NE-1 - Complete Raw Mutation Data

Full TSV data with all sample columns and abundance information
← Back to Dashboard

Complete Mutations Data

This table shows the complete data from the mutations.tsv file exactly as it appears in the source. Scroll horizontally to see all columns.

SRR32355749(2317723) SRR35903923(9072650) SRR35903932(7212033) SRR35903981(11320501) SRR35953078(5397287) SRR35953111(5057171) SRR36005449(8126442) SRR36005473(6908759) SRR36112043(6739597) SRR36112046(8186042) SRR36668494(5656521)
"('2025-02-05', '240000')" "('2025-10-22', '120000')" "('2025-10-22', '240000')" "('2025-10-20', '120000')" "('2025-10-29', '120000')" "('2025-10-27', '120000')" "('2025-11-05', '120000')" "('2025-11-03', '120000')" "('2025-11-12', '120000')" "('2025-11-12', '240000')" "('2025-12-19', '240000')"
Sequences Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Total samples Positives Sum Negatives Sum Total Sum
84 C84A 25 0.002 7 1.000 176 0.003 43 0.001 22 0.001 20 0.001 6 1.002 0.006 1.008
88 G88A 4 0.001 2 0.000 7 1.000 11 0.000 1 0.000 2 0.000 6 1.001 0.0 1.001
91 RATG13 G91A 3 0.000 7 1.000 5 0.000 1 0.000 3 0.000 5 1.0 0.0 1.0
100 C100A 1 0.000 6 0.000 7 1.000 41 0.001 8 0.000 9 0.000 7 0.000 7 1.0 0.001 1.001
111 T111C 7 0.001 1 0.000 3 0.000 23543 0.999 4 1.0 0.0 1.0
123 C123T 5 0.001 7 1.000 1 0.000 4 0.000 1 0.000 1 0.000 6 1.001 0.0 1.001
168 T168C 5 0.000 1 0.000 8 1.000 4 0.000 1 0.000 5 0.000 10 0.000 7 1.0 0.0 1.0
178 A178G 13 0.000 2 0.000 8 1.000 16 0.000 1 0.000 23606 0.804 17 0.001 7 1.8050000000000000 0.0 1.8050000000000000
190 RATG13 C190T 9 0.000 7 0.875 4135 0.141 3 1.016 0 1.016
192 GC192-193del 40158 0.829 1781 0.060 15 0.000 3 0.889 0 0.889
195 195-insertA 40161 0.829 131 0.004 15 0.000 3 0.833 0 0.833
195 T195C 40128 0.829 1 0.000 6 0.000 4 0.000 133 0.004 18 0.001 6 0.834 0.0 0.834
212 T212C 23076 0.476 2 0.000 6 0.000 6 0.000 227162 0.882 12 0.000 6 1.358 0.0 1.358
222 C222A 5 0.000 28 0.002 193 0.003 40 0.001 87105 0.338 163 0.005 6 0.343 0.006 0.34900000000000000
229 A229G 39 0.001 7 0.000 8 1.000 30 0.000 8 0.000 75 0.000 9 0.000 7 1.001 0.0 1.001
263 A263G 20 0.000 6 0.000 34 0.000 5 0.000 166122 0.649 13 0.000 6 0.649 0.0 0.649
291 A291T|(ORF1ab_polyprotein:A26T(N9I))|(ORF1a_polyprotein:A26T(N9I)) 1 0.000 25 0.002 1 1.000 176 0.002 24 0.001 18 0.001 12 0.000 7 1.001 0.005 1.0060000000000000
316 T316C|(ORF1ab_polyprotein:T51C(S17S))|(ORF1a_polyprotein:T51C(S17S)) 3 0.000 1 1.000 19 0.000 4 0.000 2 0.000 7 0.000 6 1.0 0.0 1.0
344 C344T|(ORF1ab_polyprotein:C79T(L27F))|(ORF1a_polyprotein:C79T(L27F)) 1 0.000 3 0.000 3 0.000 11614 0.502 1 0.000 5 0.502 0.0 0.502
347 G347A|(ORF1ab_polyprotein:G82A(V28I))|(ORF1a_polyprotein:G82A(V28I)) 2 0.000 3 0.000 1 0.000 11573 0.500 1 0.000 5 0.5 0.0 0.5
378 RATG13 T378C|(ORF1ab_polyprotein:T113C(V38A))|(ORF1a_polyprotein:T113C(V38A)) 6 0.001 2 0.000 14 0.000 6 0.000 23078 0.994 11 0.000 6 0.995 0.0 0.995
425 GTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTT425-457del|(ORF1ab_polyprotein:160-192del(VEVEKGVLPQL54-64del))|(ORF1a_polyprotein:160-192del(VEVEKGVLPQL54-64del)) 2272 0.936 1885 0.957 21466 0.987 19 0.184 4 3.064 0 3.064
451 T451G|(ORF1ab_polyprotein:T186G(P62P))|(ORF1a_polyprotein:T186G(P62P)) 30226 0.792 1 0.004 1824 0.068 3 0.8600000000000000 0.004 0.8640000000000000
465 C465A|(ORF1ab_polyprotein:C200A(P67H))|(ORF1a_polyprotein:C200A(P67H)) 1840 0.047 2 0.009 1609 0.817 2 0.008 1419 0.049 19 0.181 6 1.0940000000000000 0.017 1.1110000000000000
474 T474C|(ORF1ab_polyprotein:T209C(F70S))|(ORF1a_polyprotein:T209C(F70S)) 3 0.000 273 0.139 21026 0.725 19 0.181 4 1.045 0 1.045
475 C475A|(ORF1ab_polyprotein:C210A(F70L))|(ORF1a_polyprotein:C210A(F70L)) 20538 0.530 2 0.001 4790 0.165 1 0.010 4 0.7060000000000000 0 0.7060000000000000
479 AAA479-481del|(ORF1ab_polyprotein:214-216del(K72del))|(ORF1a_polyprotein:214-216del(K72del)) 275 0.140 20368 0.703 19 0.181 3 1.024 0 1.024
480 AAC480-482del|(ORF1ab_polyprotein:AAACGT214-219AGTdel(KR72-73Sdel))|(ORF1a_polyprotein:AAACGT214-219AGTdel(KR72-73Sdel)) 1606 0.815 693 0.024 2 0.839 0 0.839
486 C486T|(ORF1ab_polyprotein:C221T(S74L))|(ORF1a_polyprotein:C221T(S74L)) 856 0.022 1880 0.954 21531 0.743 19 0.181 4 1.9 0 1.9
488 G488A|(ORF1ab_polyprotein:G223A(D75N))|(ORF1a_polyprotein:G223A(D75N)) 1878 0.953 21508 0.742 19 0.181 3 1.876 0 1.876
508 TGGTCATGTT508-517del|(ORF1ab_polyprotein:CATGGTCATGTTATGGTT241-258CAAdel(HGHVMV81-86Qdel))|(ORF1a_polyprotein:CATGGTCATGTTATGGTT241-258CAAdel(HGHVMV81-86Qdel)) 250 0.127 15325 0.702 19 0.184 3 1.013 0 1.013
508 TGGTCATGTTATGGT508-522del|(ORF1ab_polyprotein:CATGGTCATGTTATGGTT241-258CATdel(HGHVMV81-86Hdel))|(ORF1a_polyprotein:CATGGTCATGTTATGGTT241-258CATdel(HGHVMV81-86Hdel)) 2213 0.938 1620 0.822 6179 0.283 3 2.043 0 2.043
519 TGGTT519-523del|(ORF1ab_polyprotein:CATGGTCATGTTATGGTT241-258CAAdel(HGHVMV81-86Qdel))|(ORF1a_polyprotein:CATGGTCATGTTATGGTT241-258CAAdel(HGHVMV81-86Qdel)) 250 0.127 15325 0.702 19 0.183 3 1.012 0 1.012
537 A537C|(ORF1ab_polyprotein:A272C(E91A))|(ORF1a_polyprotein:A272C(E91A)) 1886 0.956 1 0.001 20842 0.948 20 0.192 4 2.096 0.001 2.097
560 C560A|(ORF1ab_polyprotein:C295A(R99S))|(ORF1a_polyprotein:C295A(R99S)) 2300 0.975 1857 0.941 2 0.008 20878 0.950 19 0.183 5 3.049 0.008 3.057
593 RATG13 C593T|(ORF1ab_polyprotein:CAT328-330TAC(H110Y))|(ORF1a_polyprotein:CAT328-330TAC(H110Y)) 1681 0.712 1832 0.929 4450 0.203 19 0.184 4 2.028 0 2.028
595 T595C|(ORF1ab_polyprotein:CAT328-330TAC(H110Y))|(ORF1a_polyprotein:CAT328-330TAC(H110Y)) 1681 0.712 1832 0.929 4450 0.203 19 0.184 4 2.028 0 2.028
595 T595C|(ORF1ab_polyprotein:T330C(H110H))|(ORF1a_polyprotein:T330C(H110H)) 593 0.251 23 0.012 8419 0.383 3 0.646 0 0.646
632 C632T|(ORF1ab_polyprotein:C367T(L123F))|(ORF1a_polyprotein:C367T(L123F)) 2219 0.941 770 0.905 14866 0.981 19 0.184 4 3.011 0 3.011
637 T637C|(ORF1ab_polyprotein:T372C(R124R))|(ORF1a_polyprotein:T372C(R124R)) 25 0.011 691 0.812 7929 0.523 18 0.175 4 1.521 0 1.521
649 T649A|(ORF1ab_polyprotein:T384A(N128K))|(ORF1a_polyprotein:T384A(N128K)) 2283 0.968 768 0.896 1 0.011 14519 0.960 19 0.143 5 2.967 0.011 2.978
670 T670A|(ORF1ab_polyprotein:T405A(S135R))|(ORF1a_polyprotein:T405A(S135R)) 1215 0.985 766 0.747 15041 0.990 19 0.078 4 2.8 0 2.8
linked 684 T684C|(ORF1ab_polyprotein:T419C(L140P))|(ORF1a_polyprotein:T419C(L140P)) 685 0.043 39 0.000 973 0.010 18 0.000 79 0.000 13478 0.057 28 0.000 7 0.11 0.0 0.11
linked 897 C897A|(ORF1ab_polyprotein:C632A(A211D))|(ORF1a_polyprotein:C632A(A211D)) 14844 0.997 276519 0.545 97131 0.992 259174 0.993 1 0.250 1 0.500 1155897 0.994 1 1.000 58531 0.265 105933 0.996 10 3.25 4.282 7.532
932 G932T|(ORF1ab_polyprotein:G667T(D223Y))|(ORF1a_polyprotein:G667T(D223Y)) 2 0.000 461 0.001 96931 0.990 189 0.001 777 0.001 95 0.000 51 0.000 7 0.99 0.003 0.993
1168 A1168G|(ORF1ab_polyprotein:A903G(R301R))|(ORF1a_polyprotein:A903G(R301R)) 464 0.397 25 0.000 1 0.000 23 0.000 5 0.000 21634 0.943 6 1.3400000000000000 0.0 1.3400000000000000
1758 C1758T|(ORF1ab_polyprotein:C1493T(A498V))|(ORF1a_polyprotein:C1493T(A498V)) 10592 0.512 7 0.000 102 0.000 9 0.000 21 0.000 13 0.000 6 0.512 0.0 0.512
2060 G2060A|(ORF1ab_polyprotein:G1795A(A599T))|(ORF1a_polyprotein:G1795A(A599T)) 36221 0.726 23 0.000 23 0.000 25 0.000 9 0.000 12 0.000 13 0.000 7 0.726 0.0 0.726
2095 RATG13 G2095A|(ORF1ab_polyprotein:G1830A(S610S))|(ORF1a_polyprotein:G1830A(S610S)) 16 0.000 6 0.000 10 0.000 22 0.000 10 0.000 4164 0.030 40434 0.394 7 0.42400000000000000 0.0 0.42400000000000000
2509 RATG13 C2509T|(ORF1ab_polyprotein:C2244T(P748P))|(ORF1a_polyprotein:C2244T(P748P)) 2 0.000 1 0.000 30 0.000 27562 0.861 8 0.000 5 0.861 0.0 0.861
2586 T2586C|(ORF1ab_polyprotein:T2321C(V774A))|(ORF1a_polyprotein:T2321C(V774A)) 7562 0.423 10 0.000 3 0.000 62 0.000 2 0.000 6 0.000 11 0.000 7 0.423 0.0 0.423
