NL-1 - Complete Raw Mutation Data

Full TSV data with all sample columns and abundance information
← Back to Dashboard

Complete Mutations Data

This table shows the complete data from the mutations.tsv file exactly as it appears in the source. Scroll horizontally to see all columns.

Unnamed: 0 Unnamed: 1 Unnamed: 2 Unnamed: 3 SRR23050824 Unnamed: 5 SRR23050832 Unnamed: 7 SRR23050837 Unnamed: 9 SRR23050838 Unnamed: 11 SRR23050839 Unnamed: 13 SRR23050845 Unnamed: 15 SRR23050850 Unnamed: 17 SRR23050857 Unnamed: 19 SRR23050862 Unnamed: 21 SRR23050863 Unnamed: 23 SRR23050866 Unnamed: 25 SRR23050869 Unnamed: 27 SRR23050870 Unnamed: 29 SRR23050871 Unnamed: 31 SRR23050875 Unnamed: 33 SRR23050879 Unnamed: 35 SRR23050882 Unnamed: 37 SRR23050883 Unnamed: 39 SRR23050891 Unnamed: 41 SRR23050898 Unnamed: 43 SRR23050827 Unnamed: 45 SRR23050830 Unnamed: 47 SRR23050831 Unnamed: 49 SRR23050833 Unnamed: 51 SRR23050834 Unnamed: 53 SRR23050836 Unnamed: 55 SRR23050842 Unnamed: 57 SRR23050846 Unnamed: 59 SRR23050855 Unnamed: 61 SRR23050859 Unnamed: 63 SRR23050861 Unnamed: 65 SRR23050874 Unnamed: 67 SRR23050878 Unnamed: 69 SRR23050884 Unnamed: 71 SRR23050886 Unnamed: 73 SRR23050888 Unnamed: 75 SRR23050893 Unnamed: 77 SRR23050894 Unnamed: 79 SRR23050899 Unnamed: 81 SRR23050901 Unnamed: 83 Unnamed: 84 Unnamed: 85 Unnamed: 86 Unnamed: 87 Unnamed: 88 Key Unnamed: 90
('2022-08-25', '67890') ('2022-08-22', '67890') ('2022-09-18', '67890') ('2022-09-16', '67890') ('2022-09-12', '67890') ('2022-08-28', '67890') ('2022-08-14', '67890') ('2022-08-18', '67890') ('2022-09-15', '67890') ('2022-08-24', '467169') ('2022-09-13', '467169') ('2022-09-03', '467169') ('2022-09-03', '467169') ('2022-08-26', '67890') ('2022-09-11', '467169') ('2022-08-04', '67890') ('2022-09-08', '467169') ('2022-09-08', '467169') ('2022-09-01', '467169') ('2022-08-29', '467169') ('2022-08-10', '313928') ('2022-09-16', '313928') ('2022-08-26', '313928') ('2022-08-22', '313928') ('2022-08-19', '313928') ('2022-08-17', '313928') ('2022-09-02', '67890') ('2022-08-23', '313928') ('2022-09-26', '313928') ('2022-09-21', '313928') ('2022-09-19', '313928') ('2022-09-12', '313928') ('2022-09-09', '313928') ('2022-09-07', '313928') ('2022-09-06', '313928') ('2022-09-05', '313928') ('2022-08-31', '313928') ('2022-08-31', '313928') ('2022-08-29', '313928') ('2022-08-02', '313928') Cryptic Sewershed
Linked/Ubiquitous Position Flagged Sequences Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Total samples Positives Sum Negatives Sum Total Sum Non-Cryptic Sewershed
100 C100A 473 0.652 176 0.385 10 1 3 2.037 0 2.037
119 C119A 32 1 64 1 2 2 0 2
210 Delta G210T 93 1 281 0.342 301 0.594 414 0.974 110 0.991 303 0.987 2 0.007 7 4.888 0.007 4.895
linked 241 Delta C241T 42 1 92 0.989 76 0.987 279 0.34 155 0.994 304 0.598 423 0.991 184 0.989 110 0.991 308 0.99 269 0.982 91 1 12 8.869 1.982 10.8509999999999
315 GTT315-317del|(ORF1ab_polyprotein:AGTTTG49-54ATGdel(SL17-18Mdel))|(ORF1a_polyprotein:AGTTTG49-54ATGdel(SL17-18Mdel)) 38 0.927 75 0.974 510 0.625 194 0.385 14 1 5 3.911 0 3.911
linked 425 GTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTT425-457del|(ORF1ab_polyprotein:160-192del(VEVEKGVLPQL54-64del))|(ORF1a_polyprotein:160-192del(VEVEKGVLPQL54-64del)) 1935 0.37 1084 0.985 1600 0.196 2410 0.697 904 0.986 2440 0.436 7646 0.404 1139 0.322 857 0.308 1013 0.511 548 0.305 4186 0.523 265 0.287 13 6.043 0.287 6.33
