NH-1 - Complete Raw Mutation Data

Full TSV data with all sample columns and abundance information
← Back to Dashboard

Complete Mutations Data

This table shows the complete data from the mutations.tsv file exactly as it appears in the source. Scroll horizontally to see all columns.

SRR33953980(251722) SRR33955129(254398) SRR33955131(379564) SRR33955141(513441) SRR33955143(260972) SRR33955148(389230) SRR33955199(274118) SRR33955201(227249) SRR33955204(308140) SRR33956172(525047) SRR33956174(378778) SRR33956186(87609) SRR33956188(257694) SRR33956190(333896) SRR33956192(336213) SRR33972966(231847) SRR33972968(282400) SRR33973812(337713) SRR33983805(543848) SRR33983806(385395) SRR33983814(24987)
('2025-04-07', '40000') ('2025-04-21', '2800') ('2025-04-22', '40000') ('2025-04-22', '40000') ('2025-04-14', '2800') ('2025-04-16', '40000') ('2025-04-28', '2800') ('2025-04-28', '40000') ('2025-04-28', '40000') ('2025-05-12', '2800') ('2025-05-12', '40000') ('2025-05-12', '40000') ('2025-05-05', '2800') ('2025-05-05', '40000') ('2025-05-05', '40000') ('2025-05-19', '2800') ('2025-05-19', '40000') ('2025-05-26', '40000') ('2025-06-02', '2800') ('2025-06-02', '40000') ('2025-06-02', '40000')
Sequences Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Total samples Positives Sum Negatives Sum Total Sum
505 T505A|(ORF1ab_polyprotein:T240A(P80P))|(ORF1a_polyprotein:T240A(P80P)) 20 0.714 72 0.447 2 0.083 12 0.207 4 1.451 0 1.451
508 T508C|(ORF1ab_polyprotein:T243C(H81H))|(ORF1a_polyprotein:T243C(H81H)) 21 0.750 156 0.987 23 0.958 57 0.983 4 3.678 0 3.678
558 G558A|(ORF1ab_polyprotein:G293A(G98D))|(ORF1a_polyprotein:G293A(G98D)) 50 0.318 29 0.829 2 1.147 0 1.147
709 G709A|(ORF1ab_polyprotein:G444A(E148E))|(ORF1a_polyprotein:G444A(E148E)) 225 0.361 1 0.361 0 0.361
754 T754C|(ORF1ab_polyprotein:T489C(T163T))|(ORF1a_polyprotein:T489C(T163T)) 583 0.632 2807 0.999 1367 0.500 2535 0.999 4 3.13 0 3.13
856 T856C|(ORF1ab_polyprotein:T591C(P197P))|(ORF1a_polyprotein:T591C(P197P)) 613 0.624 3023 0.997 1408 0.498 2774 0.997 4 3.116 0 3.116
1051 A1051G|(ORF1ab_polyprotein:A786G(K262K))|(ORF1a_polyprotein:A786G(K262K)) 18 0.400 1 0.4 0 0.4
1598 G1598T|(ORF1ab_polyprotein:G1333T(G445C))|(ORF1a_polyprotein:G1333T(G445C)) 3 0.375 3 0.130 2 0.505 0 0.505
1732 A1732C|(ORF1ab_polyprotein:A1467C(E489D))|(ORF1a_polyprotein:A1467C(E489D)) 857 0.198 274 0.108 2 0.306 0 0.306
1820 G1820A|(ORF1ab_polyprotein:G1555A(G519S))|(ORF1a_polyprotein:G1555A(G519S)) 5221 0.993 2959 0.997 3 0.001 2 0.001 2369 0.997 2666 0.992 1034 0.998 7 4.977 0.002 4.979
1981 A1981G|(ORF1ab_polyprotein:A1716G(G572G))|(ORF1a_polyprotein:A1716G(G572G)) 54 1.000 54 0.088 2 1.088 0 1.088
2832 A2832G|(ORF1ab_polyprotein:A2567G(K856R))|(ORF1a_polyprotein:A2567G(K856R)) 1938 0.999 1593 0.980 32 1.000 799 0.780 2 0.002 5 3.761 0 3.761
2947 C2947A|(ORF1ab_polyprotein:C2682A(G894G))|(ORF1a_polyprotein:C2682A(G894G)) 73 0.593 1 0.593 0 0.593
3075 A3075G|(ORF1ab_polyprotein:A2810G(E937G))|(ORF1a_polyprotein:A2810G(E937G)) 59 0.311 1 0.311 0 0.311
3140 RATG13 C3140T|(ORF1ab_polyprotein:C2875T(P959S))|(ORF1a_polyprotein:C2875T(P959S)) 265 0.808 361 0.994 2 1.000 63 0.420 4 3.222 0 3.222
3892 G3892T|(ORF1ab_polyprotein:G3627T(E1209D))|(ORF1a_polyprotein:G3627T(E1209D)) 160 0.630 377 0.997 90 1.000 314 0.997 4 3.624 0 3.624
4120 T4120C|(ORF1ab_polyprotein:T3855C(Y1285Y))|(ORF1a_polyprotein:T3855C(Y1285Y)) 16 0.080 62 0.183 37 0.370 70 0.257 4 0.89 0 0.89
4179 A4179G|(ORF1ab_polyprotein:A3914G(K1305R))|(ORF1a_polyprotein:A3914G(K1305R)) 14 0.038 132 0.468 2 0.506 0 0.506
4189 RATG13 C4189T|(ORF1ab_polyprotein:C3924T(G1308G))|(ORF1a_polyprotein:C3924T(G1308G)) 5 0.013 268 0.464 2 0.47700000000000004 0 0.47700000000000004