2731 G2731T|(ORF1ab_polyprotein:G2466T(K822N))|(ORF1a_polyprotein:G2466T(K822N)) 1 0.062 271 0.002 19 0.003 1542 0.004 56 0.002 3916 0.342 6 0.40700000000000000 0.008 0.41500000000000000
2756 A2756G|(ORF1ab_polyprotein:A2491G(I831V))|(ORF1a_polyprotein:A2491G(I831V)) 12 0.000 1 0.000 25 0.000 8 0.000 9595 0.858 5 0.858 0.0 0.858
linkedubiq 3037 "RATG13,Delta" C3037T|(ORF1ab_polyprotein:C2772T(F924F))|(ORF1a_polyprotein:C2772T(F924F)) 3827 0.999 1 1.000 22125 0.984 14283 0.979 13062 0.991 27029 0.983 6 3.9570000000000000 1.979 5.936
3096 C3096T|(ORF1ab_polyprotein:C2831T(S944L))|(ORF1a_polyprotein:C2831T(S944L)) 11230 0.870 1 0.000 2 0.87 0 0.87
3156 C3156T|(ORF1ab_polyprotein:C2891T(A964V))|(ORF1a_polyprotein:C2891T(A964V)) 21722 0.996 1 0.000 3 0.000 7 0.000 4 0.996 0.0 0.996
3170 C3170T|(ORF1ab_polyprotein:C2905T(L969F))|(ORF1a_polyprotein:C2905T(L969F)) 11230 0.870 6 0.000 2 0.87 0 0.87
linked 3565 T3565C|(ORF1ab_polyprotein:T3300C(G1100G))|(ORF1a_polyprotein:T3300C(G1100G)) 9848 0.997 40733 0.995 82250 0.997 1 1.000 211526 0.998 29251 0.997 42593 0.711 7 2.703 3.992 6.695
3743 C3743T|(ORF1ab_polyprotein:C3478T(H1160Y))|(ORF1a_polyprotein:C3478T(H1160Y)) 5 0.001 1 0.000 1 0.000 20 0.000 15990 0.990 5 0.000 6 0.991 0.0 0.991
3874 RATG13 C3874T|(ORF1ab_polyprotein:C3609T(I1203I))|(ORF1a_polyprotein:C3609T(I1203I)) 9748 0.660 3 0.000 4 0.000 6 0.000 7 0.000 1 0.000 5 0.000 7 0.66 0.0 0.66
4047 G4047A|(ORF1ab_polyprotein:G3782A(G1261D))|(ORF1a_polyprotein:G3782A(G1261D)) 4171 0.825 4 0.000 8 0.000 2 0.000 5 0.000 5 0.825 0.0 0.825
4067 G4067A|(ORF1ab_polyprotein:G3802A(A1268T))|(ORF1a_polyprotein:G3802A(A1268T)) 3 0.000 42369 0.480 2 0.000 16180 0.793 2 0.000 5 1.2730000000000000 0.0 1.2730000000000000
4160 G4160T|(ORF1ab_polyprotein:G3895T(V1299L))|(ORF1a_polyprotein:G3895T(V1299L)) 3 0.000 38 0.000 62 0.000 92 0.000 9 0.000 33359 0.995 6 0.995 0.0 0.995
4181 G4181A|(ORF1ab_polyprotein:G3916A(A1306T))|(ORF1a_polyprotein:G3916A(A1306T)) 36 0.002 4 0.000 2 0.000 17 0.000 21007 0.652 2 0.000 6 0.654 0.0 0.654
linked 4184 G4184A|(ORF1ab_polyprotein:G3919A(G1307S))|(ORF1a_polyprotein:G3919A(G1307S)) 22333 0.998 1 1.000 100496 0.997 154233 0.996 4 1.000 258073 0.998 11146 0.346 33563 0.998 8 3.3390000000000000 3.9940000000000000 7.333000000000000
4206 C4206T|(ORF1ab_polyprotein:C3941T(A1314V))|(ORF1a_polyprotein:C3941T(A1314V)) 22335 0.998 3 0.000 7 0.000 8 0.000 2 0.000 5 0.998 0.0 0.998
4207 G4207A|(ORF1ab_polyprotein:G3942A(A1314A))|(ORF1a_polyprotein:G3942A(A1314A)) 4 0.000 9 0.000 11 0.000 11151 0.346 2 0.000 5 0.346 0.0 0.346
linked 4214 T4214C|(ORF1ab_polyprotein:T3949C(L1317L))|(ORF1a_polyprotein:T3949C(L1317L)) 5 0.000 100472 0.996 154224 0.996 2 0.500 257833 0.997 11149 0.346 33287 0.990 7 2.332 2.493 4.825000000000000
linked 4321 C4321T|(ORF1ab_polyprotein:C4056T(A1352A))|(ORF1a_polyprotein:C4056T(A1352A)) 22625 0.998 2 1.000 99512 0.990 152526 0.990 3 0.600 253675 0.993 11112 0.345 33422 0.995 8 3.3280000000000000 3.5830000000000000 6.911
4331 C4331T|(ORF1ab_polyprotein:C4066T(L1356L))|(ORF1a_polyprotein:C4066T(L1356L)) 10 0.000 5 0.000 5 0.000 4 0.000 11329 0.352 2 0.000 6 0.352 0.0 0.352
4442 RATG13 G4442A|(ORF1ab_polyprotein:G4177A(V1393M))|(ORF1a_polyprotein:G4177A(V1393M)) 2 0.000 12 0.000 5 0.000 16 0.000 28 0.000 43 0.000 40253 0.350 7 0.000 8 0.35 0.0 0.35
4485 A4485C|(ORF1ab_polyprotein:A4220C(K1407T))|(ORF1a_polyprotein:A4220C(K1407T)) 1 0.000 49 0.000 149 0.001 118 0.000 217 0.000 44670 0.509 6 0.001 7 0.51 0.001 0.511
4508 G4508T|(ORF1ab_polyprotein:G4243T(V1415L))|(ORF1a_polyprotein:G4243T(V1415L)) 48273 0.339 395 0.001 291 0.001 480 0.001 28 0.000 3 0.000 6 0.339 0.003 0.342
4780 C4780T|(ORF1ab_polyprotein:C4515T(I1505I))|(ORF1a_polyprotein:C4515T(I1505I)) 25 0.000 93404 0.330 1 0.000 25 0.000 3 0.000 4 0.000 6 0.33 0.0 0.33
4851 A4851G|(ORF1ab_polyprotein:A4586G(K1529R))|(ORF1a_polyprotein:A4586G(K1529R)) 28918 0.474 77 0.000 56 0.000 307 0.000 169135 0.830 46229 0.237 6 1.541 0.0 1.541
4865 A4865T|(ORF1ab_polyprotein:A4600T(S1534C))|(ORF1a_polyprotein:A4600T(S1534C)) 29538 0.481 88 0.000 47 0.000 354 0.000 169292 0.831 46294 0.238 6 1.5500000000000000 0.0 1.5500000000000000
4991 A4991T|(ORF1ab_polyprotein:A4726T(N1576Y))|(ORF1a_polyprotein:A4726T(N1576Y)) 255 0.001 117 0.001 902 0.001 136309 0.668 73 0.000 5 0.669 0.002 0.671
5028 T5028A|(ORF1ab_polyprotein:T4763A(M1588K))|(ORF1a_polyprotein:T4763A(M1588K)) 29067 0.479 24 0.000 12 0.000 87 0.000 104728 0.513 36 0.000 6 0.992 0.0 0.992
5192 C5192T|(ORF1ab_polyprotein:C4927T(L1643L))|(ORF1a_polyprotein:C4927T(L1643L)) 3 0.001 2 0.000 4 0.000 35950 0.853 2 0.000 5 0.854 0.0 0.854
5212 A5212G|(ORF1ab_polyprotein:A4947G(A1649A))|(ORF1a_polyprotein:A4947G(A1649A)) 10 0.000 25 0.000 36651 0.851 6 0.000 4 0.851 0.0 0.851
5259 C5259T|(ORF1ab_polyprotein:C4994T(T1665I))|(ORF1a_polyprotein:C4994T(T1665I)) 2 0.001 2 0.000 9 0.000 35937 0.852 2 0.000 5 0.853 0.0 0.853
5309 A5309G|(ORF1ab_polyprotein:A5044G(T1682A))|(ORF1a_polyprotein:A5044G(T1682A)) 2 0.000 15 0.000 20617 0.489 4 0.000 4 0.489 0.0 0.489
5395 T5395A|(ORF1ab_polyprotein:T5130A(F1710L))|(ORF1a_polyprotein:T5130A(F1710L)) 11128 0.832 43 0.000 122 0.000 113366 0.799 16302 0.143 5 1.774 0.0 1.774
5497 C5497T|(ORF1ab_polyprotein:C5232T(C1744C))|(ORF1a_polyprotein:C5232T(C1744C)) 2 0.000 2 0.000 11 0.000 66058 0.653 7 0.000 5 0.653 0.0 0.653
5512 RATG13 C5512T|(ORF1ab_polyprotein:C5247T(N1749N))|(ORF1a_polyprotein:C5247T(N1749N)) 7 0.001 45508 0.990 16 0.000 6 0.000 4 0.991 0.0 0.991
5648 RATG13 A5648C|(ORF1ab_polyprotein:A5383C(K1795Q))|(ORF1a_polyprotein:A5383C(K1795Q)) 11147 0.998 19 0.000 58 0.000 79241 0.783 16484 0.177 5 1.958 0.0 1.958
6074 RATG13 T6074C|(ORF1ab_polyprotein:T5809C(F1937L))|(ORF1a_polyprotein:T5809C(F1937L)) 1004 0.907 9 0.000 305 0.003 34 0.000 4 0.91 0 0.91
6104 T6104C|(ORF1ab_polyprotein:T5839C(Y1947H))|(ORF1a_polyprotein:T5839C(Y1947H)) 402 0.362 939 0.006 6614 0.055 29 0.000 4 0.423 0 0.423
6114 C6114T|(ORF1ab_polyprotein:C5849T(P1950L))|(ORF1a_polyprotein:C5849T(P1950L)) 1071 0.966 1087 0.007 6940 0.059 9 0.000 4 1.032 0 1.032
6130 TA6130-6131del|(ORF1ab_polyprotein:5865-5866del(1955fs))|(ORF1a_polyprotein:5865-5866del(1955fs)) 1098 0.990 193 0.001 87 0.001 3 0.992 0 0.992
6138 C6138A|(ORF1ab_polyprotein:C5873A(T1958K))|(ORF1a_polyprotein:C5873A(T1958K)) 602 0.543 1385 0.009 7057 0.060 85 0.000 4 0.612 0 0.612
6138 C6138T|(ORF1ab_polyprotein:C5873T(T1958I))|(ORF1a_polyprotein:C5873T(T1958I)) 405 0.365 15 0.000 182 0.002 19 0.000 4 0.367 0 0.367
6187 C6187A|(ORF1ab_polyprotein:C5922A(H1974Q))|(ORF1a_polyprotein:C5922A(H1974Q)) 775 0.699 1562 0.010 7178 0.061 163 0.001 4 0.7710000000000000 0 0.7710000000000000
6188 T6188C|(ORF1ab_polyprotein:T5923C(Y1975H))|(ORF1a_polyprotein:T5923C(Y1975H)) 784 0.708 1135 0.007 7049 0.060 27 0.000 4 0.7750000000000000 0 0.7750000000000000
linked 6212 G6212T|(ORF1ab_polyprotein:G5947T(A1983S))|(ORF1a_polyprotein:G5947T(A1983S)) 779 0.704 1412 0.009 2 0.400 7348 0.063 87 0.000 5 0.7760000000000000 0.4 1.176
6229 A6229G|(ORF1ab_polyprotein:A5964G(K1988K))|(ORF1a_polyprotein:A5964G(K1988K)) 993 0.912 1130 0.007 5619 0.049 23 0.000 4 0.9680000000000000 0 0.9680000000000000
6286 RATG13 C6286T|(ORF1ab_polyprotein:C6021T(T2007T))|(ORF1a_polyprotein:C6021T(T2007T)) 7 0.000 5 0.000 53732 0.638 3 0.638 0 0.638
6313 A6313T|(ORF1ab_polyprotein:A6048T(T2016T))|(ORF1a_polyprotein:A6048T(T2016T)) 20428 0.496 33 0.000 21 0.000 12 0.000 4 0.496 0 0.496
6450 T6450C|(ORF1ab_polyprotein:T6185C(L2062P))|(ORF1a_polyprotein:T6185C(L2062P)) 15 0.000 28 0.000 15 0.000 34041 0.403 4 0.403 0 0.403
6510 A6510G|(ORF1ab_polyprotein:A6245G(N2082S))|(ORF1a_polyprotein:A6245G(N2082S)) 20426 0.495 10 0.000 72691 0.991 7 0.000 4 1.486 0 1.486
6633 RATG13 C6633T|(ORF1ab_polyprotein:C6368T(A2123V))|(ORF1a_polyprotein:C6368T(A2123V)) 2403 0.995 1 0.000 12815 0.864 3 1.859 0.0 1.859
6648 C6648A|(ORF1ab_polyprotein:C6383A(A2128D))|(ORF1a_polyprotein:C6383A(A2128D)) 2 0.001 78 0.003 7268 0.490 2 0.000 4 0.491 0.003 0.494