508 TGGTCATGTTATGGT508-522del|(ORF1ab_polyprotein:CATGGTCATGTTATGGTT241-258CATdel(HGHVMV81-86Hdel))|(ORF1a_polyprotein:CATGGTCATGTTATGGTT241-258CATdel(HGHVMV81-86Hdel)) 1946 0.337 1075 0.918 1612 0.18 2416 0.679 907 0.945 2435 0.427 8408 0.41 1136 0.298 866 0.305 1026 0.467 545 0.297 4159 0.474 3 0.002 13 5.737 0.002 5.739
752 A752T|(ORF1ab_polyprotein:A487T(T163S))|(ORF1a_polyprotein:A487T(T163S)) 526 0.259 2 0.003 2 0.002 9 0.005 291 0.973 2 0.003 201 0.446 84 0.152 166 0.095 194 0.693 109 0.245 880 0.142 9 0.002 8 0.002 3 0.001 3 0.007 16 3.018 0.012 3.03
821 G821A|(ORF1ab_polyprotein:G556A(V186I))|(ORF1a_polyprotein:G556A(V186I)) 169 0.082 2 0.003 376 0.225 149 0.259 83 0.151 264 0.15 202 0.971 72 0.252 469 0.075 2 0.001 10 2.168 0.001 2.169
1592 T1592A|(ORF1ab_polyprotein:T1327A(S443T))|(ORF1a_polyprotein:T1327A(S443T)) 132 0.038 3236 0.991 665 0.48 212 0.311 169 0.091 5 1.911 0 1.911
1674 A1674G|(ORF1ab_polyprotein:A1409G(N470S))|(ORF1a_polyprotein:A1409G(N470S)) 8304 0.983 2794 0.735 1958 0.984 453 0.312 414 0.56 111 0.299 1658 0.351 615 0.304 3 0.001 7 0.001 10 4.528 0.002 4.52999999999999
2533 T2533A|(ORF1ab_polyprotein:T2268A(V756V))|(ORF1a_polyprotein:T2268A(V756V)) 9 0.153 49 1 45 0.549 32 0.889 3 0.75 8 0.308 4 0.031 7 3.68 0 3.68
2720 G2720A|(ORF1ab_polyprotein:G2455A(A819T))|(ORF1a_polyprotein:G2455A(A819T)) 4 0.667 23 0.359 51 0.981 35 1 51 0.63 40 1 11 1 4 0.571 14 0.5 16 0.113 10 6.821 0 6.821
linked 3037 RATG13,Delta C3037T|(ORF1ab_polyprotein:C2772T(F924F))|(ORF1a_polyprotein:C2772T(F924F)) 125 1 2357 0.995 3285 0.993 174 0.972 1309 0.99 2426 0.988 101 1 150 0.987 114 1 338 0.997 76 1 66 0.985 2257 0.991 93 0.989 1252 0.991 611 0.989 80 0.988 2990 0.995 2283 0.992 6093 0.993 4904 0.993 6657 0.991 33 1 268 0.996 6712 0.991 1365 0.991 233 0.996 101 0.981 161 0.988 100 0.99 53 1 52 1 250 0.988 254 0.966 122 0.992 4296 0.991 36 16.855 18.834 35.689
3068 G3068T|(ORF1ab_polyprotein:G2803T(D935Y))|(ORF1a_polyprotein:G2803T(D935Y)) 907 0.383 5 0.002 707 0.535 2380 0.969 99 0.98 152 0.448 31 0.408 32 0.478 4 0.002 32 0.34 134 0.106 195 0.316 3 0.001 11 0.002 7 0.001 13 0.002 11 0.002 3 0.012 2 0.008 8 0.002 20 4.967 0.03 4.997
3193 A3193G|(ORF1ab_polyprotein:A2928G(E976E))|(ORF1a_polyprotein:A2928G(E976E)) 186 0.386 1442 0.481 538 0.941 218 0.461 1819 0.984 1284 0.965 1471 0.909 752 0.933 2569 0.606 1364 0.325 207 0.243 540 0.261 539 0.117 8758 0.805 328 0.245 2 0.001 16 8.662 0.001 8.663
4181 G4181T|(ORF1ab_polyprotein:G3916T(A1306S))|(ORF1a_polyprotein:G3916T(A1306S)) 28 1 12 0.923 2 1 5 1 142 0.966 16 1 6 1 6 1 2 0.667 16 0.333 16 0.552 2 0.009 12 9.441 0.009 9.45
5106 A5106C|(ORF1ab_polyprotein:A4841C(E1614A))|(ORF1a_polyprotein:A4841C(E1614A)) 16 1 141 0.898 24 0.429 100 0.437 28 0.933 9 1 10 1 12 0.8 3 0.5 14 0.667 56 0.348 6 0.462 2 0.003 13 8.474 0.003 8.477
5151 T5151G|(ORF1ab_polyprotein:T4886G(V1629G))|(ORF1a_polyprotein:T4886G(V1629G)) 16 1 143 0.911 26 0.456 97 0.424 28 0.933 9 1 10 1 12 0.8 3 0.5 14 0.667 56 0.348 6 0.462 2 0.004 2 0.004 14 8.501 0.008 8.50899999999999
5183 C5183T|(ORF1ab_polyprotein:C4918T(P1640S))|(ORF1a_polyprotein:C4918T(P1640S)) 9 0.562 83 0.529 3 0.2 7 0.333 30 0.186 3 0.004 2 0.003 3 0.005 8 1.81 0.012 1.822
6402 C6402T|(ORF1ab_polyprotein:C6137T(P2046L))|(ORF1a_polyprotein:C6137T(P2046L)) 2 1 2 1 2 2 0 2
7124 C7124T|(ORF1ab_polyprotein:C6859T(P2287S))|(ORF1a_polyprotein:C6859T(P2287S)) 3 1 2 1 31 0.886 3 1 9 0.643 5 4.529 0 4.529