4573 RATG13 C4573T|(ORF1ab_polyprotein:C4308T(N1436N))|(ORF1a_polyprotein:C4308T(N1436N)) 219 0.079 283 0.217 2 0.296 0 0.296
4897 RATG13 C4897T|(ORF1ab_polyprotein:C4632T(F1544F))|(ORF1a_polyprotein:C4632T(F1544F)) 3 0.002 3 0.007 5 0.001 913 0.820 4 0.82 0.01 0.83
5095 T5095C|(ORF1ab_polyprotein:T4830C(H1610H))|(ORF1a_polyprotein:T4830C(H1610H)) 37 0.804 97 0.980 29 1.000 26 0.703 4 3.487 0 3.487
5284 C5284T|(ORF1ab_polyprotein:C5019T(N1673N))|(ORF1a_polyprotein:C5019T(N1673N)) 120 0.750 407 0.990 81 1.000 146 0.820 4 3.56 0 3.56
5299 T5299C|(ORF1ab_polyprotein:T5034C(T1678T))|(ORF1a_polyprotein:T5034C(T1678T)) 118 0.761 415 0.988 90 1.000 148 0.818 4 3.567 0 3.567
5386 T5386G|(ORF1ab_polyprotein:T5121G(A1707A))|(ORF1a_polyprotein:T5121G(A1707A)) 23 0.742 113 0.942 12 0.343 26 0.839 4 2.866 0 2.866
5482 C5482T|(ORF1ab_polyprotein:C5217T(A1739A))|(ORF1a_polyprotein:C5217T(A1739A)) 338 1.000 1842 0.992 180 0.738 493 1.000 4 3.73 0 3.73
5515 G5515T|(ORF1ab_polyprotein:G5250T(V1750V))|(ORF1a_polyprotein:G5250T(V1750V)) 316 1.000 1735 0.993 168 0.724 458 0.998 4 3.715 0 3.715
5648 RATG13 A5648C|(ORF1ab_polyprotein:A5383C(K1795Q))|(ORF1a_polyprotein:A5383C(K1795Q)) 264 1.000 1474 0.997 143 0.726 377 1.000 4 3.723 0 3.723
5728 T5728C|(ORF1ab_polyprotein:T5463C(F1821F))|(ORF1a_polyprotein:T5463C(F1821F)) 71 1.000 1 1.0 0 1.0
6115 T6115G|(ORF1ab_polyprotein:T5850G(P1950P))|(ORF1a_polyprotein:T5850G(P1950P)) 117 0.216 264 0.111 2 0.327 0 0.327
6336 C6336T|(ORF1ab_polyprotein:C6071T(S2024L))|(ORF1a_polyprotein:C6071T(S2024L)) 1236 0.786 857 0.491 2 1.2770000000000001 0 1.2770000000000001
6513 GTT6513-6515del|(ORF1ab_polyprotein:AGTTTA6247-6252ATAdel(SL2083-2084Idel))|(ORF1a_polyprotein:AGTTTA6247-6252ATAdel(SL2083-2084Idel)) 1237 0.997 1136 0.917 215 0.488 309 1.000 4 3.402 0 3.402
6736 RATG13 T6736C|(ORF1ab_polyprotein:T6471C(V2157V))|(ORF1a_polyprotein:T6471C(V2157V)) 179 0.821 405 0.998 100 1.000 3 2.819 0 2.819
7005 C7005A|(ORF1ab_polyprotein:C6740A(T2247N))|(ORF1a_polyprotein:C6740A(T2247N)) 88 1.000 615 0.962 381 0.995 3 2.957 0 2.957
7061 T7061C|(ORF1ab_polyprotein:T6796C(Y2266H))|(ORF1a_polyprotein:T6796C(Y2266H)) 67 1.000 488 0.982 314 0.997 2 0.013 4 2.979 0.013 2.992
7112 A7112G|(ORF1ab_polyprotein:A6847G(T2283A))|(ORF1a_polyprotein:A6847G(T2283A)) 11 0.208 18 0.069 2 0.277 0 0.277
7144 T7144C|(ORF1ab_polyprotein:T6879C(S2293S))|(ORF1a_polyprotein:T6879C(S2293S)) 51 0.307 1 0.307 0 0.307
7464 T7464C|(ORF1ab_polyprotein:T7199C(V2400A))|(ORF1a_polyprotein:T7199C(V2400A)) 53 1.000 1 1.0 0 1.0
7490 T7490C|(ORF1ab_polyprotein:T7225C(C2409R))|(ORF1a_polyprotein:T7225C(C2409R)) 4 0.571 1 0.571 0 0.571
7588 T7588C|(ORF1ab_polyprotein:T7323C(G2441G))|(ORF1a_polyprotein:T7323C(G2441G)) 1117 0.999 956 0.866 222 1.000 3 2.865 0 2.865
7654 A7654G|(ORF1ab_polyprotein:A7389G(T2463T))|(ORF1a_polyprotein:A7389G(T2463T)) 1075 0.998 1117 0.982 234 0.996 3 2.976 0 2.976
8240 C8240T|(ORF1ab_polyprotein:C7975T(H2659Y))|(ORF1a_polyprotein:C7975T(H2659Y)) 842 0.195 2120 0.265 1487 0.220 3 0.68 0 0.68
8434 A8434G|(ORF1ab_polyprotein:A8169G(E2723E))|(ORF1a_polyprotein:A8169G(E2723E)) 1196 0.427 1 0.427 0 0.427
8662 T8662C|(ORF1ab_polyprotein:T8397C(H2799H))|(ORF1a_polyprotein:T8397C(H2799H)) 11 0.306 9 0.045 13 0.565 46 0.272 4 1.188 0 1.188
8681 A8681G|(ORF1ab_polyprotein:A8416G(I2806V))|(ORF1a_polyprotein:A8416G(I2806V)) 2 0.003 36 1.000 149 1.000 17 1.000 168 0.994 3 0.002 6 3.9939999999999998 0.005 3.9989999999999997
8707 T8707C|(ORF1ab_polyprotein:T8442C(G2814G))|(ORF1a_polyprotein:T8442C(G2814G)) 12 0.400 1 0.4 0 0.4
8970 T8970G|(ORF1ab_polyprotein:T8705G(L2902R))|(ORF1a_polyprotein:T8705G(L2902R)) 42 0.124 81 0.352 66 0.957 3 1.4329999999999998 0 1.4329999999999998
9039 C9039T|(ORF1ab_polyprotein:C8774T(A2925V))|(ORF1a_polyprotein:C8774T(A2925V)) 164 1.000 238 0.838 113 0.601 3 0.052 4 2.491 0 2.491
