NY-12 - Complete Raw Mutation Data

Full TSV data with all sample columns and abundance information
← Back to Dashboard

Complete Mutations Data

This table shows the complete data from the mutations.tsv file exactly as it appears in the source. Scroll horizontally to see all columns.

SRR30865903(532717) SRR30865908(506121) SRR30865911(377261) SRR30865912(365724) SRR30865913(527553) SRR30865914(398601) SRR30865916(347649)
('2024-09-24', '1173448') ('2024-09-24', '923524') ('2024-09-24', '649549') ('2024-09-24', '1227810') ('2024-09-24', '735054') ('2024-09-24', '781885') ('2024-09-24', '894311')
Sequences Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Total samples Positives Sum Negatives Sum Total Sum
119 C119T 1 0.007 8 0.098 2 0.098 0.007 0.10500000000000001
linkedubiq 241 Delta C241T 8657 0.998 5922 0.996 4956 0.996 3909 0.996 7928 0.996 5685 0.996 5466 0.997 7 0.996 5.979 6.975
598 G598A|(ORF1ab_polyprotein:G333A(V111V))|(ORF1a_polyprotein:G333A(V111V)) 3 0.001 18 0.020 1 0.001 3 0.02 0.002 0.022
668 A668T|(ORF1ab_polyprotein:AGT403-405TGG(S135W))|(ORF1a_polyprotein:AGT403-405TGG(S135W)) 8 0.039 1 0.004 2 0.039 0.004 0.043
670 T670G|(ORF1ab_polyprotein:AGT403-405TGG(S135W))|(ORF1a_polyprotein:AGT403-405TGG(S135W)) 8 0.039 1 0.004 2 0.039 0.004 0.043
linkedubiq 670 T670G|(ORF1ab_polyprotein:T405G(S135R))|(ORF1a_polyprotein:T405G(S135R)) 302 1.000 736 0.996 197 0.961 181 1.000 286 0.997 242 0.992 267 0.996 7 0.961 5.981 6.942
830 A830G|(ORF1ab_polyprotein:A565G(N189D))|(ORF1a_polyprotein:A565G(N189D)) 2 0.002 6 0.023 2 0.023 0.002 0.025
linkedubiq 897 C897A|(ORF1ab_polyprotein:C632A(A211D))|(ORF1a_polyprotein:C632A(A211D)) 341 0.997 1171 0.973 254 0.996 244 0.992 465 0.998 293 0.997 646 0.994 7 0.996 5.951 6.946999999999999
989 A989T|(ORF1ab_polyprotein:ACG724-726TCT(T242S))|(ORF1a_polyprotein:ACG724-726TCT(T242S)) 67 0.031 1 0.000 2 0.031 0.0 0.031
991 G991T|(ORF1ab_polyprotein:ACG724-726TCT(T242S))|(ORF1a_polyprotein:ACG724-726TCT(T242S)) 67 0.031 1 0.000 2 0.031 0.0 0.031
1322 G1322T|(ORF1ab_polyprotein:G1057T(G353C))|(ORF1a_polyprotein:G1057T(G353C)) 1 0.001 27 0.034 2 0.034 0.001 0.035
1592 T1592A|(ORF1ab_polyprotein:T1327A(S443T))|(ORF1a_polyprotein:T1327A(S443T)) 1 0.000 58 0.029 2 0.029 0.0 0.029
1662 A1662T|(ORF1ab_polyprotein:A1397T(D466V))|(ORF1a_polyprotein:A1397T(D466V)) 6 0.001 58 0.026 1 0.000 3 0.001 4 0.026 0.002 0.027999999999999997