8662 T8662C|(ORF1ab_polyprotein:T8397C(H2799H))|(ORF1a_polyprotein:T8397C(H2799H)) 2248 0.359 6323 0.993 4291 0.679 3312 0.663 5038 0.992 16290 0.995 2057 0.261 816 0.141 764 0.248 1008 0.204 5306 0.347 3578 0.299 1928 0.333 13 6.514 0 6.514
8915 T8915G|(ORF1ab_polyprotein:T8650G(F2884V))|(ORF1a_polyprotein:T8650G(F2884V)) 26 1 21 1 7 1 2 0.222 25 0.758 35 0.814 15 0.714 5 0.385 7 0.875 44 0.83 10 7.598 0 7.598
8986 C8986T|(ORF1ab_polyprotein:C8721T(D2907D))|(ORF1a_polyprotein:C8721T(D2907D)) 46 1 31 1 15 0.682 2 0.2 6 1 31 0.816 36 0.818 16 0.64 5 0.385 9 0.409 44 0.8 16 0.333 12 8.083 0 8.083
9053 G9053T|(ORF1ab_polyprotein:G8788T(V2930L))|(ORF1a_polyprotein:G8788T(V2930L)) 20 1 10 1 10 0.588 6 1 5 1 16 0.364 6 4.952 0 4.952
9209 G9209A|(ORF1ab_polyprotein:G8944A(E2982K))|(ORF1a_polyprotein:G8944A(E2982K)) 20 1 10 1 9 0.529 2 0.667 7 1 7 1 2 1 5 0.556 3 0.15 16 0.348 10 7.25 0 7.25
9767 A9767G|(ORF1ab_polyprotein:A9502G(N3168D))|(ORF1a_polyprotein:A9502G(N3168D)) 880 0.24 2126 0.538 576 0.571 2 0.001 994 0.581 3 0.001 71 1 340 0.4 354 0.401 70 0.565 78 0.451 47 0.138 10 0.909 410 0.282 229 0.472 332 0.308 5 0.001 17 6.858 0.001 6.859
linked 10029 C10029T|(ORF1ab_polyprotein:C9764T(T3255I))|(ORF1a_polyprotein:C9764T(T3255I)) 432 0.984 3978 0.984 2833 0.981 2682 0.981 2900 0.981 1368 0.972 899 0.99 508 0.994 7 0.7 1726 0.99 2693 0.973 292 0.983 983 0.989 1939 0.985 1139 0.984 6396 0.981 1587 0.984 4186 0.981 5181 0.983 2677 0.985 5901 0.984 2314 0.984 11238 0.981 3275 0.976 6706 0.987 1594 0.985 742 0.988 3 1 1113 0.992 92 0.948 3944 0.982 4584 0.977 3 1 1949 0.988 1404 0.991 35 16.436 17.712 34.1479999999999
10039 C10039T|(ORF1ab_polyprotein:C9774T(T3258T))|(ORF1a_polyprotein:C9774T(T3258T)) 133 0.303 1443 0.357 677 0.234 514 0.188 3 0.001 3 0.002 309 0.177 669 0.242 143 0.481 3 0.003 3 0.002 463 0.4 1638 0.251 2 0.001 12 0.003 9 0.002 9 0.003 10 0.002 22 0.002 12 0.004 13 0.002 5 0.001 15 0.003 4 0.002 2 0.001 25 2.642 0.025 2.667
10253 T10253G|(ORF1ab_polyprotein:T9988G(L3330V))|(ORF1a_polyprotein:T9988G(L3330V)) 1559 0.921 989 0.584 2 0.003 1107 0.975 433 0.986 135 0.556 224 0.926 65 0.956 18 1 12 0.103 27 0.643 139 0.284 142 0.584 2 0.002 3 0.003 11 0.003 11 0.001 2 0.007 4 0.001 19 8.521 0.017 8.538
10295 T10295G|(ORF1ab_polyprotein:T10030G(S3344A))|(ORF1a_polyprotein:T10030G(S3344A)) 1572 0.929 996 0.588 1113 0.98 432 0.984 134 0.551 209 0.864 57 0.838 18 1 12 0.103 28 0.667 145 0.296 136 0.56 4 0.003 4 0.004 5 0.001 2 0.006 5 0.002 17 8.36 0.016 8.376
10646 A10646G|(ORF1ab_polyprotein:A10381G(T3461A))|(ORF1a_polyprotein:A10381G(T3461A)) 407 0.974 3729 0.969 1141 0.644 584 0.504 1388 0.966 2220 0.611 2 0.001 2380 0.939 1101 0.832 336 0.982 7 0.003 237 0.127 465 0.668 322 0.322 3858 0.497 502 0.299 2 0.001 6 0.002 4 0.003 2 0.002 2 0.003 2 0.002 5 0.002 4 0.001 3 0.001 4 0.003 3 0.003 27 9.338 0.023 9.36099999999999
10747 C10747T|(ORF1ab_polyprotein:C10482T(N3494N))|(ORF1a_polyprotein:C10482T(N3494N)) 386 0.992 3436 0.989 1014 0.652 542 0.513 1326 0.988 2000 0.634 60 0.033 25 0.625 2245 0.945 998 0.845 321 0.997 206 0.124 414 0.655 320 0.34 3459 0.499 476 0.301 2 0.002 17 10.132 0.002 10.134
11081 RATG13 T11081G|(ORF1ab_polyprotein:T10816G(L3606V))|(ORF1a_polyprotein:T10816G(L3606V)) 144 1 531 0.56 95 0.96 61 0.16 25 0.09 306 0.146 34 0.047 160 0.238 534 0.634 274 0.429 25 0.49 2 0.02 38 0.155 2 0.014 11 0.193 377 0.164 16 5.3 0 5.3