9166 C9166T|(ORF1ab_polyprotein:C8901T(T2967T))|(ORF1a_polyprotein:C8901T(T2967T)) 10 0.370 1 0.37 0 0.37
9360 C9360T|(ORF1ab_polyprotein:C9095T(T3032I))|(ORF1a_polyprotein:C9095T(T3032I)) 13 0.176 40 0.204 2 0.38 0 0.38
9571 T9571C|(ORF1ab_polyprotein:T9306C(P3102P))|(ORF1a_polyprotein:T9306C(P3102P)) 28 0.196 77 0.161 111 0.271 3 0.628 0 0.628
10195 A10195G|(ORF1ab_polyprotein:A9930G(E3310E))|(ORF1a_polyprotein:A9930G(E3310E)) 6 1.000 45 1.000 6 0.500 12 1.000 4 3.5 0 3.5
10354 G10354A|(ORF1ab_polyprotein:G10089A(K3363K))|(ORF1a_polyprotein:G10089A(K3363K)) 64 0.157 297 0.337 2 0.494 0 0.494
linked 10449 C10449A|(ORF1ab_polyprotein:C10184A(P3395H))|(ORF1a_polyprotein:C10184A(P3395H)) 1669 0.996 58 1.000 1160 0.997 386 1.000 280 1.000 38 1.000 991 0.998 737 1.000 5933 0.998 830 0.999 1037 0.999 49 1.000 4705 1.000 13 4.999 7.9879999999999995 12.986999999999998
10456 RATG13 C10456T|(ORF1ab_polyprotein:C10191T(F3397F))|(ORF1a_polyprotein:C10191T(F3397F)) 17 0.315 67 0.172 16 0.444 2 0.002 363 0.444 5 1.375 0.002 1.377
10705 G10705T|(ORF1ab_polyprotein:G10440T(R3480S))|(ORF1a_polyprotein:G10440T(R3480S)) 990 0.462 1 0.462 0 0.462
10834 C10834T|(ORF1ab_polyprotein:C10569T(A3523A))|(ORF1a_polyprotein:C10569T(A3523A)) 7 0.002 4 0.002 2 0.002 2 0.001 11 0.002 3551 0.998 6 1.003 0.004 1.007
11081 RATG13 T11081G|(ORF1ab_polyprotein:T10816G(L3606V))|(ORF1a_polyprotein:T10816G(L3606V)) 18 0.600 148 0.378 355 1.000 3 1.978 0 1.978
11117 A11117G|(ORF1ab_polyprotein:A10852G(I3618V))|(ORF1a_polyprotein:A10852G(I3618V)) 23 0.852 393 1.000 82 1.000 363 0.992 4 3.844 0 3.844
11273 G11273A|(ORF1ab_polyprotein:G11008A(V3670I))|(ORF1a_polyprotein:G11008A(V3670I)) 4 0.667 48 0.980 3 1.000 50 0.272 4 2.919 0 2.919
11283 GTTTGTCTG11283-11291del|(ORF1ab_polyprotein:AGTTTGTCTGGT11017-11028AGTdel(SLSG3673-3676Sdel))|(ORF1a_polyprotein:AGTTTGTCTGGT11017-11028AGTdel(SLSG3673-3676Sdel)) 4 0.667 43 1.000 2 1.000 43 0.277 4 2.944 0 2.944
11522 T11522G|(ORF1ab_polyprotein:T11257G(F3753V))|(ORF1a_polyprotein:T11257G(F3753V)) 16 0.800 36 1.000 7 0.700 11 1.000 4 3.5 0 3.5
11537 A11537G|(ORF1ab_polyprotein:A11272G(I3758V))|(ORF1a_polyprotein:A11272G(I3758V)) 23 0.719 48 0.980 11 0.733 12 1.000 4 3.432 0 3.432
11575 C11575T|(ORF1ab_polyprotein:C11310T(F3770F))|(ORF1a_polyprotein:C11310T(F3770F)) 20 0.500 24 0.324 7 0.318 3 1.142 0 1.142
11830 A11830G|(ORF1ab_polyprotein:A11565G(V3855V))|(ORF1a_polyprotein:A11565G(V3855V)) 18 0.277 1 0.277 0 0.277
13195 T13195C|(ORF1ab_polyprotein:T12930C(V4310V))|(ORF1a_polyprotein:T12930C(V4310V)) 7905 0.998 5455 0.999 8 0.001 959 1.000 5109 0.998 5 3.995 0.001 3.996
13557 T13557C|(ORF1ab_polyprotein:T13293C(N4431N)) 10711 0.896 6039 0.990 1488 0.575 10 0.001 4 2.461 0.001 2.4619999999999997
13712 A13712C|(ORF1ab_polyprotein:A13448C(K4483T)) 3472 0.998 1 0.998 0 0.998
13818 C13818T|(ORF1ab_polyprotein:C13554T(D4518D)) 259 0.666 1 0.666 0 0.666
14116 A14116G|(ORF1ab_polyprotein:A13852G(T4618A)) 66 0.589 112 0.824 5 1.000 3 2.413 0 2.413
14583 C14583T|(ORF1ab_polyprotein:C14319T(H4773H)) 4 1.000 28 1.000 5 1.000 19 1.000 4 4.0 0 4.0
14598 T14598C|(ORF1ab_polyprotein:T14334C(N4778N)) 4 0.800 37 1.000 4 1.000 21 1.000 4 3.8 0 3.8
14952 T14952C|(ORF1ab_polyprotein:T14688C(F4896F)) 33 0.256 1 0.256 0 0.256
15049 C15049G|(ORF1ab_polyprotein:C14785G(P4929A)) 3 1.000 32 1.000 11 1.000 27 1.000 4 4.0 0 4.0
15240 C15240T|(ORF1ab_polyprotein:C14976T(N4992N)) 130 0.942 807 0.978 82 0.845 594 0.780 4 0.001 5 3.545 0.001 3.546
15276 T15276G|(ORF1ab_polyprotein:T15012G(P5004P)) 128 0.970 740 0.979 81 0.880 550 0.778 4 3.607 0 3.607
16585 G16585T|(ORF1ab_polyprotein:G16321T(A5441S)) 16 0.889 35 1.000 3 1.000 9 0.818 7 1.000 5 4.707 0 4.707