1911 C1911G|(ORF1ab_polyprotein:C1646G(S549C))|(ORF1a_polyprotein:C1646G(S549C)) 2 0.000 10 0.003 2 0.003 0.0 0.003
2011 T2011G|(ORF1ab_polyprotein:T1746G(D582E))|(ORF1a_polyprotein:T1746G(D582E)) 1 0.000 58 0.103 2 0.103 0.0 0.103
ubiq 2790 C2790T|(ORF1ab_polyprotein:C2525T(T842I))|(ORF1a_polyprotein:C2525T(T842I)) 1085 0.991 1393 0.989 532 0.991 541 0.989 1195 0.992 626 0.994 640 0.994 7 0.991 5.949 6.9399999999999995
2953 T2953C|(ORF1ab_polyprotein:T2688C(D896D))|(ORF1a_polyprotein:T2688C(D896D)) 5 0.043 1 0.043 0 0.043
ubiq 3037 RATG13,Delta C3037T|(ORF1ab_polyprotein:C2772T(F924F))|(ORF1a_polyprotein:C2772T(F924F)) 2592 0.990 3584 0.989 1440 0.988 1257 0.993 2328 0.990 1477 0.991 1367 0.993 7 0.988 5.946 6.933999999999999
3221 C3221-3221del|(ORF1ab_polyprotein:2956-2956del(986fs))|(ORF1a_polyprotein:2956-2956del(986fs)) 15 0.008 1 0.008 0 0.008
3392 G3392A|(ORF1ab_polyprotein:G3127A(A1043T))|(ORF1a_polyprotein:G3127A(A1043T)) 5 0.069 1 0.069 0 0.069
linkedubiq 3431 G3431T|(ORF1ab_polyprotein:G3166T(V1056L))|(ORF1a_polyprotein:G3166T(V1056L)) 1044 0.989 1335 0.993 871 0.990 843 0.940 1867 0.990 792 0.999 1157 0.995 7 0.99 5.906 6.896
3479 G3479A|(ORF1ab_polyprotein:G3214A(A1072T))|(ORF1a_polyprotein:G3214A(A1072T)) 49 0.055 1 0.001 1 0.001 3 0.003 4 0.055 0.005 0.06
ubiq 3565 T3565C|(ORF1ab_polyprotein:T3300C(G1100G))|(ORF1a_polyprotein:T3300C(G1100G)) 168 0.994 403 0.998 127 1.000 83 0.976 134 1.000 87 0.989 191 1.000 7 1.0 5.957 6.957
3723 3723-insertT|(ORF1ab_polyprotein:3458insertT(1153fs))|(ORF1a_polyprotein:3458insertT(1153fs)) 1 0.000 90 0.049 1 0.001 3 0.049 0.001 0.05
3753 G3753T|(ORF1ab_polyprotein:G3488T(R1163I))|(ORF1a_polyprotein:G3488T(R1163I)) 90 0.047 1 0.047 0 0.047
linkedubiq 4184 G4184A|(ORF1ab_polyprotein:G3919A(G1307S))|(ORF1a_polyprotein:G3919A(G1307S)) 503 0.998 569 0.995 484 0.996 670 0.994 606 0.997 446 0.989 282 0.993 7 0.996 5.966 6.962
4233 A4233T|(ORF1ab_polyprotein:A3968T(D1323V))|(ORF1a_polyprotein:A3968T(D1323V)) 1 0.003 23 0.066 2 0.066 0.003 0.069
ubiq 4321 C4321T|(ORF1ab_polyprotein:C4056T(A1352A))|(ORF1a_polyprotein:C4056T(A1352A)) 149 0.993 288 0.990 167 0.982 119 1.000 233 0.991 112 0.991 135 1.000 7 0.982 5.965 6.947
4451 A4451-4451del|(ORF1ab_polyprotein:4186-4186del(1396fs))|(ORF1a_polyprotein:4186-4186del(1396fs)) 2 0.002 48 0.033 1 0.001 3 0.033 0.003 0.036000000000000004
4718 GC4718-4719del|(ORF1ab_polyprotein:4453-4454del(1485fs))|(ORF1a_polyprotein:4453-4454del(1485fs)) 7 0.108 1 0.108 0 0.108