6651 C6651T|(ORF1ab_polyprotein:C6386T(A2129V))|(ORF1a_polyprotein:C6386T(A2129V)) 2430 0.998 7279 0.491 2 1.4890000000000000 0 1.4890000000000000
7281 A7281T|(ORF1ab_polyprotein:A7016T(Y2339F))|(ORF1a_polyprotein:A7016T(Y2339F)) 27 0.004 20 0.004 49 0.003 6 0.002 27 0.001 3777 0.324 2 0.000 7 0.328 0.010000000000000000 0.338
7367 A7367G|(ORF1ab_polyprotein:A7102G(I2368V))|(ORF1a_polyprotein:A7102G(I2368V)) 1807 0.996 1 0.000 1 0.000 1 0.000 2 0.000 9936 0.825 6 1.821 0.0 1.821
7480 T7480G|(ORF1ab_polyprotein:T7215G(N2405K))|(ORF1a_polyprotein:T7215G(N2405K)) 1791 0.999 5 0.001 3 0.001 11 0.001 1 0.000 8 0.000 9925 0.847 4 0.001 8 1.8480000000000000 0.002 1.8500000000000000
7764 C7764T|(ORF1ab_polyprotein:C7499T(S2500F))|(ORF1a_polyprotein:C7499T(S2500F)) 1 0.250 406 0.998 2 1.248 0 1.248
7829 G7829T|(ORF1ab_polyprotein:G7564T(V2522F))|(ORF1a_polyprotein:G7564T(V2522F)) 3 0.000 1123 0.001 256 0.001 535 0.001 392 0.002 43673 0.351 31 0.000 7 0.352 0.004 0.356
8039 G8039A|(ORF1ab_polyprotein:G7774A(D2592N))|(ORF1a_polyprotein:G7774A(D2592N)) 36183 0.999 57 0.000 119 0.001 37 0.000 22 0.000 123777 0.995 3 0.000 7 1.995 0.0 1.995
8080 A8080T|(ORF1ab_polyprotein:A7815T(P2605P))|(ORF1a_polyprotein:A7815T(P2605P)) 35963 0.993 1133 0.002 299 0.002 591 0.001 509 0.002 123976 0.997 54 0.001 7 1.9930000000000000 0.005 1.9980000000000000
8090 C8090T|(ORF1ab_polyprotein:C7825T(L2609F))|(ORF1a_polyprotein:C7825T(L2609F)) 16884 0.466 12 0.000 2 0.000 4 0.000 6 0.000 4 0.000 2 0.000 7 0.466 0.0 0.466
8205 A8205G|(ORF1ab_polyprotein:A7940G(E2647G))|(ORF1a_polyprotein:A7940G(E2647G)) 795 0.997 60 0.000 167 0.003 55 0.000 4 1.0 0 1.0
linked 8299 C8299T|(ORF1ab_polyprotein:C8034T(N2678N))|(ORF1a_polyprotein:C8034T(N2678N)) 26 0.000 1 0.250 2 0.200 54000 0.984 59352 0.218 5 1.202 0.45 1.652
8344 C8344T|(ORF1ab_polyprotein:C8079T(D2693D))|(ORF1a_polyprotein:C8079T(D2693D)) 21 0.000 53382 0.993 58939 0.221 3 1.214 0 1.214
linked 8390 A8390G|(ORF1ab_polyprotein:A8125G(I2709V))|(ORF1a_polyprotein:A8125G(I2709V)) 27 0.000 1 0.333 2 0.667 53450 0.994 59063 0.221 5 1.215 1.0 2.215
8471 A8471C|(ORF1ab_polyprotein:A8206C(N2736H))|(ORF1a_polyprotein:A8206C(N2736H)) 5 0.002 1 0.000 2 0.000 17141 0.998 4 1.0 0.0 1.0
8502 C8502T|(ORF1ab_polyprotein:C8237T(T2746I))|(ORF1a_polyprotein:C8237T(T2746I)) 2 0.001 4 0.000 1 0.000 1 0.000 7238 0.419 2 0.000 6 0.42 0.0 0.42
8590 A8590G|(ORF1ab_polyprotein:A8325G(K2775K))|(ORF1a_polyprotein:A8325G(K2775K)) 2639 0.995 4 0.000 5 0.000 12 0.000 4548 0.259 2 0.000 6 1.254 0.0 1.254
8880 C8880T|(ORF1ab_polyprotein:C8615T(T2872M))|(ORF1a_polyprotein:C8615T(T2872M)) 5670 0.996 4 0.000 34814 0.742 4 0.000 4 1.738 0 1.738
8917 C8917T|(ORF1ab_polyprotein:C8652T(F2884F))|(ORF1a_polyprotein:C8652T(F2884F)) 5679 0.998 2 0.000 35402 0.740 3 1.738 0 1.738
9042 C9042T|(ORF1ab_polyprotein:C8777T(S2926F))|(ORF1a_polyprotein:C8777T(S2926F)) 5586 0.997 1 0.000 34923 0.743 1 0.000 4 1.74 0 1.74
9205 T9205C|(ORF1ab_polyprotein:T8940C(D2980D))|(ORF1a_polyprotein:T8940C(D2980D)) 16 0.000 3 0.000 18 0.000 9 1.000 16 0.001 5 1.001 0.0 1.001
9434 G9434T|(ORF1ab_polyprotein:G9169T(V3057L))|(ORF1a_polyprotein:G9169T(V3057L)) 19480 0.799 71 0.002 48820 0.836 48 0.001 4 1.638 0 1.638
9440 T9440A|(ORF1ab_polyprotein:T9175A(C3059S))|(ORF1a_polyprotein:T9175A(C3059S)) 19697 0.798 54 0.002 57875 0.991 47 0.001 4 1.792 0 1.792
9711 C9711T|(ORF1ab_polyprotein:C9446T(S3149F))|(ORF1a_polyprotein:C9446T(S3149F)) 11 0.000 3 0.000 9 0.000 1 0.000 2 0.000 57916 0.629 1 0.000 7 0.629 0.0 0.629
9867 T9867C|(ORF1ab_polyprotein:T9602C(L3201P))|(ORF1a_polyprotein:T9602C(L3201P)) 32 0.000 9 0.000 35 0.000 20 0.000 16 0.000 33942 0.367 7 0.000 7 0.367 0.0 0.367
9996 C9996T|(ORF1ab_polyprotein:C9731T(S3244L))|(ORF1a_polyprotein:C9731T(S3244L)) 3091 0.676 14009 0.906 2 1.582 0 1.582
10138 RATG13 C10138T|(ORF1ab_polyprotein:C9873T(N3291N))|(ORF1a_polyprotein:C9873T(N3291N)) 3122 0.676 14098 0.905 2 1.581 0 1.581
10353 A10353G|(ORF1ab_polyprotein:A10088G(K3363R))|(ORF1a_polyprotein:A10088G(K3363R)) 21989 0.683 51 0.000 19 0.000 40 0.000 55 0.001 63564 0.766 60 0.001 7 1.4500000000000000 0.001 1.451
10474 C10474T|(ORF1ab_polyprotein:C10209T(F3403F))|(ORF1a_polyprotein:C10209T(F3403F)) 8767 0.272 9 0.000 2 0.000 10 0.000 8 0.000 12484 0.151 9 0.000 7 0.42300000000000000 0.0 0.42300000000000000
10747 C10747T|(ORF1ab_polyprotein:C10482T(N3494N))|(ORF1a_polyprotein:C10482T(N3494N)) 1 0.000 10 0.000 82042 0.446 1 0.000 4 0.446 0.0 0.446
11451 A11451G|(ORF1ab_polyprotein:A11186G(Q3729R))|(ORF1a_polyprotein:A11186G(Q3729R)) 1 0.000 49 0.001 3 0.000 62923 0.821 4 0.000 5 0.821 0.001 0.822
11514 C11514T|(ORF1ab_polyprotein:C11249T(T3750I))|(ORF1a_polyprotein:C11249T(T3750I)) 25 0.028 5286 0.970 2 0.998 0 0.998
12439 RATG13 C12439A|(ORF1ab_polyprotein:C12174A(P4058P))|(ORF1a_polyprotein:C12174A(P4058P)) 24 0.002 22 0.001 32389 0.906 8 0.000 4 0.908 0.001 0.909
12789 C12789T|(ORF1ab_polyprotein:C12524T(T4175I))|(ORF1a_polyprotein:C12524T(T4175I)) 4809 0.999 2278 0.154 4379 0.709 3 1.862 0 1.862
12797 G12797A|(ORF1ab_polyprotein:G12532A(G4178S))|(ORF1a_polyprotein:G12532A(G4178S)) 2 0.000 8443 0.616 2 0.616 0 0.616
linked 12815 RATG13 C12815T|(ORF1ab_polyprotein:C12550T(L4184L))|(ORF1a_polyprotein:C12550T(L4184L)) 4767 0.988 1 1.000 2283 0.167 4360 0.990 4 2.145 1.0 3.145
linked 12880 C12880T|(ORF1ab_polyprotein:C12615T(I4205I))|(ORF1a_polyprotein:C12615T(I4205I)) 4818 0.998 3 1.000 2276 0.166 4364 0.992 4 2.1560000000000000 1.0 3.1560000000000000
13264 C13264T|(ORF1ab_polyprotein:C12999T(H4333H))|(ORF1a_polyprotein:C12999T(H4333H)) 2 0.000 26 0.000 3285 0.994 13 0.000 1 0.000 5 0.994 0.0 0.994
13289 T13289C|(ORF1ab_polyprotein:T13024C(F4342L))|(ORF1a_polyprotein:T13024C(F4342L)) 53 0.000 54 0.000 28613 0.651 1 0.000 4 0.651 0.0 0.651
13290 T13290C|(ORF1ab_polyprotein:T13025C(F4342S))|(ORF1a_polyprotein:T13025C(F4342S)) 3495 0.524 70 0.000 1 0.000 69 0.000 2 0.000 3 0.000 6 0.524 0.0 0.524
linked 13339 T13339C|(ORF1ab_polyprotein:T13074C(N4358N))|(ORF1a_polyprotein:T13074C(N4358N)) 3126 0.469 393948 0.983 3141 0.985 1 1.000 214859 0.981 1 1.000 1 1.000 14689 0.341 3131 0.470 9 2.2650000000000000 4.964 7.229
13680 C13680T|(ORF1ab_polyprotein:C13416T(Y4472Y)) 14 0.000 23 0.000 4 0.000 15 0.000 87461 0.425 7 0.000 6 0.425 0.0 0.425
13711 A13711G|(ORF1ab_polyprotein:A13447G(K4483E)) 49266 0.667 76 0.000 9 0.000 34 0.000 18 0.000 16 0.000 6 0.667 0.0 0.667
14126 G14126A|(ORF1ab_polyprotein:G13862A(S4621N)) 13 0.000 30 0.000 20 0.000 11 0.000 4 0.000 103733 0.820 4 0.000 7 0.82 0.0 0.82
linked 14135 C14135A|(ORF1ab_polyprotein:C13871A(P4624H)) 13 0.000 614 0.002 1 0.042 959 0.001 679 0.001 253 0.001 116 0.001 36 0.001 8 0.044000000000000000 0.005 0.049
14150 A14150G|(ORF1ab_polyprotein:A13886G(Y4629C)) 30 0.000 1 0.333 60 0.000 33 0.000 15 0.000 4 0.000 11 0.000 7 0.333 0.0 0.333
14156 C14156A|(ORF1ab_polyprotein:C13892A(S4631*)) 824 0.002 1 0.500 1347 0.002 868 0.001 317 0.001 140 0.001 18 0.000 7 0.501 0.006 0.507
14256 A14256T|(ORF1ab_polyprotein:A13992T(K4664N)) 1 0.000 336 0.001 1 0.333 579 0.001 670 0.001 270 0.001 96 0.001 57 0.001 8 0.335 0.004 0.339
linked 14258 A14258C|(ORF1ab_polyprotein:A13994C(Y4665S)) 15 0.000 1608 0.004 1 0.333 2572 0.004 1 0.167 1871 0.003 660 0.003 313 0.002 293 0.004 9 0.339 0.18100000000000000 0.52
14269 G14269C|(ORF1ab_polyprotein:G14005C(E4669Q)) 262 0.001 1 0.333 488 0.001 491 0.001 177 0.001 58 0.000 35 0.001 7 0.334 0.004 0.338
linked 14276 G14276T|(ORF1ab_polyprotein:G14012T(R4671M)) 3 0.000 1293 0.003 1 0.333 2193 0.003 1 0.143 1549 0.002 580 0.002 242 0.002 58 0.001 9 0.336 0.153 0.489
14290 G14290T|(ORF1ab_polyprotein:G14026T(D4676Y)) 17 0.000 949 0.003 1569 0.002 948 0.001 328 0.001 136 0.001 32677 0.490 7 0.491 0.007 0.498
14290 G14290T|(ORF1ab_polyprotein:GAC14026-14028TAG(D4676*)) 6 0.000 1 0.333 11 0.000 7 0.000 3 0.000 2 0.000 6 0.333 0.0 0.333