11201 A11201G|(ORF1ab_polyprotein:A10936G(T3646A))|(ORF1a_polyprotein:A10936G(T3646A)) 149 0.987 976 0.981 147 0.336 96 0.96 338 0.805 1586 0.666 216 0.301 145 0.218 826 0.933 633 0.946 52 1 37 0.146 1004 0.395 233 0.704 14 9.378 0 9.378
11294 T11294C|(ORF1ab_polyprotein:T11029C(F3677L))|(ORF1a_polyprotein:T11029C(F3677L)) 85 0.563 974 0.988 152 0.358 98 0.99 340 0.823 1015 0.438 207 0.295 145 0.224 784 0.893 627 0.95 51 0.981 39 0.159 859 0.354 155 0.473 14 8.48899999999999 0 8.48899999999999
11332 A11332G|(ORF1ab_polyprotein:A11067G(V3689V))|(ORF1a_polyprotein:A11067G(V3689V)) 928 0.996 4521 0.986 140 0.063 1815 0.792 467 0.768 1925 0.884 7332 0.907 849 0.623 290 0.342 980 0.944 646 0.953 67 0.957 34 0.201 104 0.2 38 0.167 707 0.685 1016 0.419 545 0.86 2 0.001 2 0.002 20 11.747 0.003 11.75
11651 C11651T|(ORF1ab_polyprotein:C11386T(L3796F))|(ORF1a_polyprotein:C11386T(L3796F)) 773 0.948 1835 0.477 591 0.257 613 0.315 2873 0.469 159 0.244 68 0.24 127 0.384 15 0.138 16 0.485 286 0.267 15 0.029 12 4.253 0 4.253
12505 T12505C|(ORF1ab_polyprotein:T12240C(Y4080Y))|(ORF1a_polyprotein:T12240C(Y4080Y)) 139 0.288 123 0.197 27 0.964 268 0.713 17 0.034 17 0.029 113 0.039 7 2.264 0 2.264
14408 CTACAAG14408-14414del|(ORF1ab_polyprotein:14144-14150del(4715fs)) 1048 0.673 1966 0.382 23 0.031 179 0.591 771 0.427 557 0.058 5 0.147 553 0.674 59 0.298 423 0.981 606 0.659 1546 0.629 12 5.55 0 5.55
15451 G15451A|(ORF1ab_polyprotein:G15187A(G5063S)) 6 0.667 3 1 5 0.833 9 0.818 4 3.318 0 3.318
15952 C15952A|(ORF1ab_polyprotein:C15688A(L5230I)) 2446 0.996 3892 0.729 5675 0.662 4380 0.995 4494 0.614 352 0.989 4717 0.779 10359 0.794 453 0.54 754 0.245 2 0.002 3931 0.398 6130 0.379 1309 0.171 14 0.001 12 0.001 7 0.003 17 8.293 0.005 8.298
linked 15952 RATG13 C15952T|(ORF1ab_polyprotein:C15688T(L5230L)) 1145 0.215 8 0.001 11 0.001 17 0.002 5 0.001 2779 0.38 855 0.141 1410 0.108 2 0.002 797 0.259 1122 0.162 1182 0.984 2141 0.217 7877 0.487 12 0.001 9 0.001 6328 0.995 17 0.002 8 0.002 9 0.002 9 0.002 20 0.002 3 0.001 6 0.001 7 0.002 24 0.002 5 0.002 21 0.001 4 0.002 29 2.96 1.018 3.97799999999999
16008 T16008G|(ORF1ab_polyprotein:T15744G(I5248M)) 1842 0.308 14 0.002 18 0.002 20 0.002 11 0.002 3111 0.375 1722 0.257 1553 0.108 2 0.002 852 0.252 1242 0.162 1308 0.975 2291 0.213 10347 0.574 16 0.002 36 0.003 13 0.002 11 0.002 8 0.001 20 0.002 7 0.002 10 0.002 15 0.002 5 0.002 6 0.001 9 0.002 17 0.002 25 0.002 15 0.005 18 0.004 29 0.002 5 0.002 32 3.23599999999999 0.038 3.27399999999999
16175 C16175A|(ORF1ab_polyprotein:C15911A(T5304N)) 1373 0.557 5154 0.625 6860 0.669 12 0.001 10 0.002 1769 0.246 109 0.09 123 0.05 4190 0.649 9656 0.736 461 0.514 774 0.247 17 0.002 31 0.025 1943 0.189 4589 0.282 1311 0.162 14 0.001 13 0.002 13 0.002 13 0.002 2 0.003 12 0.001 10 0.002 9 0.001 7 0.001 6 0.002 7 0.001 10 0.002 18 0.002 15 0.001 4 0.001 18 0.001 33 5.046 0.025 5.071
16466 C16466T|(ORF1ab_polyprotein:C16202T(P5401L)) 3853 0.926 1933 0.838 774 0.999 754 0.98 849 0.996 19 0.157 178 0.368 530 0.883 169 0.854 42 0.442 70 0.986 28 0.059 75 0.789 426 0.592 2942 0.882 15 10.751 0 10.751
17178 T17178A|(ORF1ab_polyprotein:T16914A(V5638V)) 5 0.417 14 0.209 21 0.7 47 0.122 6 0.375 5 0.238 2 0.118 7 2.179 0 2.179