16999 A16999G|(ORF1ab_polyprotein:A16735G(T5579A)) 6 0.750 66 0.985 7 0.500 24 1.000 2 0.250 5 3.485 0 3.485
17124 T17124C|(ORF1ab_polyprotein:T16860C(A5620A)) 974 0.884 2891 0.994 250 0.958 13 0.520 2424 0.999 5 4.355 0 4.355
18163 A18163T|(ORF1ab_polyprotein:A17899T(I5967L)) 104 0.812 301 0.850 19 0.633 3 2.295 0 2.295
18395 C18395T|(ORF1ab_polyprotein:C18131T(A6044V)) 59 0.345 222 0.351 77 0.306 2 0.001 4 1.002 0.001 1.003
18568 C18568T|(ORF1ab_polyprotein:C18304T(L6102F)) 10599 0.726 6703 0.972 5239 0.999 14052 0.999 4 3.6959999999999997 0 3.6959999999999997
18744 RATG13 C18744T|(ORF1ab_polyprotein:C18480T(Y6160Y)) 10537 0.721 6599 0.967 15 0.001 5237 0.990 14000 0.995 5 3.673 0.001 3.674
18994 G18994T|(ORF1ab_polyprotein:G18730T(A6244S)) 263 1.000 498 1.000 78 0.453 57 1.000 4 3.453 0 3.453
19026 T19026C|(ORF1ab_polyprotein:T18762C(L6254L)) 242 1.000 426 1.000 56 0.409 53 1.000 4 3.409 0 3.409
19129 G19129A|(ORF1ab_polyprotein:G18865A(E6289K)) 236 0.904 462 0.985 64 0.508 313 0.997 4 3.394 0 3.394
19235 G19235T|(ORF1ab_polyprotein:G18971T(C6324F)) 861 0.290 1 0.29 0 0.29
19262 A19262G|(ORF1ab_polyprotein:A18998G(N6333S)) 4 0.002 2 0.003 98 0.314 3 0.316 0.003 0.319
19513 A19513C|(ORF1ab_polyprotein:A19249C(R6417R)) 5372 0.997 3789 0.948 6322 0.804 2114 0.593 4 3.342 0 3.342
19524 RATG13 C19524T|(ORF1ab_polyprotein:C19260T(L6420L)) 2 0.001 6260 0.997 4681 0.948 7409 0.800 2508 0.599 5 3.344 0.001 3.3449999999999998
19538 T19538C|(ORF1ab_polyprotein:T19274C(M6425T)) 2 0.001 7206 0.998 5276 0.931 8462 0.792 2831 0.570 5 3.291 0.001 3.292
19815 A19815T|(ORF1ab_polyprotein:A19551T(P6517P)) 2253 0.954 2470 0.977 643 0.432 344 1.000 4 3.363 0 3.363
20057 G20057A|(ORF1ab_polyprotein:G19793A(G6598D)) 615 0.498 1 0.498 0 0.498
20409 T20409A|(ORF1ab_polyprotein:T20145A(F6715L)) 3 1.000 6 1.000 2 1.000 3 3.0 0 3.0
20703 C20703T|(ORF1ab_polyprotein:C20439T(Y6813Y)) 64 0.189 195 0.195 2 0.384 0 0.384
20823 RATG13 C20823T|(ORF1ab_polyprotein:C20559T(N6853N)) 905 1.000 2686 0.975 1602 0.841 544 0.995 4 3.811 0 3.811
21137 A21137G|(ORF1ab_polyprotein:A20873G(K6958R)) 4 0.001 17 0.013 45 0.152 95 0.127 2 0.001 5 0.292 0.002 0.294
21429 T21429A|(ORF1ab_polyprotein:T21165A(T7055T)) 80 0.305 58 0.045 2 0.35 0 0.35
21601 TCAGTGTGT21601-21609del|(surface_glycoprotein:AGTCAGTGTGTT37-48AGTdel(SQCV13-16Sdel)) 291 1.000 1620 0.998 433 0.995 975 0.997 4 3.99 0 3.99
21938 G21938A|(surface_glycoprotein:G376A(V126I)) 294 0.488 1303 0.964 373 1.000 1215 0.998 4 3.45 0 3.45
21987 GTGTTTATT21987-21995del|(surface_glycoprotein:GGTGTTTATTAC424-435GACdel(GVYY142-145Ddel)) 582 0.552 2596 0.969 738 1.000 1971 0.997 4 3.518 0 3.518
22013 A22013T|(surface_glycoprotein:A451T(S151C)) 7 0.001 539 0.509 1474 0.521 741 0.999 1579 0.728 5 2.757 0.001 2.758
22014 G22014A|(surface_glycoprotein:G452A(S151N)) 171 0.060 578 0.265 2 0.325 0 0.325
22015 T22015G|(surface_glycoprotein:T453G(S151R)) 46 0.043 896 0.327 2 0.37 0 0.37
22018 G22018T|(surface_glycoprotein:G456T(W152C)) 177 0.066 589 0.283 2 0.349 0 0.349
22023 A22023G|(surface_glycoprotein:A461G(E154G)) 5 0.005 450 0.171 682 1.000 540 0.263 4 1.439 0 1.439
22159 TTA22159-22161del|(surface_glycoprotein:GGTTAT595-600GGTdel(GY199-200Gdel)) 268 0.369 958 0.419 448 0.996 919 0.569 4 2.3529999999999998 0 2.3529999999999998
linked 22194 ATT22194-22196del|(surface_glycoprotein:AATTTA631-636ATAdel(NL211-212Idel)) 285 0.997 445 1.000 1703 0.997 292 1.000 731 0.999 711 0.973 7078 0.993 1562 0.995 226 1.000 363 0.992 1299 0.998 719 0.994 664 0.994 485 0.907 1943 0.997 476 0.996 695 0.997 17 3.88 12.949 16.829
22207 T22207G|(surface_glycoprotein:T645G(D215E)) 47 0.276 183 0.530 68 0.607 185 0.791 4 2.204 0 2.204