14292 C14292G|(ORF1ab_polyprotein:GAC14026-14028TAG(D4676*)) 6 0.000 1 0.333 11 0.000 7 0.000 3 0.000 2 0.000 6 0.333 0.0 0.333
14299 T14299A|(ORF1ab_polyprotein:T14035A(F4679I)) 317 0.001 1 0.333 488 0.001 576 0.001 179 0.001 57 0.000 65 0.001 7 0.334 0.004 0.338
14302 A14302C|(ORF1ab_polyprotein:AAA14038-14040CAC(K4680H)) 3 0.000 37 0.000 1 0.333 55 0.000 47 0.000 21 0.000 5 0.000 4 0.000 8 0.333 0.0 0.333
14304 A14304C|(ORF1ab_polyprotein:AAA14038-14040CAC(K4680H)) 3 0.000 37 0.000 1 0.333 55 0.000 47 0.000 21 0.000 5 0.000 4 0.000 8 0.333 0.0 0.333
14306 A14306C|(ORF1ab_polyprotein:A14042C(Y4681S)) 20 0.001 381 0.001 1 0.333 577 0.001 429 0.001 157 0.001 61 0.000 56 0.001 8 0.335 0.004 0.339
14328 A14328T|(ORF1ab_polyprotein:A14064T(P4688P)) 386 0.001 1 0.333 616 0.001 450 0.001 164 0.001 77 0.001 33 0.001 7 0.335 0.004 0.339
14330 A14330C|(ORF1ab_polyprotein:A14066C(N4689T)) 16 0.000 1006 0.003 1 0.333 1664 0.003 608 0.001 234 0.001 106 0.001 147 0.002 8 0.336 0.008 0.34400000000000000
14343 T14343C|(ORF1ab_polyprotein:T14079C(C4693C)) 4 0.000 45 0.000 92 0.000 78 0.000 229 0.001 104835 0.821 13 0.000 7 0.821 0.001 0.822
14367 T14367G|(ORF1ab_polyprotein:T14103G(H4701Q)) 8 0.000 279 0.001 1 0.333 483 0.001 189 0.000 62 0.000 51 0.000 35 0.001 8 0.334 0.002 0.336
14380 A14380C|(ORF1ab_polyprotein:A14116C(N4706H)) 579 0.002 1 0.333 920 0.001 406 0.001 139 0.001 84 0.001 77 0.001 7 0.335 0.005 0.34
linkedubiq 14408 Delta C14408T|(ORF1ab_polyprotein:C14144T(P4715L)) 37250 0.997 362777 0.997 12238 0.999 653661 0.998 13277 0.999 6362 0.999 657489 0.999 255464 0.999 4540 0.999 142448 0.998 71441 0.998 11 3.992 6.990000000000000 10.982
14694 C14694T|(ORF1ab_polyprotein:C14430T(D4810D)) 4 0.001 1 0.000 13774 0.766 1 0.000 4 0.767 0.0 0.767
14724 C14724T|(ORF1ab_polyprotein:C14460T(F4820F)) 2838 0.595 1 0.000 1 0.000 1 0.000 1 0.000 1 0.000 1 0.000 7 0.595 0.0 0.595
14801 A14801G|(ORF1ab_polyprotein:A14537G(D4846G)) 1 0.000 3 0.000 1 0.000 5 0.000 15 0.000 16908 0.845 3 0.000 7 0.845 0.0 0.845
15007 G15007A|(ORF1ab_polyprotein:G14743A(D4915N)) 1422 0.463 2 0.000 2 0.000 1 0.000 4 0.463 0.0 0.463
15201 A15201G|(ORF1ab_polyprotein:A14937G(V4979V)) 11993 0.349 12 0.000 2 0.000 30 0.001 19 0.000 43 0.000 21 0.000 7 0.349 0.001 0.35
15372 G15372T|(ORF1ab_polyprotein:G15108T(T5036T)) 13110 0.387 44 0.001 5 0.001 71 0.000 1 0.000 1 0.000 22 0.000 56 0.000 12 0.000 9 0.388 0.001 0.389
15480 C15480A|(ORF1ab_polyprotein:C15216A(T5072T)) 1234 0.087 430 0.003 132 0.003 748 0.002 381 0.004 848 0.002 681 0.001 48615 0.818 17 0.001 9 0.9090000000000000 0.012 0.9210000000000000
linked 15540 RATG13 C15540T|(ORF1ab_polyprotein:C15276T(V5092V)) 1235 0.087 4 0.000 2 0.000 9 0.000 1 0.167 10 0.000 20 0.000 15 0.000 49589 0.815 2 0.000 10 0.9020000000000000 0.167 1.069
15737 T15737A|(ORF1ab_polyprotein:T15473A(F5158Y)) 28 0.001 17 0.001 19 0.001 65 0.000 42418 0.866 14 0.000 6 0.867 0.002 0.869
16182 G16182T|(ORF1ab_polyprotein:G15918T(R5306S)) 42 0.001 536 0.002 203 0.002 1133 0.002 497 0.003 1562 0.001 227 0.001 40228 0.487 8 0.491 0.008 0.499
linked 16224 T16224C|(ORF1ab_polyprotein:T15960C(H5320H)) 10 0.000 66 0.000 25 0.000 170 0.000 2 0.500 70 0.000 524 0.000 76391 0.334 82377 0.996 9 1.33 0.5 1.83
16225 A16225G|(ORF1ab_polyprotein:A15961G(T5321A)) 28568 0.494 21 0.000 15 0.000 59 0.000 11 0.000 111 0.000 17 0.000 11 0.000 8 0.494 0.0 0.494
16957 G16957A|(ORF1ab_polyprotein:G16693A(V5565M)) 26447 0.439 1 0.000 4 0.000 2 0.000 2 0.000 143879 0.857 3 0.000 7 1.296 0.0 1.296
17088 T17088A|(ORF1ab_polyprotein:T16824A(P5608P)) 96 0.001 184 0.002 127 0.002 215 0.002 267 0.002 526 0.001 52 0.001 69 0.001 63200 0.419 62 0.001 10 0.422 0.010000000000000000 0.432
17205 A17205G|(ORF1ab_polyprotein:A16941G(K5647K)) 4 0.001 3 0.000 7 0.000 11 0.000 4 0.000 5 0.000 29 0.000 2 0.000 2 0.000 129561 0.861 7 0.000 11 0.862 0.0 0.862
linked 18163 A18163G|(ORF1ab_polyprotein:A17899G(I5967V)) 7234 0.478 42611 0.998 34600 0.997 51898 0.996 50839 0.997 25072 0.996 1 1.000 23543 0.999 10251 0.159 50246 0.999 10 2.633 5.986 8.619
18258 T18258C|(ORF1ab_polyprotein:T17994C(F5998F)) 7 0.000 6730 0.311 8 0.000 92 0.004 1 0.000 5 0.315 0.0 0.315
18395 C18395T|(ORF1ab_polyprotein:C18131T(A6044V)) 4280 0.597 2 0.000 1 0.000 4 0.000 4 0.597 0.0 0.597
18424 A18424G|(ORF1ab_polyprotein:A18160G(N6054D)) 4873 0.679 7 0.000 5 0.000 10 0.000 16381 0.754 1 0.000 6 1.433 0.0 1.433
18555 RATG13 C18555T|(ORF1ab_polyprotein:C18291T(D6097D)) 20295 0.307 19 0.000 17 0.000 6 0.000 7 0.000 9 0.000 6 0.307 0.0 0.307
18747 C18747T|(ORF1ab_polyprotein:C18483T(V6161V)) 24656 0.374 19 0.000 24 0.000 15 0.000 14 0.000 16 0.000 6 0.374 0.0 0.374
linked 18894 C18894T|(ORF1ab_polyprotein:C18630T(C6210C)) 1159 0.460 1 1.000 1 0.500 5 1.000 1 1.000 1 1.000 1 1.000 202636 0.996 3 0.000 3085 0.993 10 2.453 5.496 7.949
19061 T19061G|(ORF1ab_polyprotein:T18797G(V6266G)) 1 1.000 237 0.001 66 0.001 14 0.005 4 1.006 0.001 1.007
19454 C19454T|(ORF1ab_polyprotein:C19190T(T6397M)) 38021 0.375 4 0.000 5 0.000 8 0.000 7 0.000 11 0.000 15 0.000 7 0.375 0.0 0.375
19613 G19613A|(ORF1ab_polyprotein:G19349A(R6450K)) 19 0.000 41 0.000 53 0.000 122 0.000 51 0.000 176311 0.885 15 0.000 7 0.885 0.0 0.885
19706 A19706G|(ORF1ab_polyprotein:A19442G(N6481S)) 1 0.000 13 0.000 10 0.000 32 0.000 10 0.000 149824 0.769 15 0.000 7 0.769 0.0 0.769
19824 G19824A|(ORF1ab_polyprotein:G19560A(E6520E)) 1 0.000 8376 0.993 3 0.000 16486 0.167 1 0.000 5 1.16 0.0 1.16
20302 G20302A|(ORF1ab_polyprotein:G20038A(E6680K)) 1997 0.477 4 0.000 31222 0.994 3 1.471 0.0 1.471
20407 RATG13 T20407C|(ORF1ab_polyprotein:T20143C(F6715L)) 1384 0.242 1600 0.184 35 0.000 31656 0.983 1 0.000 5 1.409 0.0 1.409
20745 T20745C|(ORF1ab_polyprotein:T20481C(N6827N)) 17712 0.594 36 0.000 10 0.000 158644 0.998 15 0.000 5 1.592 0.0 1.592
20990 20990-insertGCA|(ORF1ab_polyprotein:TTG20725-20727TGCATGinsert(L6909CM)) 3 0.750 1 0.000 2 0.75 0 0.75
21137 A21137G|(ORF1ab_polyprotein:A20873G(K6958R)) 10 0.000 310 0.001 36 0.000 101904 0.811 43 0.000 5 0.812 0.0 0.812
21268 G21268-21268del|(ORF1ab_polyprotein:21004-21004del(7002fs)) 1 0.000 34798 0.330 2 0.33 0 0.33
21327 C21327T|(ORF1ab_polyprotein:C21063T(V7021V)) 18119 0.546 35 0.000 8 0.000 4 0.000 18 0.000 5 0.546 0.0 0.546
21604 G21604T|(surface_glycoprotein:G42T(Q14H)) 5680 0.830 9 0.000 2 0.83 0 0.83
21617 ACA21617-21619del|(surface_glycoprotein:55-57del(T19del)) 14096 0.668 61736 0.887 108259 0.998 1 0.000 4 2.553 0 2.553
21633 T21633C|(surface_glycoprotein:T71C(L24S)) 20416 0.943 62716 0.888 109680 0.998 1 0.000 4 2.829 0 2.829
21635 C21635T|(surface_glycoprotein:C73T(P25S)) 14798 0.684 62695 0.888 109656 0.998 3 2.5700000000000000 0 2.5700000000000000
21642 C21642A|(surface_glycoprotein:C80A(A27E)) 20297 0.938 62787 0.887 109734 0.999 3 2.824 0 2.824
21657 RATG13 T21657C|(surface_glycoprotein:T95C(F32S)) 20398 0.945 62640 0.885 109611 0.998 3 0.000 4 2.828 0 2.828
21707 C21707T|(surface_glycoprotein:C145T(H49Y)) 15150 0.997 62648 0.884 108656 0.997 3 2.878 0 2.878
21761 G21761T|(surface_glycoprotein:G199T(A67S)) 15135 0.995 1150 0.016 242 0.002 1 0.000 4 1.013 0 1.013
21761 GCTATACATGTCTCTGGGACCAATGG21761-21786del|(surface_glycoprotein:GCTATACATGTCTCTGGGACCAATGGTACT199-228TCTdel(AIHVSGTNGT67-76Sdel)) 62258 0.851 28501 0.255 2 1.1060000000000000 0 1.1060000000000000
linked 21765 TACATG21765-21770del|(surface_glycoprotein:ATACATGTC202-210ATCdel(IHV68-70Idel)) 15161 0.997 8034 0.110 9 0.900 8 0.000 2943 0.972 5 2.079 0.9 2.979
21768 A21768-21768del|(surface_glycoprotein:206-206del(69fs)) 2 0.000 80917 0.724 2 0.724 0 0.724
21780 C21780A|(surface_glycoprotein:C218A(T73N)) 15088 0.992 22 0.000 82842 0.736 1 0.000 4 1.728 0 1.728
21782 A21782T|(surface_glycoprotein:A220T(N74Y)) 10 0.000 46326 0.412 3 0.001 3 0.413 0 0.413
21788 A21788-21788del|(surface_glycoprotein:GCTATACATGTCTCTGGGACCAATGGTACT199-228TCTdel(AIHVSGTNGT67-76Sdel)) 62258 0.850 28501 0.253 2 1.103 0 1.103