18744 RATG13 C18744T|(ORF1ab_polyprotein:C18480T(Y6160Y)) 2153 0.868 672 0.278 636 0.502 227 0.143 3921 0.973 246 0.992 32 0.33 140 0.859 66 0.917 18 0.474 27 0.818 86 0.503 86 0.851 203 0.377 3 0.002 2 0.003 5 0.002 11 0.001 17 0.004 2 0.005 33 0.003 5 0.004 13 0.001 23 8.885 0.025 8.91
19220 C19220T|(ORF1ab_polyprotein:C18956T(A6319V)) 5276 0.663 6875 0.923 22 0.002 2163 0.485 8 0.001 23 0.013 4223 0.466 18 0.75 5064 0.936 10365 0.906 608 0.643 1724 0.701 3 0.001 13 0.01 2662 0.994 17216 0.896 1839 0.525 17 8.915 0 8.915
20407 RATG13 T20407C|(ORF1ab_polyprotein:T20143C(F6715L)) 2572 0.833 6529 0.894 4653 0.734 1094 0.569 5662 0.965 5474 0.988 585 0.987 2588 0.947 2199 0.937 259 0.778 171 0.994 351 0.193 572 0.638 742 0.385 4835 0.694 1635 0.422 3 0.002 17 11.958 0.002 11.96
linked 21618 Delta C21618G|(surface_glycoprotein:C56G(T19R)) 377 1 1016 0.907 134 0.561 207 0.767 513 0.979 667 0.987 4 0.031 3 0.006 626 0.782 934 0.934 27 0.509 58 0.892 120 0.488 649 0.684 313 0.568 150 1 16 10.095 1 11.095
21758 CATGCTATA21758-21766del|(surface_glycoprotein:196-204del(HAI66-68del)) 78 0.987 230 0.97 58 0.806 7 0.292 28 0.519 729 0.952 4 1 3 0.3 6 0.857 2 0.286 5 0.294 2 0.667 17 1 13 8.93 0 8.93
linked 21987 G21987A|(surface_glycoprotein:G425A(G142D)) 4 1 2 1 3 1 3 1 22 1 2 1 17 1 5 1 2 1 3 1 3 1 5 1 12 4 8 12
22008 A22008G|(surface_glycoprotein:A446G(N149S)) 2 1 3 1 3 1 3 3 0 3
22029 Delta AGTTCA22029-22034del|(surface_glycoprotein:GAGTTCAGA466-474GGAdel(EFR156-158Gdel)) 4 1 2 1 3 1 3 1 4 4 0 4
22600 A22600C|(surface_glycoprotein:A1038C(R346S)) 1306 0.702 275 0.33 550 0.642 28 0.483 106 0.311 96 0.449 3 1 12 1 45 0.978 1949 0.898 518 0.728 11 7.521 0 7.521
22812 A22812C|(surface_glycoprotein:A1250C(K417T)) 55 0.764 1807 0.985 319 0.67 509 0.998 599 0.845 73 0.869 491 0.925 170 0.971 121 1 27 0.794 175 0.994 174 0.978 136 0.951 21 1 41 0.872 41 0.482 82 0.943 57 0.648 172 0.864 200 0.885 20 17.438 0 17.438
linkedubiq 22917 Delta T22917G|(surface_glycoprotein:T1355G(L452R)) 76 1 1915 0.987 489 0.972 531 0.985 734 0.985 89 0.957 555 0.979 180 0.978 122 1 34 0.944 182 0.978 181 0.995 149 0.98 21 1 47 0.94 91 0.989 96 0.99 87 0.978 212 1 235 0.992 19 1 118 0.952 45 0.978 10 1 94 1 290 0.986 552 0.989 32 1 1228 0.984 37 0.597 30 0.968 21 1 65 1 12 1 14 1 22 0.957 36 19.629 15.411 35.04
22920 A22920T|(surface_glycoprotein:A1358T(Y453F)) 137 0.071 2 0.004 356 0.478 29 0.806 81 0.435 2 0.011 15 0.099 41 0.446 62 0.633 11 0.052 137 0.578 3 0.002 12 3.613 0.002 3.61499999999999
linked 22995 RATG13,Delta C22995A|(surface_glycoprotein:C1433A(T478K)) 42 0.42 1180 0.587 597 0.99 133 0.221 752 0.989 102 0.981 430 0.687 184 0.984 157 1 42 0.977 124 0.534 133 0.662 107 0.656 21 1 51 1 111 0.982 42 0.424 109 0.991 92 0.314 160 0.618 214 1 203 0.99 59 0.983 859 0.999 96 0.99 422 0.995 564 0.986 151 0.987 1313 0.99 62 0.984 32 1 39 1 80 1 20 1 117 1 96 1 49 1 16 1 38 15.017 17.904 32.921
23056 RATG13 A23056C|(surface_glycoprotein:A1494C(Q498H)) 59 0.602 1795 0.95 297 0.504 479 0.832 530 0.718 59 0.596 460 0.776 122 0.693 141 0.876 27 0.675 158 0.725 164 0.837 138 0.902 18 0.947 35 0.761 39 0.364 77 0.906 60 0.545 209 0.726 207 0.818 20 14.753 0 14.753
23064 A23064C|(surface_glycoprotein:A1502C(N501T)) 17 0.224 811 0.439 296 0.544 97 0.192 255 0.386 61 0.726 305 0.558 120 0.984 140 0.993 3 0.086 99 0.55 84 0.575 18 1 13 0.325 18 0.22 4 0.04 26 0.094 66 0.282 18 8.218 0 8.218
23282 G23282A|(surface_glycoprotein:G1720A(D574N)) 2476 0.691 18 0.367 985 0.326 4255 0.566 6 0.001 1293 0.274 1971 0.377 618 0.998 1111 0.413 6990 0.775 2263 0.341 3170 0.516 4918 0.862 8 0.002 4 0.002 4 0.001 16 6.507 0.005 6.512