4728 G4728A|(ORF1ab_polyprotein:G4463A(G1488D))|(ORF1a_polyprotein:G4463A(G1488D)) 2 0.001 103 0.036 1 0.000 1 0.000 2 0.001 5 0.036 0.002 0.038
4771 T4771G|(ORF1ab_polyprotein:T4506G(I1502M))|(ORF1a_polyprotein:T4506G(I1502M)) 1 0.000 7 0.002 1 0.000 1 0.000 4 0.002 0.0 0.002
4835 G4835T|(ORF1ab_polyprotein:G4570T(G1524C))|(ORF1a_polyprotein:G4570T(G1524C)) 2 0.001 74 0.026 2 0.001 1 0.000 4 0.026 0.002 0.027999999999999997
5096 A5096T|(ORF1ab_polyprotein:A4831T(N1611Y))|(ORF1a_polyprotein:A4831T(N1611Y)) 43 0.020 1 0.000 1 0.000 1 0.001 4 0.02 0.001 0.021
5392 RATG13 C5392T|(ORF1ab_polyprotein:C5127T(N1709N))|(ORF1a_polyprotein:C5127T(N1709N)) 1 0.001 27 0.024 1 0.001 3 0.024 0.002 0.026000000000000002
5529 G5529A|(ORF1ab_polyprotein:G5264A(C1755Y))|(ORF1a_polyprotein:G5264A(C1755Y)) 6 0.036 1 0.036 0 0.036
ubiq 6183 A6183G|(ORF1ab_polyprotein:A5918G(K1973R))|(ORF1a_polyprotein:A5918G(K1973R)) 599 0.990 824 0.990 550 0.980 313 0.991 655 0.994 345 1.000 526 0.996 7 0.98 5.961 6.941000000000001
6268 RATG13 C6268T|(ORF1ab_polyprotein:C6003T(A2001A))|(ORF1a_polyprotein:C6003T(A2001A)) 1 0.001 12 0.020 2 0.02 0.001 0.021
6378 A6378T|(ORF1ab_polyprotein:A6113T(N2038I))|(ORF1a_polyprotein:A6113T(N2038I)) 4 0.000 2 0.000 6 0.001 1 0.000 3 0.000 2 0.000 2 0.000 7 0.001 0.0 0.001
6427 T6427A|(ORF1ab_polyprotein:T6162A(N2054K))|(ORF1a_polyprotein:T6162A(N2054K)) 4 0.000 5 0.000 7 0.001 2 0.000 2 0.000 2 0.000 6 0.001 0.0 0.001
6436 A6436T|(ORF1ab_polyprotein:A6171T(I2057I))|(ORF1a_polyprotein:A6171T(I2057I)) 4 0.000 3 0.000 5 0.001 1 0.000 1 0.000 1 0.000 2 0.000 7 0.001 0.0 0.001
6512 A6512T|(ORF1ab_polyprotein:A6247T(S2083C))|(ORF1a_polyprotein:A6247T(S2083C)) 1 0.000 2 0.000 8 0.001 3 0.000 1 0.000 5 0.001 0.0 0.001
6720 C6720G|(ORF1ab_polyprotein:C6455G(T2152R))|(ORF1a_polyprotein:C6455G(T2152R)) 33 0.023 1 0.023 0 0.023
6942 T6942C|(ORF1ab_polyprotein:T6677C(L2226P))|(ORF1a_polyprotein:T6677C(L2226P)) 5 0.002 84 0.056 5 0.002 5 0.001 1 0.000 5 0.056 0.005 0.061
6947 A6947C|(ORF1ab_polyprotein:A6682C(N2228H))|(ORF1a_polyprotein:A6682C(N2228H)) 1 0.000 55 0.036 1 0.000 1 0.000 4 0.036 0.0 0.036
7279 C7279T|(ORF1ab_polyprotein:C7014T(F2338F))|(ORF1a_polyprotein:C7014T(F2338F)) 1 0.001 1 0.001 10 0.031 3 0.031 0.002 0.033
7354 G7354T|(ORF1ab_polyprotein:G7089T(W2363C))|(ORF1a_polyprotein:G7089T(W2363C)) 7 0.071 1 0.071 0 0.071