21789 RATG13 C21789T|(surface_glycoprotein:C227T(T76I)) 15150 0.996 1 0.000 82842 0.735 3 1.7310000000000000 0 1.7310000000000000
21793 G21793C|(surface_glycoprotein:G231C(K77N)) 15185 0.998 63787 0.868 28796 0.255 3 2.121 0 2.121
21811 C21811A|(surface_glycoprotein:C249A(V83V)) 15140 0.995 65000 0.886 108658 0.996 1 0.000 4 2.8770000000000000 0 2.8770000000000000
21823 T21823A|(surface_glycoprotein:T261A(N87K)) 15186 0.998 64317 0.877 108311 0.993 3 0.001 4 2.8690000000000000 0 2.8690000000000000
21973 T21973A|(surface_glycoprotein:T411A(N137K)) 90 0.001 333 0.001 264 0.002 324 0.001 72932 0.693 57 0.000 6 0.694 0.004 0.698
21992 T21992C|(surface_glycoprotein:T430C(Y144H)) 57710 0.700 1 0.000 1 0.000 1 0.000 1 0.000 13 0.000 1 0.000 7 0.7 0.0 0.7
21995 T21995C|(surface_glycoprotein:T433C(Y145H)) 57425 0.695 18 0.000 41 0.000 30 0.000 60 0.000 72537 0.689 40 0.000 7 1.384 0.0 1.384
22012 A22012T|(surface_glycoprotein:A450T(K150N)) 58981 0.701 61 0.001 197 0.001 193 0.001 189 0.000 83637 0.795 15023 0.095 7 1.592 0.002 1.594
linked 22054 T22054G|(surface_glycoprotein:T492G(N164K)) 67 0.001 55 0.001 164 0.001 1 0.111 130 0.001 173 0.000 86050 0.797 15322 0.095 8 0.894 0.113 1.0070000000000000
22079 C22079A|(surface_glycoprotein:C517A(Q173K)) 59102 0.702 215 0.003 698 0.003 610 0.004 639 0.001 74193 0.687 60 0.000 7 1.392 0.008 1.4
22088 C22088T|(surface_glycoprotein:C526T(L176F)) 52522 0.624 12 0.000 11 0.000 4 0.000 14 0.000 11848 0.111 15169 0.094 7 0.829 0.0 0.829
22088 C22088T|(surface_glycoprotein:CTT526-528TCT(L176S)) 12 0.000 72344 0.679 2 0.679 0 0.679
22089 T22089C|(surface_glycoprotein:CTT526-528TCT(L176S)) 12 0.000 72344 0.679 2 0.679 0 0.679
22094 G22094A|(surface_glycoprotein:G532A(D178N)) 39067 0.464 5 0.000 12 0.000 14 0.000 15 0.000 42429 0.400 21 0.000 7 0.8640000000000000 0.0 0.8640000000000000
linked 22101 A22101C|(surface_glycoprotein:A539C(E180A)) 38 0.000 52 0.001 155 0.001 1 0.111 233 0.001 262 0.001 72997 0.688 140 0.001 8 0.69 0.114 0.8040000000000000
22104 G22104T|(surface_glycoprotein:G542T(G181V)) 59078 0.702 115 0.002 355 0.001 284 0.002 262 0.001 84945 0.801 15256 0.096 7 1.601 0.004 1.605
22108 A22108C|(surface_glycoprotein:A546C(K182N)) 58886 0.700 7 0.000 84514 0.798 14978 0.095 4 1.593 0 1.593
22115 A22115C|(surface_glycoprotein:A553C(N185H)) 38 0.000 16 0.000 41 0.000 48 0.000 68 0.000 73128 0.691 32 0.000 7 0.691 0.0 0.691
22119 T22119A|(surface_glycoprotein:T557A(F186Y)) 39081 0.465 61 0.001 227 0.001 233 0.001 207 0.000 129 0.001 139 0.001 7 0.468 0.002 0.47000000000000000
linked 22122 A22122C|(surface_glycoprotein:A560C(K187T)) 39116 0.465 98 0.001 316 0.001 1 0.111 373 0.002 397 0.001 112 0.001 199 0.001 8 0.468 0.115 0.5830000000000000
22181 C22181T|(surface_glycoprotein:C619T(H207Y)) 57694 0.700 6 0.000 10 0.000 4 0.000 12 0.000 84812 0.802 14933 0.094 7 1.596 0.0 1.596
22193 A22193G|(surface_glycoprotein:A631G(N211D)) 29 0.000 1 0.000 1 0.000 73424 0.657 4 0.000 5 0.657 0.0 0.657
22199 G22199T|(surface_glycoprotein:G637T(V213L)) 57633 0.661 8 0.000 3 0.000 2 0.000 9 0.000 1 0.000 85061 0.761 2 0.000 8 1.4220000000000000 0.0 1.4220000000000000
22206 A22206G|(surface_glycoprotein:A644G(D215G)) 57678 0.661 38 0.000 26 0.000 11 0.000 24 0.000 28 0.000 16 0.000 34 0.000 8 0.661 0.0 0.661
22206 A22206G|(surface_glycoprotein:GAT643-645GGG(D215G)) 10 0.000 73396 0.657 2 0.657 0 0.657
22207 T22207G|(surface_glycoprotein:GAT643-645GGG(D215G)) 10 0.000 73396 0.657 2 0.657 0 0.657
22566 T22566C|(surface_glycoprotein:T1004C(L335S)) 1 0.000 10 0.000 1 0.000 17 0.000 5 0.000 11548 0.600 6 0.6 0.0 0.6
22578 G22578A|(surface_glycoprotein:G1016A(G339D)) 2800 0.686 42 0.000 1 0.000 43 0.000 14 0.000 3868 0.201 893 0.102 7 0.9890000000000000 0.0 0.9890000000000000
22582 A22582C|(surface_glycoprotein:A1020C(E340D)) 2 0.000 146 0.001 8 0.001 82 0.000 51 0.000 5175 0.269 891 0.102 7 0.372 0.001 0.373
22593 C22593T|(surface_glycoprotein:C1031T(A344V)) 2793 0.685 7 0.000 4 0.000 1 0.000 12392 0.644 5 1.3290000000000000 0.0 1.3290000000000000
22598 A22598G|(surface_glycoprotein:AGA1036-1038GAA(R346E)) 2805 0.686 1 0.000 17490 0.908 881 0.101 4 1.6950000000000000 0.0 1.6950000000000000
22599 G22599A|(surface_glycoprotein:AGA1036-1038GAA(R346E)) 2805 0.685 1 0.000 17490 0.908 881 0.101 4 1.6940000000000000 0.0 1.6940000000000000
22632 G22632A|(surface_glycoprotein:G1070A(R357K)) 717 0.174 7 0.000 7 0.000 7 0.000 17591 0.914 885 0.101 6 1.189 0.0 1.189
22672 T22672A|(surface_glycoprotein:T1110A(N370K)) 2129 0.516 234 0.001 7 0.001 212 0.001 83 0.001 25 0.001 4 0.000 7 0.518 0.003 0.521
22674 C22674A|(surface_glycoprotein:C1112A(S371Y)) 708 0.172 195 0.001 11 0.001 175 0.001 61 0.001 17787 0.904 908 0.102 7 1.1790000000000000 0.003 1.1820000000000000
22696 G22696T|(surface_glycoprotein:G1134T(K378N)) 2 0.000 164 0.001 13 0.001 151 0.001 46 0.000 17478 0.909 890 0.101 7 1.011 0.002 1.013
22712 C22712T|(surface_glycoprotein:C1150T(P384S)) 2836 0.688 6 0.000 15 0.000 9 0.000 19136 0.996 1850 0.211 6 1.895 0.0 1.895
linkedubiq 22770 G22770A|(surface_glycoprotein:G1208A(R403K)) 4054 0.999 195967 0.994 11356 0.993 206778 0.994 4 1.000 1 1.000 111666 0.997 19146 0.997 8701 0.997 9 3.986 4.985 8.971
22799 G22799A|(surface_glycoprotein:GGG1237-1239AAG(G413K)) 11423 0.898 18237 0.813 915 0.044 3 1.755 0 1.755
22800 G22800A|(surface_glycoprotein:GGG1237-1239AAG(G413K)) 11423 0.898 18237 0.813 915 0.044 3 1.755 0 1.755
22812 A22812C|(surface_glycoprotein:A1250C(K417T)) 11415 0.897 1 0.000 2 0.897 0 0.897
22812 A22812G|(surface_glycoprotein:A1250G(K417R)) 18247 0.813 918 0.044 2 0.857 0 0.857
22893 AGGTTG22893-22898del|(surface_glycoprotein:AAGGTTGGT1330-1338AGTdel(KVG444-446Sdel)) 7771 0.885 4 0.001 19 0.002 3 0.888 0 0.888
22901 G22901C|(surface_glycoprotein:GGTAATTAT1339-1347CGTdel(GNY447-449Rdel)) 7824 0.891 6 0.002 19 0.002 3 0.895 0 0.895
22903 TAATTA22903-22908del|(surface_glycoprotein:GGTAATTAT1339-1347CGTdel(GNY447-449Rdel)) 7824 0.891 6 0.002 19 0.002 3 0.895 0 0.895
22917 T22917A|(surface_glycoprotein:T1355A(L452Q)) 8774 0.998 734 0.220 19 0.002 3 1.22 0 1.22
22925 T22925G|(surface_glycoprotein:TTG1363-1365GCG(L455A)) 8764 0.997 8 0.001 1 0.000 725 0.216 25 0.002 5 1.216 0.0 1.216
22926 T22926C|(surface_glycoprotein:TTG1363-1365GCG(L455A)) 8764 0.997 8 0.001 1 0.000 725 0.216 25 0.002 5 1.216 0.0 1.216
22936 G22936T|(surface_glycoprotein:G1374T(K458N)) 8772 0.998 12 0.001 1 0.001 1 0.000 584 0.174 24 0.002 6 1.175 0.001 1.176
22942 T22942G|(surface_glycoprotein:T1380G(N460K)) 8751 0.995 729 0.217 25 0.002 3 1.214 0 1.214
22979 T22979C|(surface_glycoprotein:T1417C(Y473H)) 8704 0.990 2 0.000 724 0.218 20 0.002 4 1.21 0 1.21
22991 A22991G|(surface_glycoprotein:AGC1429-1431GAC(S477D)) 7820 0.891 3 0.000 2 0.001 724 0.218 22 0.002 5 1.111 0.001 1.1120000000000000
22992 G22992A|(surface_glycoprotein:AGC1429-1431GAC(S477D)) 7820 0.891 3 0.000 2 0.001 724 0.218 22 0.002 5 1.111 0.001 1.1120000000000000
22997 C22997T|(surface_glycoprotein:CCT1435-1437TTT(P479F)) 7756 0.884 143 0.043 2 0.927 0 0.927
22998 C22998T|(surface_glycoprotein:CCT1435-1437TTT(P479F)) 7756 0.884 143 0.043 2 0.927 0 0.927
23006 G23006A|(surface_glycoprotein:G1444A(G482S)) 7762 0.887 576 0.173 19 0.002 3 1.062 0 1.062
23010 T23010G|(surface_glycoprotein:T1448G(V483G)) 7743 0.887 3 0.000 1 0.000 3 0.887 0 0.887
23015 G23015A|(surface_glycoprotein:G1453A(G485S)) 7740 0.887 16 0.001 1 0.001 1 0.000 2 0.001 10 0.001 6 0.89 0.001 0.891
23019 T23019C|(surface_glycoprotein:T1457C(F486S)) 7739 0.887 1 0.000 724 0.218 20 0.002 4 1.107 0 1.107
23027 23027-insertA|(surface_glycoprotein:TAC1465-1467ATCCCAACGCAAGCTCTCinsert(Y489IPTQALinsert)) 7613 0.881 151 0.046 2 0.927 0 0.927
23028 23028-insertCCCAACGCA|(surface_glycoprotein:TAC1465-1467ATCCCAACGCAAGCTCTCinsert(Y489IPTQALinsert)) 7613 0.881 151 0.046 2 0.927 0 0.927