23373 C23373T|(surface_glycoprotein:C1811T(T604I)) 8 0.003 1162 0.287 1560 0.336 21 0.002 2254 0.649 19 0.002 14 0.003 3290 0.637 3354 0.542 797 0.961 9 0.003 31 0.003 16 0.002 1034 0.143 15 0.002 7 0.002 15 0.003 12 0.003 11 0.002 16 0.003 2 0.002 44 0.003 16 0.002 6 0.001 26 0.002 6 0.002 12 0.003 6 0.002 8 0.002 8 0.002 30 3.575 0.034 3.609
linked 23403 Delta A23403G|(surface_glycoprotein:A1841G(D614G)) 3036 0.969 3898 0.961 4496 0.968 3 0.429 8930 0.967 3349 0.964 8206 0.968 5211 0.949 3 0.75 3 1 2 0.5 5045 0.976 5926 0.958 660 0.968 801 0.966 2978 0.957 10284 0.958 7172 0.969 6915 0.956 6358 0.963 4093 0.959 5737 0.965 4168 0.97 4848 0.963 2 0.5 5010 0.958 889 0.958 170 0.977 13896 0.959 6567 0.977 5159 0.969 4471 0.975 10489 0.975 7 1 3266 0.967 3630 0.955 2513 0.934 3592 0.948 8 0.889 3232 0.976 40 18.096 18.774 36.87
23523 A23523T|(surface_glycoprotein:A1961T(E654V)) 1499 0.426 2035 0.273 961 0.204 1430 0.27 3246 0.354 1840 0.299 1466 0.258 3 0.001 8 2.084 0.001 2.085
23604 Delta C23604G|(surface_glycoprotein:C2042G(P681R)) 3770 0.932 1397 0.328 423 0.791 3016 0.89 4462 0.576 663 0.151 5726 0.929 5213 0.933 950 0.989 1139 0.927 1358 0.41 7220 0.784 4562 0.666 4871 0.678 5467 0.91 5 0.001 3 0.001 5 0.002 18 10.894 0.004 10.898
24034 RATG13 C24034T|(surface_glycoprotein:C2472T(N824N)) 229 0.541 1298 0.945 201 0.276 276 0.697 252 0.381 347 0.986 137 0.986 115 0.278 346 0.842 177 0.885 6 1 46 1 35 0.972 871 0.731 215 0.911 153 0.544 2 0.005 17 11.975 0.005 11.98
24054 C24054A|(surface_glycoprotein:C2492A(A831D)) 298 0.217 3 0.004 2 0.005 74 0.18 14 0.07 23 0.5 23 0.639 85 0.36 5 0.007 6 0.003 3 0.003 2 0.004 3 0.006 3 0.002 14 1.975 0.025 2
24122 A24122C|(surface_glycoprotein:A2560C(K854Q)) 230 0.544 1272 0.928 204 0.279 274 0.692 2 0.005 243 0.367 337 0.963 136 0.978 114 0.276 348 0.849 178 0.894 6 1 46 1 36 1 862 0.724 207 0.877 150 0.538 5 0.012 7 0.003 3 0.009 3 0.015 2 0.009 4 0.003 2 0.004 2 0.004 2 0.008 2 0.005 2 0.001 28 11.914 0.073 11.987
24362 A24362G|(surface_glycoprotein:A2800G(I934V)) 206 0.995 738 0.425 273 0.337 603 0.565 165 0.405 103 0.327 340 0.364 7 3.418 0 3.418
24410 Delta G24410A|(surface_glycoprotein:G2848A(D950N)) 204 0.986 1543 0.888 5 0.002 496 0.614 720 0.688 820 0.769 327 0.805 306 0.971 514 0.24 613 0.656 3 0.001 2 0.001 4 0.003 2 0.002 14 6.619 0.007 6.62599999999999
25056 A25056T|(surface_glycoprotein:A3494T(D1165V)) 23 0.852 297 0.11 6 0.002 188 0.25 40 0.207 715 0.257 67 0.027 42 0.037 15 0.17 27 0.027 330 0.318 46 0.035 8 0.001 4 0.001 11 0.003 4 0.001 3 0.005 4 0.003 2 0.003 6 0.002 20 2.292 0.019 2.311
25105 A25105C|(surface_glycoprotein:A3543C(K1181N)) 25 0.926 2085 0.759 224 0.291 40 0.196 641 0.394 1234 0.438 2279 0.899 991 0.862 79 0.054 75 0.843 572 0.565 667 0.638 1324 0.995 4 0.001 14 7.86 0.001 7.861
25164 A25164G|(surface_glycoprotein:A3602G(Q1201R)) 712 0.276 30 0.052 66 0.043 519 0.251 1511 0.609 726 0.644 313 0.211 336 0.347 237 0.365 1029 0.794 10 3.592 0 3.592
25469 Delta C25469T|(ORF3a_protein:C77T(S26L)) 25 0.581 413 0.956 159 0.172 247 0.735 12 0.444 80 0.611 283 0.708 134 0.924 38 0.95 73 0.973 8 0.151 84 0.706 893 0.661 37 1 5 0.006 2 0.002 2 0.007 17 9.572 0.015 9.587