7463 G7463T|(ORF1ab_polyprotein:G7198T(V2400F))|(ORF1a_polyprotein:G7198T(V2400F)) 3 0.000 5 0.001 1 0.000 3 0.001 0.0 0.001
7488 C7488T|(ORF1ab_polyprotein:C7223T(T2408I))|(ORF1a_polyprotein:C7223T(T2408I)) 6 0.001 4 0.001 262 0.047 2 0.000 4 0.001 4 0.001 3 0.001 7 0.047 0.005 0.052
7514 A7514T|(ORF1ab_polyprotein:A7249T(R2417*))|(ORF1a_polyprotein:A7249T(R2417*)) 2 0.000 7 0.001 2 0.000 2 0.000 4 0.001 0.0 0.001
7670 G7670A|(ORF1ab_polyprotein:G7405A(V2469I))|(ORF1a_polyprotein:G7405A(V2469I)) 6 0.012 1 0.012 0 0.012
ubiq 7842 A7842G|(ORF1ab_polyprotein:A7577G(N2526S))|(ORF1a_polyprotein:A7577G(N2526S)) 62 0.984 100 0.962 39 1.000 34 0.971 75 0.949 65 0.985 119 0.992 7 1.0 5.843 6.843
8023 T8023A|(ORF1ab_polyprotein:T7758A(V2586V))|(ORF1a_polyprotein:T7758A(V2586V)) 1 0.000 13 0.005 1 0.000 3 0.005 0.0 0.005
ubiq 8293 C8293T|(ORF1ab_polyprotein:C8028T(T2676T))|(ORF1a_polyprotein:C8028T(T2676T)) 1981 0.993 1332 0.996 642 0.997 905 0.962 2430 0.991 1176 0.991 947 0.997 7 0.997 5.93 6.927
8321 C8321A|(ORF1ab_polyprotein:C8056A(R2686S))|(ORF1a_polyprotein:C8056A(R2686S)) 2 0.001 7 0.011 1 0.000 3 0.011 0.001 0.012
ubiq 8393 G8393A|(ORF1ab_polyprotein:G8128A(A2710T))|(ORF1a_polyprotein:G8128A(A2710T)) 117 1.000 191 0.941 96 1.000 91 0.948 139 1.000 75 0.974 155 1.000 7 1.0 5.8629999999999995 6.8629999999999995
8947 C8947T|(ORF1ab_polyprotein:C8682T(N2894N))|(ORF1a_polyprotein:C8682T(N2894N)) 11 0.064 1 0.064 0 0.064
9251 G9251T|(ORF1ab_polyprotein:G8986T(V2996F))|(ORF1a_polyprotein:G8986T(V2996F)) 1 0.000 149 0.076 1 0.000 1 0.000 4 0.076 0.0 0.076
9286 RATG13 C9286T|(ORF1ab_polyprotein:C9021T(N3007N))|(ORF1a_polyprotein:C9021T(N3007N)) 1 0.001 2 0.001 140 0.072 3 0.002 1 0.000 2 0.002 6 0.072 0.006 0.078
9290 G9290T|(ORF1ab_polyprotein:G9025T(D3009Y))|(ORF1a_polyprotein:G9025T(D3009Y)) 3 0.001 73 0.037 1 0.001 2 0.000 2 0.002 5 0.037 0.004 0.040999999999999995
linkedubiq 9344 C9344T|(ORF1ab_polyprotein:C9079T(L3027F))|(ORF1a_polyprotein:C9079T(L3027F)) 1418 0.997 3035 0.993 1944 0.995 1967 0.995 4269 0.993 2446 0.995 1208 0.996 7 0.995 5.969 6.964
ubiq 9424 A9424G|(ORF1ab_polyprotein:A9159G(V3053V))|(ORF1a_polyprotein:A9159G(V3053V)) 3 1.000 4 1.000 6 1.000 6 1.000 2 1.000 5 1.000 6 1.0 5.0 6.0
ubiq 9534 C9534T|(ORF1ab_polyprotein:C9269T(T3090I))|(ORF1a_polyprotein:C9269T(T3090I)) 4528 0.995 5521 0.993 3161 0.991 2347 0.994 5253 0.993 3586 0.994 3552 0.989 7 0.991 5.958 6.949
9738 G9738C|(ORF1ab_polyprotein:G9473C(S3158T))|(ORF1a_polyprotein:G9473C(S3158T)) 6 0.003 1 0.003 0 0.003