23029 23029-insertGCTCT|(surface_glycoprotein:TAC1465-1467ATCCCAACGCAAGCTCTCinsert(Y489IPTQALinsert)) 7613 0.881 151 0.046 2 0.927 0 0.927
23031 T23031C|(surface_glycoprotein:T1469C(F490S)) 8567 0.992 3 0.000 714 0.216 8 0.001 4 1.209 0 1.209
23048 G23048A|(surface_glycoprotein:G1486A(G496S)) 8584 0.994 567 0.171 2 1.165 0 1.165
23054 RATG13 C23054T|(surface_glycoprotein:CAA1492-1494TGT(Q498C)) 8565 0.991 151 0.046 19 0.002 3 1.039 0 1.039
23055 A23055G|(surface_glycoprotein:CAA1492-1494TGT(Q498C)) 8565 0.991 151 0.046 19 0.002 3 1.039 0 1.039
23056 A23056T|(surface_glycoprotein:CAA1492-1494TGT(Q498C)) 8565 0.991 151 0.046 19 0.002 3 1.039 0 1.039
23076 A23076G|(surface_glycoprotein:A1514G(Y505C)) 8510 0.985 714 0.216 19 0.002 3 1.203 0 1.203
23084 T23084C|(surface_glycoprotein:TAC1522-1524CAT(Y508H)) 8614 0.997 715 0.216 19 0.002 3 1.215 0 1.215
23086 RATG13 C23086T|(surface_glycoprotein:TAC1522-1524CAT(Y508H)) 8614 0.997 715 0.216 19 0.002 3 1.215 0 1.215
23185 C23185T|(surface_glycoprotein:C1623T(F541F)) 26302 0.656 4 0.000 8 0.000 5 0.000 4 0.000 3 0.000 6 0.656 0.0 0.656
linked 23222 G23222A|(surface_glycoprotein:G1660A(E554K)) 38929 0.959 8 1.000 225218 0.992 434619 0.993 5 0.833 2 1.000 235571 0.995 1 1.000 159218 0.995 21662 0.752 165321 0.997 11 3.7 6.816 10.516
linked 23271 C23271T|(surface_glycoprotein:C1709T(A570V)) 40404 0.837 61154 0.995 247716 0.990 444990 0.990 12 0.923 2 1.000 239710 0.992 254305 0.997 206197 0.995 32195 0.406 173638 0.963 11 3.1960000000000000 6.892 10.088000000000000
linked 23277 C23277T|(surface_glycoprotein:C1715T(T572I)) 7712 0.160 10 0.000 247527 0.989 444217 0.989 11 0.846 2 1.000 239448 0.990 254581 0.997 205899 0.993 78774 0.993 155933 0.864 11 3.0060000000000000 5.815 8.821000000000000
23280 C23280T|(surface_glycoprotein:C1718T(T573I)) 2747 0.057 9 0.000 15 0.000 3 0.000 4 0.000 7 0.000 46710 0.589 5359 0.030 8 0.676 0.0 0.676
23336 T23336G|(surface_glycoprotein:T1774G(F592V)) 7737 0.160 881 0.014 230 0.001 50 0.000 35 0.000 2387 0.009 436 0.002 46582 0.593 5463 0.031 9 0.785 0.025 0.81
linkedubiq 23403 Delta A23403G|(surface_glycoprotein:A1841G(D614G)) 47856 0.998 60982 0.991 243219 0.996 436468 0.996 7 1.000 2 1.000 236365 0.998 253868 0.995 203676 0.998 78525 0.996 176958 0.998 11 3.9880000000000000 6.978000000000000 10.966000000000000
linked 23423 C23423T|(surface_glycoprotein:C1861T(P621S)) 40013 0.834 111590 0.996 256737 0.998 437223 0.998 8 1.000 2 1.000 236584 0.999 469191 0.996 241581 0.998 36715 0.332 176305 0.947 11 3.111 6.987000000000000 10.098000000000000
23427 T23427A|(surface_glycoprotein:GTT1864-1866GAC(V622D)) 7825 0.163 5 0.000 73261 0.662 9690 0.052 4 0.8770000000000000 0.0 0.8770000000000000
23428 T23428C|(surface_glycoprotein:GTT1864-1866GAC(V622D)) 7825 0.163 5 0.000 73261 0.662 9690 0.052 4 0.8770000000000000 0.0 0.8770000000000000
23429 G23429A|(surface_glycoprotein:G1867A(A623T)) 7844 0.164 11 0.000 19 0.000 20 0.000 14 0.000 11 0.000 9 0.000 73391 0.663 9691 0.052 9 0.8790000000000000 0.0 0.8790000000000000
23487 T23487G|(surface_glycoprotein:T1925G(V642G)) 6346 0.805 14 0.000 6 0.000 37 0.000 9 0.000 39560 0.785 5422 0.475 7 2.065 0.0 2.065
linkedubiq 23525 C23525T|(surface_glycoprotein:C1963T(H655Y)) 7772 0.998 61360 0.998 17305 0.998 2 1.000 255787 0.999 44473 0.998 50002 0.992 11385 0.997 8 3.9850000000000000 3.995 7.98
23534 A23534G|(surface_glycoprotein:A1972G(N658D)) 7 0.000 2 0.000 20 0.000 1 0.000 25615 0.508 5 0.508 0.0 0.508
23592 A23592T|(surface_glycoprotein:A2030T(Q677L)) 6139 0.810 36 0.001 23 0.001 109 0.000 21 0.000 37818 0.793 5244 0.473 7 2.077 0.001 2.078
linked 23690 A23690C|(surface_glycoprotein:A2128C(N710H)) 16663 0.450 1 0.200 151897 0.724 43 0.000 60 0.000 101949 0.824 25 0.000 7 1.998 0.2 2.198
23781 T23781G|(surface_glycoprotein:T2219G(M740R)) 11 0.000 78 0.000 92 0.000 343 0.001 102653 0.818 67 0.001 6 0.819 0.001 0.82
linked 23843 A23843G|(surface_glycoprotein:A2281G(T761A)) 16452 0.448 1 0.200 150295 0.719 38 0.000 66 0.000 100682 0.821 12 0.000 7 1.988 0.2 2.188
23945 A23945G|(surface_glycoprotein:A2383G(K795E)) 20525 0.385 22 0.000 44 0.000 57812 0.724 4 1.109 0.0 1.109
24044 C24044G|(surface_glycoprotein:C2482G(L828V)) 30589 0.563 109 0.001 122 0.001 58120 0.713 4 1.277 0.001 1.2780000000000000
24079 T24079G|(surface_glycoprotein:T2517G(D839E)) 30702 0.565 289 0.004 1084 0.005 58375 0.722 4 1.291 0.005 1.2960000000000000
24090 A24090G|(surface_glycoprotein:A2528G(D843G)) 30284 0.562 3 0.000 16 0.000 58239 0.720 4 1.282 0.0 1.282
24111 T24111C|(surface_glycoprotein:T2549C(I850T)) 30167 0.564 20 0.000 79 0.000 58120 0.718 4 1.282 0.0 1.282
24433 A24433C|(surface_glycoprotein:A2871C(Q957H)) 615 0.476 2 0.002 2474 0.518 13 0.002 3 0.001 1573 0.719 5 0.002 7 1.7150000000000000 0.005 1.7200000000000000
24436 T24436G|(surface_glycoprotein:T2874G(A958A)) 612 0.473 2470 0.517 1572 0.718 3 1.7080000000000000 0 1.7080000000000000
24703 T24703C|(surface_glycoprotein:T3141C(Y1047Y)) 5 0.000 4 0.000 23 0.000 39 0.000 16 0.000 25003 0.454 6 0.454 0.0 0.454
24712 G24712A|(surface_glycoprotein:G3150A(M1050I)) 22345 0.703 4 0.000 7 0.000 17 0.000 54246 0.547 12 0.000 6 1.25 0.0 1.25
24796 T24796A|(surface_glycoprotein:T3234A(A1078A)) 750 0.001 143135 0.703 1424 0.001 181 0.001 249 0.001 47 0.000 143 0.001 26 0.000 21 0.000 9 0.703 0.005 0.708
24812 G24812A|(surface_glycoprotein:G3250A(D1084N)) 24 0.000 5 0.000 8 0.000 16 0.000 7 0.000 17023 0.717 1 0.000 7 0.717 0.0 0.717
24872 G24872T|(surface_glycoprotein:G3310T(V1104L)) 3703 0.495 569 0.001 83 0.001 1597 0.001 224 0.001 278 0.001 131 0.000 6 0.000 10 0.000 9 0.496 0.004 0.5
24964 C24964T|(surface_glycoprotein:C3402T(N1134N)) 36 0.000 7 0.000 68 0.000 5 0.000 15 0.000 12 0.000 24568 0.994 1 0.000 8 0.994 0.0 0.994
24966 A24966T|(surface_glycoprotein:A3404T(N1135I)) 3806 0.500 566 0.001 74 0.001 1708 0.001 213 0.001 263 0.001 122 0.000 24558 0.993 19 0.000 9 1.494 0.004 1.498
linked 24990 C24990T|(surface_glycoprotein:C3428T(P1143L)) 3751 0.493 799846 0.991 98550 0.991 1 1.000 1303619 0.988 161102 0.988 474325 0.993 1 1.000 284283 0.995 1 0.000 40082 0.994 11 2.4780000000000000 6.955 9.433
25000 C25000A|(surface_glycoprotein:C3438A(D1146E)) 3818 0.502 151 0.000 13 0.000 272 0.000 34 0.000 81 0.000 49 0.000 5 0.000 5 0.000 9 0.502 0.0 0.502
linked 25000 RATG13 C25000T|(surface_glycoprotein:C3438T(D1146D)) 3766 0.495 797417 0.988 98205 0.988 1 1.000 1302226 0.987 160768 0.986 473659 0.991 1 1.000 283951 0.994 2 0.000 39928 0.990 11 2.473 6.946 9.419
25020 A25020C|(surface_glycoprotein:A3458C(D1153A)) 3755 0.499 283 0.000 40 0.000 1080 0.001 137 0.001 116 0.000 83 0.000 6732 0.278 17 0.000 9 0.777 0.002 0.779
25067 A25067T|(surface_glycoprotein:A3505T(I1169F)) 583 0.001 82 0.001 1420 0.001 167 0.001 198 0.000 96 0.000 24152 0.997 25 0.001 8 0.999 0.003 1.002
25168 A25168C|(surface_glycoprotein:A3606C(E1202D)) 1 0.000 7 0.000 6 0.001 1 0.333 4 0.334 0.0 0.334
25169 C25169T|(surface_glycoprotein:C3607T(L1203F)) 3302 0.797 5393 0.611 2 1.408 0 1.408
linked 25207 C25207T|(surface_glycoprotein:C3645T(Y1215Y)) 849 0.199 3629 0.986 1 1.000 51296 0.992 3368 0.381 3 1.000 6 2.566 1.992 4.558
25216 A25216G|(surface_glycoprotein:A3654G(L1218L)) 3390 0.795 1 0.000 7 0.000 5388 0.610 4 1.405 0.0 1.405
25223 A25223G|(surface_glycoprotein:A3661G(I1221V)) 5 0.001 1 0.000 7 0.000 3 1.000 4 1.001 0.0 1.001
25254 C25254T|(surface_glycoprotein:C3692T(T1231I)) 3392 0.795 3 0.001 7 0.000 5690 0.607 4 1.403 0.0 1.403
25273 G25273T|(surface_glycoprotein:G3711T(M1237I)) 1 0.000 17 0.004 136 0.002 27 0.003 1 0.333 5 0.34 0.002 0.342
25276 C25276T|(surface_glycoprotein:C3714T(T1238T)) 3379 0.792 1 0.000 9 0.000 5382 0.608 4 1.4 0.0 1.4
25305 G25305T|(surface_glycoprotein:G3743T(C1248F)) 101 0.027 554 0.011 107 0.012 1 0.333 4 0.37200000000000000 0.011 0.38300000000000000