22209 22209-insertCAGAAGA|(surface_glycoprotein:CTCCCT646-651CCAGAAGATCCCCTTinsert(LP216-217PEDPLinsert)) 47 0.290 172 0.490 67 0.588 184 0.786 4 2.154 0 2.154
22209 T22209C|(surface_glycoprotein:T647C(L216P)) 6 0.037 146 0.416 33 0.289 40 0.171 4 0.9129999999999999 0 0.9129999999999999
22212 C22212T|(surface_glycoprotein:C650T(P217L)) 5 0.031 146 0.416 32 0.276 39 0.165 4 0.888 0 0.888
22213 22213-insertCT|(surface_glycoprotein:CTCCCT646-651CCAGAAGATCCCCTTinsert(LP216-217PEDPLinsert)) 47 0.264 172 0.180 67 0.279 184 0.546 4 1.2690000000000001 0 1.2690000000000001
22281 CTTTACTTG22281-22289del|(surface_glycoprotein:ACTTTACTTGCT718-729ACTdel(TLLA240-243Tdel)) 20 0.400 855 0.913 123 0.494 175 0.806 4 2.613 0 2.613
22286 CTTGCTT22286-22292del|(surface_glycoprotein:CTTGCTTTACAT724-735TATdel(LALH242-245Ydel)) 61 0.065 58 0.233 2 0.29800000000000004 0 0.29800000000000004
22294 AC22294-22295del|(surface_glycoprotein:CTTGCTTTACAT724-735TATdel(LALH242-245Ydel)) 61 0.061 58 0.228 2 0.28900000000000003 0 0.28900000000000003
22458 C22458T|(surface_glycoprotein:C896T(T299I)) 3 0.176 377 0.992 81 0.771 63 0.875 4 2.814 0 2.814
22578 G22578A|(surface_glycoprotein:G1016A(G339D)) 3949 0.948 2917 0.999 73 0.091 667 0.999 4 3.037 0 3.037
22582 A22582C|(surface_glycoprotein:A1020C(E340D)) 4081 0.946 2975 0.999 75 0.087 688 0.996 4 3.028 0 3.028
22598 A22598C|(surface_glycoprotein:AGA1036-1038CGC(R346R)) 4078 0.939 2855 0.986 68 0.075 668 0.999 4 2.999 0 2.999
22600 A22600C|(surface_glycoprotein:AGA1036-1038CGC(R346R)) 4078 0.941 2855 0.987 68 0.075 668 0.999 4 3.002 0 3.002
linked 22629 A22629C|(surface_glycoprotein:A1067C(K356T)) 808 0.995 4644 0.998 4209 0.999 168 1.000 2680 0.998 934 0.998 794 0.997 1290 0.999 2035 0.999 822 0.999 13 1.000 626 0.998 388 1.000 1148 0.999 14 3.992 9.987 13.979
22673 T22673A|(surface_glycoprotein:TCC1111-1113AAC(S371N)) 1788 0.482 831 0.391 64 0.072 220 0.457 4 1.402 0 1.402
22673 T22673C|(surface_glycoprotein:TCC1111-1113CTC(S371L)) 1538 0.415 1225 0.576 260 0.541 3 1.532 0 1.532
22674 C22674A|(surface_glycoprotein:TCC1111-1113AAC(S371N)) 1788 0.485 831 0.391 64 0.075 220 0.457 4 1.408 0 1.408
22674 C22674T|(surface_glycoprotein:TCC1111-1113CTC(S371L)) 1538 0.417 1225 0.576 260 0.541 3 1.534 0 1.534
22676 RATG13 G22676A|(surface_glycoprotein:G1114A(A372T)) 3321 0.898 2088 0.982 64 0.074 480 0.998 4 2.952 0 2.952
22679 T22679A|(surface_glycoprotein:T1117A(S373T)) 3320 0.906 2093 0.984 64 0.084 480 0.998 4 2.972 0 2.972
22812 A22812C|(surface_glycoprotein:AAG1249-1251ACT(K417T)) 2142 0.967 2256 0.997 345 0.513 1609 0.999 4 3.476 0 3.476
22813 G22813T|(surface_glycoprotein:AAG1249-1251ACT(K417T)) 2142 0.967 2256 0.997 345 0.522 1609 0.999 4 3.485 0 3.485
linked 22882 T22882G|(surface_glycoprotein:T1320G(N440K)) 916 0.998 1950 0.997 606 0.998 4 1.000 24 1.000 2366 1.000 5 1.000 7 3.993 3.0 6.993
22893 A22893C|(surface_glycoprotein:AAG1330-1332ACT(K444T)) 971 1.000 1905 0.971 579 0.997 2413 0.999 4 3.967 0 3.967
22894 G22894T|(surface_glycoprotein:AAG1330-1332ACT(K444T)) 971 1.000 1905 0.971 579 0.997 2413 0.999 4 3.967 0 3.967
22906 T22906C|(surface_glycoprotein:T1344C(N448N)) 959 0.998 1918 0.998 569 0.996 2353 0.998 4 3.99 0 3.99
22907 T22907A|(surface_glycoprotein:T1345A(Y449N)) 956 0.995 1918 0.998 569 0.996 2352 0.998 4 3.987 0 3.987
22991 A22991G|(surface_glycoprotein:AGC1429-1431GAC(S477D)) 1076 0.999 2224 0.996 702 1.000 2855 0.999 4 3.9939999999999998 0 3.9939999999999998
22992 G22992A|(surface_glycoprotein:AGC1429-1431GAC(S477D)) 1076 0.999 2224 0.996 702 1.000 2855 0.999 4 3.9939999999999998 0 3.9939999999999998
linked 22995 RATG13,Delta C22995A|(surface_glycoprotein:C1433A(T478K)) 1071 0.994 2226 0.997 700 0.997 19 1.000 2845 0.996 5 3.984 1.0 4.984
23013 A23013C|(surface_glycoprotein:A1451C(E484A)) 1029 0.998 2188 0.999 666 0.999 2766 1.000 4 3.996 0 3.996