25638 C25638T|(ORF3a_protein:C246T(N82N)) 23 0.605 346 0.935 102 0.12 216 0.722 11 0.44 73 0.589 247 0.72 129 0.956 38 0.974 67 0.985 8 0.178 30 0.268 806 0.667 34 1 2 0.008 15 9.159 0.008 9.167
25803 C25803T|(ORF3a_protein:C411T(N137N)) 69 0.896 9 0.18 21 0.344 7 1 9 0.9 128 0.977 16 1 8 1 22 0.88 2 1 12 0.316 91 0.968 2 0.004 13 9.461 0.004 9.465
25936 C25936G|(ORF3a_protein:C544G(H182D)) 70 0.921 28 0.56 24 0.393 7 1 9 0.9 123 0.953 16 1 8 1 22 0.846 2 1 16 0.421 92 0.979 12 9.973 0 9.973
25961 C25961T|(ORF3a_protein:C569T(T190I)) 65 0.404 10 0.006 21 0.024 7 0.016 8 0.013 111 0.14 14 0.875 8 0.096 20 0.163 2 0.011 11 0.018 88 0.603 12 2.369 0 2.369
26129 T26129A|(ORF3a_protein:T737A(I246N)) 20 0.204 5 0.003 5 0.005 4 0.005 52 0.473 69 0.767 105 0.897 5 0.005 2 0.003 6 0.005 7 0.001 5 0.003 10 0.005 5 0.001 4 0.004 5 0.006 3 0.002 17 2.367 0.022 2.389
26287 A26287G|(envelope_protein:A43G(N15D)) 620 0.318 752 0.218 2955 0.524 180 0.541 84 0.512 15 0.938 47 0.255 17 0.074 4 0.003 3 0.002 10 3.383 0.002 3.385
26290 A26290G|(envelope_protein:A46G(S16G)) 620 0.318 756 0.219 3 0.001 2953 0.524 182 0.547 85 0.518 15 0.938 47 0.258 16 0.07 5 0.004 6 0.001 4 0.002 3 0.001 6 0.001 3 0.003 2 0.002 2 0.003 17 3.397 0.013 3.41
26325 G26325T|(envelope_protein:G81T(L27F)) 3 0.004 495 0.254 737 0.214 9 0.004 2928 0.519 141 0.426 85 0.518 15 0.938 44 0.246 17 0.075 4 0.003 3 0.015 2 0.004 2 0.002 3 0.003 15 3.21599999999999 0.009 3.22499999999999
26369 A26369G|(envelope_protein:A125G(Y42C)) 625 0.38 750 0.407 3075 0.578 155 0.654 55 0.64 15 0.938 18 0.346 3 0.097 2 0.001 9 4.04 0.001 4.041
26380 A26380G|(envelope_protein:A136G(I46V)) 628 0.38 763 0.412 3143 0.584 155 0.651 57 0.663 15 0.938 18 0.346 4 0.125 8 4.099 0 4.099
26527 C26527T|(membrane_glycoprotein:C5T(A2V)) 386 0.457 695 0.42 722 0.39 5 0.003 3087 0.572 2 0.012 140 0.583 28 0.326 15 0.938 24 0.329 51 0.981 19 0.594 4 0.026 2 0.001 14 5.631 0.001 5.632
26767 Delta T26767C|(membrane_glycoprotein:T245C(I82T)) 544 0.324 1676 0.284 4400 0.584 3203 0.557 1666 0.986 1680 0.195 2 0.004 1236 0.689 524 0.566 89 0.506 140 0.126 358 0.094 1283 0.807 5613 0.621 3 0.004 10 0.001 8 0.001 7 0.002 15 0.002 5 0.001 20 6.34699999999999 0.007 6.35399999999999
27215 TTGACT27215-27220del|(ORF6_protein:GTTGACTTT13-21GTTdel(VDF5-7Vdel)) 404 0.297 1980 0.983 381 0.325 6 0.002 855 0.846 607 0.818 358 0.582 1012 0.381 2698 0.321 706 0.978 10 5.53299999999999 0 5.53299999999999
27459 G27459T|(ORF7a_protein:G66T(E22D)) 383 0.286 1229 0.613 347 0.343 80 0.099 103 0.165 371 0.14 1749 0.209 294 0.401 3 0.001 9 2.256 0.001 2.257
27638 Delta T27638C|(ORF7a_protein:T245C(V82A)) 10 0.909 5 0.714 28 1 6 0.667 2 1 6 1 6 5.29 0 5.29
linked 27752 Delta C27752T|(ORF7a_protein:C359T(T120I)) 2296 0.932 701 0.326 6 0.006 361 0.236 25 0.005 446 0.987 357 0.899 290 0.848 61 0.592 289 0.501 255 0.669 152 0.492 3541 0.505 1112 0.508 1051 0.196 4 0.001 2 0.002 2 0.001 73 0.493 19 7.506 0.693 8.199
27874 C27874T|(ORF7b:C119T(T40I)) 2375 0.923 700 0.312 2 0.002 363 0.228 6 0.001 459 0.989 379 0.896 306 0.825 64 0.571 104 0.173 270 0.655 144 0.462 3741 0.502 1160 0.505 6 0.001 4 0.009 2 0.001 12 0.001 18 7.044 0.012 7.05599999999999
27936 G27936T|(ORF8_protein:G43T(A15S)) 2371 0.921 696 0.31 4 0.004 18 0.003 459 0.991 2 0.25 362 0.856 309 0.833 66 0.589 274 0.665 144 0.462 3399 0.456 1131 0.492 19 0.003 11 0.003 7 0.005 6 0.005 7 0.005 5 0.003 25 0.002 14 0.003 2 0.001 4 0.007 4 0.007 3 0.002 2 0.004 26 6.832 0.05 6.882