25310 T25310A|(surface_glycoprotein:T3748A(C1250S)) 3 0.001 3 0.000 1 0.000 1 0.333 4 0.334 0.0 0.334
25352 G25352T|(surface_glycoprotein:G3790T(V1264L)) 3328 0.798 3 0.001 40 0.001 1969 0.223 4 1.022 0.001 1.023
25360 A25360C|(surface_glycoprotein:A3798C(K1266N)) 3323 0.797 4 0.001 25 0.000 5426 0.614 4 1.412 0.0 1.412
25392 T25392G 3328 0.794 1 0.015 2 0.001 1 0.010 33 0.001 5432 0.616 1 0.014 7 1.425 0.026000000000000000 1.451
25420 A25420T|(ORF3a_protein:A28T(I10F)) 4224 0.083 33 0.000 8 0.000 28 0.000 29 0.000 6 0.000 13 0.000 8 0.000 29213 0.704 17 0.000 10 0.7870000000000000 0.0 0.7870000000000000
25546 RATG13 C25546T|(ORF3a_protein:C154T(L52F)) 4275 0.085 8 0.000 6 0.000 4 0.000 6 0.000 5 0.000 24002 0.725 8 0.000 8 0.8100000000000000 0.0 0.8100000000000000
25563 G25563T|(ORF3a_protein:G171T(Q57H)) 4261 0.085 430 0.001 217 0.001 371 0.001 587 0.002 275 0.001 137 0.001 24482 0.727 62 0.000 9 0.813 0.006 0.819
25613 C25613T|(ORF3a_protein:C221T(S74F)) 4245 0.084 21 0.000 12 0.000 14 0.000 22 0.000 15 0.000 7 0.000 24105 0.730 22698 0.144 9 0.958 0.0 0.958
25688 C25688T|(ORF3a_protein:C296T(A99V)) 20 0.000 6 0.000 7 0.000 6 0.000 31 0.000 7 0.000 14 0.000 23740 0.656 4 0.000 9 0.656 0.0 0.656
25703 C25703T|(ORF3a_protein:C311T(P104L)) 4378 0.084 24 0.000 1050 0.006 24 0.000 15 0.000 9 0.000 9 0.000 24126 0.670 7 0.000 9 0.76 0.0 0.76
25855 G25855T|(ORF3a_protein:G463T(D155Y)) 2 0.001 53 0.004 61 0.003 1303 0.351 4 0.356 0.003 0.359
25907 G25907T|(ORF3a_protein:G515T(G172V)) 213 0.096 1078 0.094 19 0.001 424 0.118 4 0.308 0.001 0.309
26056 G26056A|(ORF3a_protein:G664A(D222N)) 9204 0.651 7 0.000 4 0.000 3 0.000 1 0.000 40606 0.956 1 0.000 7 1.607 0.0 1.607
26149 T26149C|(ORF3a_protein:T757C(S253P)) 4369 0.306 1 0.000 18 0.000 3 0.000 13 0.000 2 0.000 40560 0.952 10 0.000 8 1.258 0.0 1.258
26149 T26149C|(ORF3a_protein:TCC757-759CCT(S253P)) 4930 0.345 4 0.000 2 0.345 0 0.345
26151 C26151T|(ORF3a_protein:TCC757-759CCT(S253P)) 4930 0.345 4 0.000 2 0.345 0 0.345
26379 T26379C|(envelope_protein:T135C(N45N)) 53533 0.465 191 0.017 15 0.000 1 0.000 3 0.000 12 0.000 8 0.000 1 0.000 188035 0.747 332 0.003 10 1.232 0.0 1.232
26417 T26417G|(envelope_protein:T173G(V58G)) 4 0.000 1 0.333 187 0.002 20 0.002 141 0.001 74 0.000 82 0.002 7 0.335 0.005 0.34
26440 A26440T|(envelope_protein:A196T(N66Y)) 88936 0.869 9 0.000 3 0.000 18 0.000 200713 0.989 18 0.000 6 1.858 0.0 1.858
26443 T26443C|(envelope_protein:T199C(S67P)) 54929 0.537 4 0.000 14 0.000 179789 0.886 10 0.000 5 1.423 0.0 1.423
26457 T26457A|(envelope_protein:T213A(P71P)) 54997 0.538 53 0.001 5 0.001 75 0.001 179938 0.887 20 0.000 6 1.425 0.003 1.428
26475 G26475A 55043 0.538 5 0.000 9 0.000 180500 0.890 11 0.000 5 1.428 0.0 1.428
26520 G26520A 27342 0.264 3 0.000 1 0.000 11 0.000 180212 0.889 4 0.000 6 1.153 0.0 1.153
26527 C26527T|(membrane_glycoprotein:C5T(A2V)) 92217 0.892 10 0.000 2 0.000 4 0.000 199699 0.985 3 0.000 6 1.877 0.0 1.877
linked 26529 G26529C|(membrane_glycoprotein:G7C(D3H)) 10574 0.102 3 1.000 85411 0.985 8509 0.985 3 1.000 76 0.962 144121 0.991 1635 0.008 42339 0.990 9 2.1 4.923000000000000 7.023
26531 T26531G|(membrane_glycoprotein:T9G(D3E)) 92363 0.893 1 0.000 3 0.000 200342 0.988 4 0.000 5 1.881 0.0 1.881
26552 T26552G|(membrane_glycoprotein:T30G(V10V)) 71 0.001 257 0.003 43 0.005 1 0.011 377 0.002 177254 0.852 139 0.003 7 0.856 0.021000000000000000 0.877
linked 26577 C26577G|(membrane_glycoprotein:C55G(Q19E)) 30705 0.297 3 1.000 85564 0.987 8471 0.983 2 1.000 80 0.941 144238 0.991 180613 0.891 42027 0.991 9 3.1790000000000000 4.902000000000000 8.081
26585 RATG13 C26585T|(membrane_glycoprotein:C63T(N21N)) 35829 0.347 2 0.000 2 0.000 3 0.000 2503 0.012 2 0.000 6 0.359 0.0 0.359
26586 C26586T|(membrane_glycoprotein:C64T(L22L)) 34334 0.332 2 0.000 1 0.000 1 0.000 5 0.000 5 0.332 0.0 0.332
26607 C26607T|(membrane_glycoprotein:C85T(L29F)) 92275 0.894 2 0.000 4 0.000 200379 0.989 2 0.000 5 1.883 0.0 1.883
26673 T26673C|(membrane_glycoprotein:T151C(L51L)) 40476 0.339 1752 0.027 11 0.000 2 0.000 10 0.000 10 0.000 2 0.000 217039 0.889 1685 0.010 9 1.2650000000000000 0.0 1.2650000000000000
linked 26681 C26681T|(membrane_glycoprotein:C159T(F53F)) 23194 0.194 62630 0.969 110306 0.997 8784 0.998 40035 0.994 171691 0.998 145348 0.999 17313 0.997 16398 0.067 169981 0.987 10 2.217 5.983 8.2
26688 C26688T|(membrane_glycoprotein:C166T(L56L)) 117 0.001 3 0.000 3 0.000 2 0.000 5 0.000 108176 0.443 1659 0.010 7 0.454 0.0 0.454
linked 26709 G26709A|(membrane_glycoprotein:G187A(A63T)) 23322 0.195 62009 0.959 110026 0.995 8772 0.996 39420 0.979 170517 0.991 145285 0.998 17254 0.993 1544 0.006 169445 0.983 10 2.143 5.952000000000000 8.095
26714 RATG13 T26714C|(membrane_glycoprotein:T192C(C64C)) 19 0.000 1166 0.018 13 0.000 3 0.000 8 0.000 16 0.000 2 0.000 112089 0.458 1696 0.010 9 0.48600000000000000 0.0 0.48600000000000000
26753 RATG13 C26753T|(membrane_glycoprotein:C231T(T77T)) 149 0.008 1741 0.027 1 0.000 2 0.000 3 0.000 2 0.000 12185 0.289 4 0.000 8 0.324 0.0 0.324
26767 Delta T26767C|(membrane_glycoprotein:T245C(I82T)) 5305 0.285 1744 0.027 3 0.000 1 0.000 14 0.000 42028 0.997 1666 0.013 7 1.3220000000000000 0.0 1.3220000000000000
26792 G26792A|(membrane_glycoprotein:G270A(L90L)) 713 0.038 596 0.009 3 0.000 3 0.000 7 0.000 1 0.000 14898 0.339 1695 0.013 8 0.399 0.0 0.399
26824 G26824A|(membrane_glycoprotein:G302A(R101K)) 595 0.032 1725 0.027 1 0.000 7 0.000 30164 0.700 7 0.000 6 0.759 0.0 0.759
linked 26833 C26833T|(membrane_glycoprotein:C311T(A104V)) 13315 0.714 62689 0.970 23906 0.997 189 0.995 40019 0.996 171741 0.997 17329 0.998 5 0.000 116977 0.893 9 2.577 4.983 7.56
26847 A26847T|(membrane_glycoprotein:A325T(M109L)) 665 0.010 25 0.001 66 0.002 131 0.001 10 0.001 22682 0.526 78 0.001 7 0.537 0.005 0.542
26853 T26853G|(membrane_glycoprotein:T331G(S111A)) 2553 0.137 1169 0.018 1 0.000 6 0.000 18 0.000 1 0.000 24171 0.561 1602 0.012 8 0.7280000000000000 0.0 0.7280000000000000
linked 26858 C26858T|(membrane_glycoprotein:C336T(F112F)) 13288 0.713 62758 0.971 23913 0.998 190 1.000 40038 0.996 171797 0.997 17342 0.999 128849 0.984 8 2.668 4.990000000000000 7.6580000000000000
26895 C26895T|(membrane_glycoprotein:C373T(H125Y)) 844 0.046 64199 0.993 1 0.000 2 0.000 5 0.000 36561 0.849 1585 0.012 7 1.9000000000000000 0.0 1.9000000000000000
26905 T26905C|(membrane_glycoprotein:T383C(I128T)) 1172 0.018 1 0.000 2 0.000 21 0.000 2 0.000 36676 0.852 1590 0.012 7 0.882 0.0 0.882
26921 T26921C|(membrane_glycoprotein:T399C(L133L)) 2401 0.130 1174 0.018 3 0.000 4 0.000 25 0.000 2 0.000 25991 0.604 1597 0.012 8 0.764 0.0 0.764
26927 RATG13 A26927G|(membrane_glycoprotein:A405G(E135E)) 1681 0.091 1170 0.018 6 0.000 4 0.000 23 0.000 1 0.000 15150 0.352 1607 0.012 8 0.473 0.0 0.473
26934 C26934A|(membrane_glycoprotein:C412A(L138I)) 2514 0.136 1768 0.027 11 0.000 30 0.001 63 0.000 4 0.000 36692 0.852 1624 0.012 8 1.0270000000000000 0.001 1.028
26969 T26969C|(membrane_glycoprotein:T447C(L149L)) 2 0.000 1178 0.018 5 0.000 8 0.000 29 0.000 1 0.000 23357 0.551 1660 0.013 8 0.5820000000000000 0.0 0.5820000000000000
26972 T26972C|(membrane_glycoprotein:T450C(R150R)) 2 0.000 62267 0.969 2 0.000 2 0.000 7 0.000 2 0.000 3 0.000 12 0.000 8 0.969 0.0 0.969
27005 C27005T|(membrane_glycoprotein:C483T(I161I)) 72544 0.637 21027 0.259 6 0.000 7 0.000 6 0.000 324124 0.950 15567 0.315 7 2.161 0.0 2.161
linked 27008 G27008T|(membrane_glycoprotein:G486T(K162N)) 72525 0.637 21149 0.260 247 0.003 1 0.333 371 0.004 103 0.001 325059 0.953 15600 0.315 8 2.165 0.341 2.5060000000000000
27056 T27056C|(membrane_glycoprotein:T534C(Y178Y)) 72584 0.636 21027 0.259 6 0.000 10 0.000 7 0.000 316731 0.928 15675 0.314 7 2.137 0.0 2.137
27061 A27061G|(membrane_glycoprotein:A539G(K180R)) 31 0.000 21033 0.259 14 0.000 31 0.000 12 0.000 76994 0.226 15654 0.314 7 0.799 0.0 0.799
27112 G27112C|(membrane_glycoprotein:G590C(S197T)) 73482 0.638 21020 0.259 26 0.000 36 0.000 8 0.000 324613 0.951 15660 0.314 7 2.162 0.0 2.162
