 966 0.575 966 0.575 18022 0.962 18022 0.962 4 0.003 4 0.003 2 0.000 2 0.000 1 0.000 1 0.000 1 0.000 1 0.000 2 0.001 2 0.001 105 0.092 105 0.092 189 0.654 189 0.654 22 2.283 0.007 2.29
25278 G25278A|(surface_glycoprotein:G3716A(S1239N)) 1 0.000 1 0.000 1 0.000 1 0.000 246 0.146 246 0.146 207 0.011 207 0.011 184 0.637 184 0.637 10 0.794 0.0 0.794
25318 RATG13 C25318T|(surface_glycoprotein:C3756T(S1252S)) 1 0.000 1 0.000 2 0.004 2 0.004 1 0.001 1 0.001 2 0.001 2 0.001 253 0.151 253 0.151 207 0.011 207 0.011 3 0.002 3 0.002 1 0.000 1 0.000 1 0.000 1 0.000 2 0.001 2 0.001 1 0.001 1 0.001 1 0.001 1 0.001 188 0.648 188 0.648 26 0.811 0.01 0.8210000000000001
25360 A25360C|(surface_glycoprotein:A3798C(K1266N)) 40 0.010 40 0.010 7 0.007 7 0.007 531 0.497 531 0.497 13416 0.953 13416 0.953 11 0.008 11 0.008 30 0.007 30 0.007 2 0.008 2 0.008 28 0.008 28 0.008 17 0.006 17 0.006 8 0.004 8 0.004 5 0.005 5 0.005 75 0.066 75 0.066 215 0.782 215 0.782 26 2.298 0.063 2.361
25392 T25392G 1 0.000 1 0.000 441 0.497 441 0.497 11392 0.982 11392 0.982 1 0.000 1 0.000 1 0.001 1 0.001 63 0.070 63 0.070 171 0.784 171 0.784 14 2.333 0.001 2.334
25420 A25420T|(ORF3a_protein:A28T(I10F)) 2 0.001 2 0.001 1 0.007 1 0.007 6 0.004 6 0.004 1 0.003 1 0.003 160 0.413 160 0.413 4818 0.970 4818 0.970 3 0.002 3 0.002 1 0.001 1 0.001 1 0.003 1 0.003 9 0.030 9 0.030 60 0.706 60 0.706 22 2.1189999999999998 0.021 2.1399999999999997