28175 A28175G|(ORF8_protein:A282G(K94K)) 61 0.396 38 0.309 563 0.211 12 0.571 4 0.444 19 0.704 2 0.003 3 0.002 8 2.635 0.005 2.63999999999999
28248 GATTTC28248-28253del|(ORF8_protein:355-360del(DF119-120del)) 2625 0.741 6090 0.952 72 0.014 951 0.423 5496 0.994 8875 0.657 9716 0.993 2804 0.665 2818 0.917 2795 0.911 344 0.587 3006 0.524 1699 0.255 5691 0.594 2196 0.493 15 9.72 0 9.72
28271 Delta A28271-28271del 2638 0.745 6113 0.955 73 0.014 953 0.423 5513 0.996 8915 0.66 9751 0.996 2821 0.669 2831 0.92 2836 0.566 348 0.592 3032 0.528 1714 0.257 5682 0.593 2210 0.496 2 0.001 16 9.41 0.001 9.411
28299 A28299T|(nucleocapsid_phosphoprotein:A26T(Q9L)) 2638 0.726 6073 0.938 12 0.001 80 0.013 21 0.002 972 0.395 5479 0.984 8836 0.637 9743 0.989 2971 0.647 2842 0.914 2829 0.53 345 0.561 2 0.002 3055 0.495 1734 0.24 5673 0.55 2204 0.469 17 0.002 7 0.001 17 0.001 12 0.002 21 0.002 10 0.001 17 0.001 25 0.002 9 0.003 10 0.001 28 9.093 0.016 9.109
linked 28382 RATG13 T28382C|(nucleocapsid_phosphoprotein:T109C(S37P)) 927 0.238 1669 0.228 25 0.003 64 0.01 26 0.003 15 0.006 21 0.003 3054 0.197 22 0.002 3 0.004 1391 0.29 1033 0.307 2117 0.372 3 0.005 4 0.003 18 0.003 37 0.005 43 0.004 15 0.003 38 0.003 27 0.003 17 0.003 37 0.003 17 0.002 24 0.002 17 0.002 31 0.004 51 0.003 8 0.003 19 0.018 45 0.003 15 0.003 16 0.005 10 0.002 30 0.003 35 1.686 0.062 1.748
28916 G28916T|(nucleocapsid_phosphoprotein:G643T(G215C)) 3910 0.581 4548 0.88 12 0.002 5094 0.659 23 0.002 3407 0.496 4174 0.658 8539 0.988 2325 0.345 802 0.348 1483 0.502 5018 0.958 4798 0.953 231 0.971 1459 0.985 6 0.002 2584 0.801 667 0.157 7966 0.649 2403 0.3 15 0.002 6 0.001 27 0.002 14 0.002 24 0.003 4 0.001 6 0.001 3 0.001 6 0.001 16 0.002 23 0.002 13 0.001 4 0.001 33 11.237 0.02 11.257
28934 T28934G|(nucleocapsid_phosphoprotein:T661G(L221V)) 4145 0.57 4247 0.75 24 0.003 5467 0.645 55 0.003 3622 0.483 2309 0.333 9380 0.97 2461 0.342 843 0.343 1590 0.495 5108 0.918 5136 0.941 243 0.96 1536 0.98 12 0.003 2794 0.789 11 0.002 7467 0.555 2563 0.293 38 0.003 26 0.003 11 0.002 14 0.002 63 0.004 20 0.002 30 0.003 8 0.002 15 0.002 7 0.002 5 0.002 9 0.001 36 0.004 72 0.006 79 0.005 8 0.002 36 10.378 0.045 10.423
29370 C29370T|(nucleocapsid_phosphoprotein:C1097T(T366I)) 951 0.487 695 0.258 213 0.236 536 0.485 36 0.092 416 0.809 286 0.316 1649 0.631 5 0.002 2 0.002 2 0.002 11 3.314 0.006 3.32
29402 Delta G29402T|(nucleocapsid_phosphoprotein:G1129T(D377Y)) 1300 0.666 2632 0.979 1167 0.713 197 0.821 1419 0.591 563 0.625 1199 0.985 1055 0.956 363 0.931 45 0.584 418 0.813 2 0.011 701 0.784 2454 0.94 97 0.443 17 0.007 6 0.006 7 0.007 25 0.006 6 0.01 12 0.004 3 0.004 8 0.004 23 10.842 0.048 10.89
29422 G29422T|(nucleocapsid_phosphoprotein:G1149T(P383P)) 930 0.482 1250 0.472 6 0.004 580 0.243 209 0.236 4 0.003 525 0.479 53 0.136 399 0.808 3 0.003 1797 0.7 7 0.003 8 0.008 3 0.003 14 0.003 9 0.003 2 0.003 3 0.026 6 0.003 19 3.566 0.052 3.618
29448 29448-insertTGTTTCTATCT|(nucleocapsid_phosphoprotein:1175insertTGTTTCTATCT(392fs)) 918 0.494 1117 0.444 200 0.255 515 0.482 53 0.145 395 0.814 263 0.305 1868 0.742 8 3.681 0 3.681
29494 GCA29494-29496del|(nucleocapsid_phosphoprotein:TTGCAA1219-1224TTAdel(LQ407-408Ldel)) 156 0.059 235 0.155 563 0.252 198 0.193 425 0.368 157 0.145 101 0.271 282 0.325 199 0.075 9 1.843 0 1.843
29742 Delta G29742T 157 0.994 46 0.939 30 1 291 0.97 11 0.733 7 0.636 8 1 6 1 10 1 137 0.765 25 0.962 11 9.999 0 9.999