27143 C27143T|(membrane_glycoprotein:C621T(N207N)) 15 0.000 2 0.000 7 0.000 5 0.000 3 0.000 120192 0.351 2 0.000 7 0.351 0.0 0.351
27147 G27147A|(membrane_glycoprotein:G625A(D209N)) 73499 0.637 20855 0.257 51 0.001 74 0.001 25 0.000 324151 0.946 15726 0.314 7 2.154 0.002 2.1560000000000000
27192 GTGACAACAGATGTTTCATCTCGTTGACTTTCAGGTT27192-27228del|(ORF6_protein:Start_disrupted) 2 0.000 84594 0.254 15422 0.312 3 0.5660000000000000 0 0.5660000000000000
27230 C27230-27230del|(ORF6_protein:29-29del(10fs)) 2 0.000 1 0.000 84645 0.233 15421 0.153 4 0.386 0.0 0.386
27230 C27230A|(ORF6_protein:C29A(T10N)) 72086 0.637 21380 0.204 663 0.002 1 0.000 868 0.003 338 0.002 226299 0.623 78 0.001 8 1.4650000000000000 0.007 1.4720000000000000
27233 T27233C|(ORF6_protein:T32C(I11T)) 72049 0.509 20895 0.199 41 0.000 5 0.000 39 0.000 27 0.000 17 0.000 312989 0.860 15456 0.152 9 1.7200000000000000 0.0 1.7200000000000000
27242 T27242C|(ORF6_protein:T41C(I14T)) 115824 0.624 20929 0.199 34 0.000 8 0.000 41 0.000 28 0.000 11 0.000 552988 0.921 15507 0.152 9 1.896 0.0 1.896
27262 A27262G|(ORF6_protein:A61G(T21A)) 115463 0.622 20773 0.197 23 0.000 16 0.000 32 0.000 42 0.000 18 0.000 427561 0.712 10 0.000 9 1.5310000000000000 0.0 1.5310000000000000
27267 RATG13 T27267C|(ORF6_protein:T66C(F22F)) 70 0.000 20 0.000 34 0.000 12 0.000 31 0.000 44 0.000 22 0.000 194067 0.323 15506 0.152 9 0.475 0.0 0.475
27285 RATG13 T27285C|(ORF6_protein:T84C(N28N)) 6166 0.033 8 0.000 25 0.000 4 0.000 26 0.000 39 0.000 6 0.000 431046 0.718 15511 0.152 9 0.903 0.0 0.903
27290 A27290G|(ORF6_protein:A89G(D30G)) 112593 0.607 21023 0.200 31 0.000 23 0.000 41 0.000 58 0.000 17 0.000 551408 0.918 15523 0.152 9 1.877 0.0 1.877
27292 T27292C|(ORF6_protein:T91C(Y31H)) 108711 0.586 21015 0.200 61 0.000 16 0.000 45 0.000 55 0.000 28 0.000 366744 0.608 15539 0.153 9 1.5470000000000000 0.0 1.5470000000000000
27318 T27318C|(ORF6_protein:T117C(N39N)) 6866 0.037 20974 0.199 9 0.000 5 0.000 17 0.000 35 0.000 13 0.000 293333 0.486 15493 0.152 9 0.874 0.0 0.874
27340 A27340G|(ORF6_protein:A139G(N47D)) 80338 0.432 17038 0.162 37 0.000 19 0.000 46 0.000 73 0.000 21 0.000 359862 0.597 15456 0.152 9 1.343 0.0 1.343
27442 C27442G|(ORF7a_protein:C49G(L17V)) 20170 0.692 3 0.000 27 0.000 31 0.000 75 0.000 65 0.000 15 0.000 33536 0.952 3 0.000 9 1.644 0.0 1.644
27522 T27522G|(ORF7a_protein:T129G(N43K)) 19932 0.692 35 0.001 346 0.002 223 0.002 543 0.002 347 0.001 100 0.001 33694 0.957 60 0.001 9 1.6510000000000000 0.008 1.6590000000000000
27634 T27634C|(ORF7a_protein:T241C(S81P)) 19608 0.387 21 0.000 3 0.000 7 0.000 5 0.000 4 0.000 80478 0.754 10 0.000 8 1.141 0.0 1.141
27684 C27684T|(ORF7a_protein:C291T(Y97Y)) 19597 0.384 11 0.000 2 0.000 3 0.000 2 0.000 1 0.000 80052 0.750 5 0.000 8 1.134 0.0 1.134
27711 A27711G|(ORF7a_protein:A318G(A106A)) 19 0.000 127 0.001 25 0.000 75 0.001 48 0.001 24 0.000 79849 0.748 49 0.001 8 0.75 0.002 0.752
27739 C27739A|(ORF7a_protein:C346A(L116I)) 2 0.000 666 0.003 161 0.003 365 0.003 256 0.003 89 0.001 78523 0.732 55 0.001 8 0.736 0.010000000000000000 0.746
27739 C27739T|(ORF7a_protein:C346T(L116F)) 19623 0.384 7 0.000 2 0.000 7 0.000 3 0.000 1 0.000 57 0.001 9 0.000 8 0.385 0.0 0.385
27792 T27792-27792del|(ORF7b:37-37del(13fs)) 18332 0.359 34 0.000 8 0.000 4 0.000 6 0.000 1818 0.064 5 0.000 7 0.423 0.0 0.423
linkedubiq 27807 C27807T|(ORF7b:C52T(L18L)) 30922 0.981 1 1.000 228910 0.994 57530 0.994 106550 0.991 70800 0.990 1 1.000 73635 0.995 26349 0.913 90115 0.994 10 3.8820000000000000 5.97 9.852
linkedubiq 27810 T27810C|(ORF7b:T55C(F19L)) 30943 0.982 1 1.000 228634 0.993 57454 0.993 106552 0.991 70819 0.990 1 1.000 73696 0.996 26323 0.913 90373 0.997 10 3.885 5.970000000000000 9.855
27900 RATG13 T27900C|(ORF8_protein:T7C(F3L)) 10 0.000 23 0.000 20 0.000 13 0.000 9 0.000 11 0.000 12 0.000 14020 0.327 11 0.000 9 0.327 0.0 0.327
linked 28271 A28271T 49834 0.720 6 0.857 291380 0.995 28572 0.996 1046781 0.994 215962 0.994 1 1.000 7 1.000 386086 0.998 86554 0.978 158085 0.997 11 3.6900000000000000 6.839 10.529
28289 C28289A|(nucleocapsid_phosphoprotein:C16A(P6T)) 19274 0.278 293 0.001 21 0.001 1219 0.001 241 0.001 242 0.001 2498 0.028 35 0.000 8 0.30700000000000000 0.004 0.31100000000000000
28291 C28291A|(nucleocapsid_phosphoprotein:C18A(P6P)) 25478 0.367 571 0.002 46 0.002 2510 0.002 518 0.002 313 0.001 76 0.001 48 0.000 8 0.37 0.007 0.377
linked 28311 C28311T|(nucleocapsid_phosphoprotein:C38T(P13L)) 49774 0.717 7 1.000 291374 0.995 28591 0.996 1046935 0.994 216024 0.994 1 1.000 7 1.000 385800 0.997 85113 0.942 158216 0.998 11 3.652 6.981 10.633
28339 T28339C|(nucleocapsid_phosphoprotein:T66C(D22D)) 16 0.000 86 0.000 4 0.000 373 0.000 90 0.000 70 0.000 80087 0.479 58 0.000 8 0.479 0.0 0.479
28362 G28362A|(nucleocapsid_phosphoprotein:G89A(G30E)) 19325 0.278 79709 0.482 2 0.76 0 0.76
linked 28362 GAGAACGCA28362-28370del|(nucleocapsid_phosphoprotein:GGAGAACGCAGT88-99GGTdel(GERS30-33Gdel)) 49650 0.715 6 1.000 291243 0.996 28599 0.997 1049748 0.995 216095 0.994 1 1.000 8 1.000 385542 0.997 84161 0.509 157334 0.997 11 3.2170000000000000 6.983 10.2
28365 A28365G|(nucleocapsid_phosphoprotein:A92G(E31G)) 19512 0.281 80484 0.486 2 0.767 0 0.767
28383 C28383T|(nucleocapsid_phosphoprotein:C110T(S37L)) 19442 0.280 16 0.000 2 0.000 36 0.000 15 0.000 22 0.000 80658 0.487 13 0.000 8 0.767 0.0 0.767
28426 T28426C|(nucleocapsid_phosphoprotein:T153C(S51S)) 19526 0.284 36 0.000 4 0.000 97 0.000 26 0.000 30 0.000 82518 0.499 27 0.000 8 0.7830000000000000 0.0 0.7830000000000000
linked 28472 C28472T|(nucleocapsid_phosphoprotein:C199T(P67S)) 19126 0.278 14 0.000 41 0.000 9 0.000 4 0.800 14 0.000 82771 0.501 8 0.000 8 0.779 0.8 1.5790000000000000
28500 C28500T|(nucleocapsid_phosphoprotein:C227T(T76I)) 46 0.001 10 0.000 1 0.000 43 0.000 8 0.000 2 0.002 12 0.000 81167 0.501 11 0.000 9 0.502 0.002 0.504
linked 28550 C28550A|(nucleocapsid_phosphoprotein:C277A(R93R)) 951 0.056 38 0.000 163 0.001 1 0.077 80 0.001 199 0.000 51 0.000 74535 0.808 26 0.000 9 0.8640000000000000 0.079 0.9430000000000000
28657 C28657T|(nucleocapsid_phosphoprotein:C384T(D128D)) 2954 0.166 6 0.000 13 0.000 6 0.000 29 0.000 6 0.000 77354 0.821 8 0.000 8 0.987 0.0 0.987
28869 C28869T|(nucleocapsid_phosphoprotein:C596T(P199L)) 20589 0.626 1 0.000 1 0.000 134608 0.849 4 0.000 5 1.475 0.0 1.475
28952 T28952C|(nucleocapsid_phosphoprotein:T679C(L227L)) 20858 0.626 5 0.000 3 0.000 2 0.000 1 0.000 134630 0.848 10 0.000 7 1.474 0.0 1.474
29095 RATG13 C29095T|(nucleocapsid_phosphoprotein:C822T(F274F)) 11 0.000 5 0.000 5 0.000 5 0.000 1 0.000 81453 0.513 7 0.000 7 0.513 0.0 0.513
29164 T29164C|(nucleocapsid_phosphoprotein:T891C(D297D)) 37 0.001 1 0.017 7 0.000 5 0.000 3 0.000 2 0.000 11 0.000 66050 0.695 8 0.696 0.017 0.713
29194 RATG13 T29194C|(nucleocapsid_phosphoprotein:T921C(F307F)) 60988 0.429 167 0.000 41 0.000 483 0.000 76 0.000 490 0.001 210250 0.898 146 0.001 8 1.328 0.001 1.329
29239 G29239A|(nucleocapsid_phosphoprotein:G966A(M322I)) 61881 0.471 34 0.000 16 0.000 122 0.000 30 0.000 27 0.000 212799 0.998 14 0.000 8 1.4690000000000000 0.0 1.4690000000000000
29249 C29249T|(nucleocapsid_phosphoprotein:C976T(P326S)) 61627 0.469 14 0.000 3 0.000 41 0.000 9 0.000 21 0.000 2 0.000 7 0.469 0.0 0.469
29250 C29250A|(nucleocapsid_phosphoprotein:C977A(P326H)) 23 0.000 501 0.001 165 0.001 1351 0.001 572 0.001 490 0.001 212681 0.998 43 0.000 8 0.999 0.004 1.003
29377 T29377A|(nucleocapsid_phosphoprotein:T1104A(P368P)) 62321 0.468 488 0.001 158 0.001 1318 0.001 508 0.001 398 0.000 208043 0.964 122 0.001 8 1.434 0.003 1.4370000000000000
29709 T29709G 38366 0.469 41 0.000 126 0.000 311552 0.867 70 0.000 5 1.3360000000000000 0.0 1.3360000000000000
29734 G29734C 2 0.000 4 0.000 303968 0.846 1 0.000 4 0.846 0.0 0.846
29736 GGCCACGCGGAGTACGATCGAGTG29736-29759del 37537 0.468 13 0.000 5 0.000 305175 0.849 3 0.000 5 1.317 0.0 1.317