23048 G23048A|(surface_glycoprotein:G1486A(G496S)) 699 0.997 1268 0.870 444 0.998 1878 0.997 4 3.862 0 3.862
linked 23055 A23055G|(surface_glycoprotein:A1493G(Q498R)) 590 0.998 1245 0.998 375 0.997 2 1.000 8 1.000 1567 0.996 3 1.000 7 3.989 3.0 6.989
linked 23063 A23063T|(surface_glycoprotein:A1501T(N501Y)) 411 1.000 847 0.998 257 0.996 2 1.000 7 1.000 1068 0.999 3 1.000 7 3.993 3.0 6.993
linked 23075 RATG13 T23075C|(surface_glycoprotein:T1513C(Y505H)) 217 1.000 498 0.998 158 1.000 2 1.000 5 1.000 569 1.000 2 1.000 7 3.998 3.0 6.998
23431 T23431C|(surface_glycoprotein:T1869C(A623A)) 2 0.286 1 0.286 0 0.286
23454 C23454A|(surface_glycoprotein:C1892A(P631H)) 62 0.363 1 0.363 0 0.363
23454 C23454A|(surface_glycoprotein:CCT1891-1893CAC(P631H)) 73 0.427 9 1.000 2 1.427 0 1.427
23455 RATG13 T23455C|(surface_glycoprotein:CCT1891-1893CAC(P631H)) 73 0.427 9 1.000 2 1.427 0 1.427
23487 T23487C|(surface_glycoprotein:T1925C(V642A)) 2 0.003 130 0.756 11 1.000 2 0.001 4 1.759 0.001 1.7599999999999998
linked 23525 C23525T|(surface_glycoprotein:C1963T(H655Y)) 1187 0.997 275 0.993 481 1.000 1414 0.996 115 1.000 168 1.000 359 0.997 188 1.000 3316 0.992 1722 0.993 706 0.999 12 1.000 1178 0.995 398 0.993 581 0.993 1024 0.997 16 4.993 10.952 15.945
23604 C23604A|(surface_glycoprotein:C2042A(P681H)) 171 0.988 103 1.000 23 1.000 76 1.000 4 3.988 0 3.988
23673 C23673T|(surface_glycoprotein:C2111T(S704L)) 2607 0.998 1750 0.829 524 0.998 1370 0.998 4 3.823 0 3.823
23756 A23756C|(surface_glycoprotein:A2194C(T732P)) 724 0.255 257 0.116 542 0.996 836 0.651 4 2.0180000000000002 0 2.0180000000000002
23757 C23757T|(surface_glycoprotein:C2195T(T732I)) 2031 0.733 372 0.168 430 0.335 3 1.236 0 1.236
23782 G23782T|(surface_glycoprotein:G2220T(M740I)) 2716 0.996 2105 0.995 517 0.998 1231 0.994 4 3.983 0 3.983
23929 RATG13 C23929T|(surface_glycoprotein:C2367T(Y789Y)) 1590 0.288 1 0.288 0 0.288
24111 T24111C|(surface_glycoprotein:T2549C(I850T)) 4282 0.998 3 0.002 4318 0.961 7 0.001 2 0.001 3 0.001 3039 0.998 11 0.001 17 0.001 9 2.959 0.005 2.964
24130 C24130A|(surface_glycoprotein:C2568A(N856K)) 4078 0.997 4111 0.961 2856 0.995 3 2.953 0 2.953
24132 G24132A|(surface_glycoprotein:G2570A(G857D)) 1518 0.664 1 0.664 0 0.664
24134 C24134A|(surface_glycoprotein:C2572A(L858I)) 2639 0.646 1333 0.312 859 0.300 3 1.258 0 1.258
24233 G24233T|(surface_glycoprotein:G2671T(G891C)) 2 0.250 1 0.25 0 0.25
24257 G24257T|(surface_glycoprotein:G2695T(A899S)) 7 0.700 1 0.7 0 0.7
24340 RATG13 A24340G|(surface_glycoprotein:A2778G(Q926Q)) 16 0.258 1 0.258 0 0.258
24355 T24355C|(surface_glycoprotein:T2793C(I931I)) 5 0.500 4 0.062 2 0.167 3 0.729 0 0.729
24503 C24503T|(surface_glycoprotein:C2941T(L981F)) 81 0.988 410 0.972 59 0.967 392 0.997 4 3.924 0 3.924
25067 A25067T|(surface_glycoprotein:A3505T(I1169F)) 4800 0.666 622 0.286 1759 0.557 3 1.5090000000000001 0 1.5090000000000001
25254 C25254T|(surface_glycoprotein:C3692T(T1231I)) 2 0.019 23 0.140 42 0.646 3 0.805 0 0.805
25276 C25276T|(surface_glycoprotein:C3714T(T1238T)) 7 0.875 1 0.875 0 0.875
25386 C25386T 2 0.023 8 0.500 2 0.523 0 0.523
25414 T25414C|(ORF3a_protein:T22C(F8L)) 74 0.987 421 0.993 210 0.673 345 1.000 4 3.653 0 3.653
25420 RATG13 A25420C|(ORF3a_protein:A28C(I10L)) 27 0.200 129 0.152 75 0.120 3 0.472 0 0.472
25430 TAACTT25430-25435del|(ORF3a_protein:GTAACTTTG37-45GTGdel(VTL13-15Vdel)) 30 0.124 324 0.243 199 0.157 3 0.524 0 0.524
25500 G25500C|(ORF3a_protein:G108C(P36P)) 466 0.981 4338 0.996 1578 0.728 2867 0.998 4 3.703 0 3.703
25543 G25543A|(ORF3a_protein:G151A(A51T)) 620 0.972 5201 0.998 1834 0.732 3436 0.995 5 0.001 6 0.001 6 3.697 0.002 3.699
linked 25584 C25584T|(ORF3a_protein:C192T(T64T)) 696 0.999 284 1.000 736 0.997 6457 0.997 5212 0.996 3446 0.996 2658 0.996 176 1.000 142 1.000 2133 0.998 22650 0.997 3673 0.997 9300 0.997 4749 0.997 1457 0.998 5417 0.997 5806 0.999 17 5.984 10.977 16.961
25806 A25806G|(ORF3a_protein:A414G(P138P)) 92 0.948 440 0.991 14 0.875 58 0.983 4 3.7969999999999997 0 3.7969999999999997
25827 TTTTCTT25827-25833del|(ORF3a_protein:435-441del(145fs)) 29 0.547 1 0.547 0 0.547
25907 G25907T|(ORF3a_protein:G515T(G172V)) 7 0.064 68 0.167 9 0.167 3 0.398 0 0.398
25909 G25909T|(ORF3a_protein:G517T(D173Y)) 75 0.688 101 0.248 9 0.170 3 1.1059999999999999 0 1.1059999999999999
25971 G25971T|(ORF3a_protein:G579T(W193C)) 25 0.260 74 0.174 3 0.070 3 0.504 0 0.504
26030 A26030T|(ORF3a_protein:A638T(Q213L)) 2 0.100 12 0.245 2 0.345 0 0.345
26045 A26045G|(ORF3a_protein:A653G(Q218R)) 3 0.273 2 0.118 2 0.391 0 0.391
26111 C26111G|(ORF3a_protein:C719G(P240R)) 255 0.288 21 0.024 2 0.312 0 0.312
26158 GTTAATCCAGTA26158-26169del|(ORF3a_protein:766-777del(VNPV256-259del)) 464 0.737 597 0.985 108 0.982 3 2.7039999999999997 0 2.7039999999999997
linked 26270 C26270T|(envelope_protein:C26T(T9I)) 42 1.000 671 0.999 32 1.000 716 0.996 64 1.000 42 1.000 108 1.000 116 0.991 100 0.990 315 0.997 107 0.982 11 2.9859999999999998 7.969 10.955
26303 T26303C|(envelope_protein:T59C(F20S)) 92 0.122 88 0.721 2 0.843 0 0.843
26333 C26333T|(envelope_protein:C89T(T30I)) 111 0.261 25 0.053 2 0.314 0 0.314
26350 G26350A|(envelope_protein:G106A(A36T)) 63 0.242 19 0.065 2 0.307 0 0.307
26351 C26351T|(envelope_protein:C107T(A36V)) 90 0.367 39 0.139 6 0.143 3 0.649 0 0.649
26530 A26530G|(membrane_glycoprotein:A8G(D3G)) 81 0.976 204 1.000 22 1.000 89 1.000 4 3.976 0 3.976
26663 T26663C|(membrane_glycoprotein:T141C(Y47Y)) 460 0.485 1755 0.761 529 0.451 1229 0.712 4 2.409 0 2.409
linked 26709 G26709A|(membrane_glycoprotein:G187A(A63T)) 158 1.000 39 1.000 87 1.000 1375 0.996 202 0.995 3556 0.996 429 0.995 299 0.997 1805 0.992 590 0.997 292 1.000 22 1.000 193 1.000 97 1.000 2696 0.997 121 1.000 15 1.000 153 0.994 83 1.000 19 5.981 12.978 18.959
26756 RATG13 T26756A|(membrane_glycoprotein:T234A(G78G)) 1416 0.992 3413 0.996 1741 0.995 2621 0.970 4 3.953 0 3.953
26816 T26816A|(membrane_glycoprotein:T294A(A98A)) 301 0.188 1285 0.344 526 0.186 3 0.718 0 0.718
26873 C26873A|(membrane_glycoprotein:C351A(N117K)) 383 0.089 412 0.191 328 0.095 3 0.375 0 0.375
26885 C26885T|(membrane_glycoprotein:C363T(N121N)) 1473 0.993 3453 0.994 1816 0.993 2768 0.971 4 3.951 0 3.951
27002 C27002T|(membrane_glycoprotein:C480T(D160D)) 40 0.333 37 0.142 2 0.069 10 0.068 4 0.612 0 0.612
27529 T27529G|(ORF7a_protein:T136G(F46V)) 714 0.787 1597 0.996 975 0.998 3 2.781 0 2.781
27641 C27641T|(ORF7a_protein:C248T(S83L)) 291 0.343 1 0.343 0 0.343
27680 T27680C|(ORF7a_protein:T287C(L96P)) 93 0.303 1138 0.593 2 0.002 632 0.379 4 1.277 0 1.277
27689 C27689T|(ORF7a_protein:C296T(P99L)) 92 0.311 1286 0.685 627 0.390 3 1.3860000000000001 0 1.3860000000000001
27765 C27765T|(ORF7b:C10T(L4F)) 223 0.817 2192 0.973 658 0.672 1704 0.996 4 3.458 0 3.458
linked 27807 C27807T|(ORF7b:C52T(L18L)) 6012 0.995 1386 0.997 3558 0.996 181 1.000 2109 0.992 1906 0.995 2345 0.993 2883 0.994 809 0.990 6249 0.997 14750 0.997 981 0.996 6802 0.995 1434 0.993 2211 0.996 1969 0.997 928 0.998 4146 0.996 18 4.976 12.941 17.917
28090 GTTCTA28090-28095del|(ORF8_protein:GGTTCTAAA196-204GAAdel(GSK66-68Edel)) 24 0.029 88 0.223 2 0.252 0 0.252
28254 A28254-28254del|(ORF8_protein:361-361del(121fs)) 7927 0.641 4110 0.981 5996 0.569 5177 1.000 4 3.191 0 3.191
linked 28271 A28271T 5676 0.998 3570 0.998 11135 0.999 12969 0.999 4901 0.998 4547 0.999 8486 0.998 19947 0.998 10864 0.997 13255 0.999 33264 0.999 6569 0.998 9434 0.999 5764 0.999 4550 0.999 13836 0.998 24558 0.998 11238 0.999 14355 0.999 19 4.992 13.979 18.971
28287 G28287A|(nucleocapsid_phosphoprotein:G14A(G5E)) 7470 0.551 4362 0.919 4047 0.362 5685 0.934 4 2.766 0 2.766
28295 A28295G|(nucleocapsid_phosphoprotein:AAT22-24GAC(N8D)) 1389 0.108 418 0.091 2262 0.216 427 0.072 4 0.487 0 0.487
28297 RATG13 T28297C|(nucleocapsid_phosphoprotein:AAT22-24GAC(N8D)) 1389 0.109 418 0.094 2262 0.216 427 0.074 4 0.493 0 0.493
linked 28297 RATG13 T28297C|(nucleocapsid_phosphoprotein:T24C(N8N)) 8984 0.838 6886 0.542 4011 0.899 8158 0.419 3720 0.355 12395 0.997 1957 0.058 4813 0.527 5302 0.923 9712 0.725 22940 0.996 10712 0.997 13539 0.997 13 3.715 5.558 9.273
linked 28311 C28311T|(nucleocapsid_phosphoprotein:C38T(P13L)) 5081 0.999 3161 0.999 9774 0.999 11350 0.999 4086 0.999 3965 0.999 7187 0.998 17118 0.999 8994 0.999 10607 0.999 28731 0.999 5444 0.999 8188 0.999 5038 0.999 3973 0.999 12116 0.999 21059 0.999 9880 0.999 12162 0.999 19 4.995 13.985 18.98
linked 28362 GAGAACGCA28362-28370del|(nucleocapsid_phosphoprotein:GGAGAACGCAGT88-99GGTdel(GERS30-33Gdel)) 4160 0.999 2549 0.998 8686 0.998 10844 0.998 3404 0.998 3798 0.998 5860 0.998 14850 0.998 8588 0.998 9567 0.998 24680 0.999 4822 0.998 6687 0.997 4766 0.998 3237 0.999 10812 0.998 18920 0.998 8028 0.999 10838 0.998 19 4.99 13.975 18.965
28382 RATG13 T28382C|(nucleocapsid_phosphoprotein:T109C(S37P)) 2314 0.189 720 0.165 2418 0.248 670 0.124 4 0.726 0 0.726
28708 C28708T|(nucleocapsid_phosphoprotein:C435T(H145H)) 3031 0.791 3902 0.993 4380 0.535 2852 0.998 4 3.317 0 3.317
28742 A28742G|(nucleocapsid_phosphoprotein:A469G(I157V)) 3 0.001 454 0.112 6 0.003 271 0.062 6 0.001 19 0.002 1528 0.172 8 0.001 4 0.001 4 0.002 447 0.144 3 0.001 10 0.001 4 0.001 6 0.001 15 0.49 0.015 0.505
28748 C28748T|(nucleocapsid_phosphoprotein:C475T(L159L)) 3100 0.793 4185 0.988 4612 0.532 3023 0.994 4 3.307 0 3.307
28808 G28808A|(nucleocapsid_phosphoprotein:G535A(G179S)) 1301 0.756 1435 0.982 1719 0.503 1136 0.998 4 3.239 0 3.239
28831 C28831A|(nucleocapsid_phosphoprotein:C558A(S186S)) 36 0.151 45 0.110 73 0.390 3 0.651 0 0.651
linked 28881 G28881A|(nucleocapsid_phosphoprotein:AGG607-609AAA(R203K)) 585 0.983 1985 0.996 3568 0.991 2854 0.968 2630 0.992 2315 0.984 550 0.993 2565 0.993 1968 0.995 5776 0.993 3488 0.997 2902 0.991 2720 0.993 1971 0.992 3698 0.995 3173 0.992 4801 0.991 3488 0.992 3614 0.992 19 4.93 13.893 18.823
linked 28882 G28882A|(nucleocapsid_phosphoprotein:AGG607-609AAA(R203K)) 585 0.983 1985 0.996 3568 0.991 2854 0.968 2630 0.992 2315 0.984 550 0.993 2565 0.993 1968 0.995 5776 0.993 3488 0.997 2902 0.991 2720 0.993 1971 0.992 3698 0.995 3173 0.992 4801 0.991 3488 0.992 3614 0.992 19 4.93 13.893 18.823
linked 28883 G28883C|(nucleocapsid_phosphoprotein:G610C(G204R)) 594 0.998 1988 0.997 3088 0.858 2944 0.999 2645 0.998 2321 0.983 552 0.996 1980 0.767 1970 0.996 5809 0.998 1622 0.464 2915 0.996 1817 0.664 1983 0.998 1235 0.332 3191 0.998 4839 0.998 3506 0.997 3636 0.998 19 4.974 12.061 17.035
28921 T28921A|(nucleocapsid_phosphoprotein:T648A(D216E)) 3587 0.805 3412 0.985 2445 0.848 2699 0.900 4 3.5380000000000003 0 3.5380000000000003
linked 28928 C28928T|(nucleocapsid_phosphoprotein:C655T(L219F)) 3701 0.805 3519 0.980 2528 0.848 2729 0.459 2798 0.898 5 3.531 0.459 3.99
29272 RATG13 C29272T|(nucleocapsid_phosphoprotein:C999T(Y333Y)) 680 0.048 119 0.037 2655 0.997 3 1.082 0 1.082
29296 C29296T|(nucleocapsid_phosphoprotein:C1023T(D341D)) 14603 0.822 3584 0.970 5084 0.456 3269 0.998 4436 0.992 5 4.2379999999999995 0 4.2379999999999995
29738 CCACGCGGAGTACGATCGAGTGT29738-29760del 15191 0.894 4556 0.977 10183 0.839 8175 0.939 4 3.649 0 3.649
29774 C29774T 18673 0.870 5992 0.989 13972 0.865 10481 0.932 4 3.656 0 3.656
29779 G29779T 19142 0.888 6038 0.994 14261 0.881 10509 0.932 4 3.6950000000000003 0 3.6950000000000003