9774 9774-insertT|(ORF1ab_polyprotein:9509insertT(3170fs))|(ORF1a_polyprotein:9509insertT(3170fs)) 59 0.026 1 0.026 0 0.026
linked 9883 A9883G|(ORF1ab_polyprotein:A9618G(R3206R))|(ORF1a_polyprotein:A9618G(R3206R)) 4 0.001 11 0.004 62 0.026 4 0.003 7 0.002 4 0.002 7 0.003 7 0.026 0.015 0.040999999999999995
ubiq 10029 C10029T|(ORF1ab_polyprotein:C9764T(T3255I))|(ORF1a_polyprotein:C9764T(T3255I)) 1278 0.997 1753 0.994 1240 0.992 631 0.901 1614 0.998 971 0.999 783 0.990 7 0.992 5.879 6.8709999999999996
10043 G10043C|(ORF1ab_polyprotein:G9778C(A3260P))|(ORF1a_polyprotein:G9778C(A3260P)) 29 0.023 1 0.023 0 0.023
ubiq 10198 C10198T|(ORF1ab_polyprotein:C9933T(D3311D))|(ORF1a_polyprotein:C9933T(D3311D)) 16 1.000 20 0.952 12 1.000 13 1.000 13 1.000 18 1.000 10 1.000 7 1.0 5.952 6.952
ubiq 10447 RATG13 G10447A|(ORF1ab_polyprotein:G10182A(R3394R))|(ORF1a_polyprotein:G10182A(R3394R)) 493 0.986 1021 0.990 343 0.997 438 0.991 487 0.996 437 0.995 1017 0.993 7 0.997 5.951 6.9479999999999995
ubiq 10449 C10449A|(ORF1ab_polyprotein:C10184A(P3395H))|(ORF1a_polyprotein:C10184A(P3395H)) 495 0.990 1024 0.993 340 0.988 440 0.995 488 0.998 433 0.986 1020 0.996 7 0.988 5.958 6.946
10659 T10659-10659del|(ORF1ab_polyprotein:10394-10394del(3465fs))|(ORF1a_polyprotein:10394-10394del(3465fs)) 1 0.000 14 0.003 1 0.000 1 0.000 4 0.003 0.0 0.003
10778 C10778G|(ORF1ab_polyprotein:C10513G(L3505V))|(ORF1a_polyprotein:C10513G(L3505V)) 10 0.009 1 0.001 2 0.009 0.001 0.009999999999999998
10886 G10886-10886del|(ORF1ab_polyprotein:10621-10621del(3541fs))|(ORF1a_polyprotein:10621-10621del(3541fs)) 8 0.008 1 0.008 0 0.008
11020 RATG13 C11020T|(ORF1ab_polyprotein:C10755T(L3585L))|(ORF1a_polyprotein:C10755T(L3585L)) 5 0.056 1 0.056 0 0.056
linkedubiq 11042 G11042T|(ORF1ab_polyprotein:G10777T(V3593F))|(ORF1a_polyprotein:G10777T(V3593F)) 10689 0.988 9369 0.987 11043 0.980 8235 0.986 14504 0.990 12408 0.989 2835 0.985 7 0.98 5.925 6.904999999999999
11056 T11056A|(ORF1ab_polyprotein:T10791A(S3597R))|(ORF1a_polyprotein:T10791A(S3597R)) 3 0.000 4 0.000 7 0.001 1 0.000 3 0.000 1 0.000 6 0.001 0.0 0.001
11061 A11061-11061del|(ORF1ab_polyprotein:10796-10796del(3599fs))|(ORF1a_polyprotein:10796-10796del(3599fs)) 1 0.000 7 0.001 1 0.000 3 0.001 0.0 0.001
11098 T11098G|(ORF1ab_polyprotein:T10833G(F3611L))|(ORF1a_polyprotein:T10833G(F3611L)) 4 0.000 2 0.000 6 0.001 2 0.000 6 0.000 2 0.000 6 0.001 0.0 0.001
11160 A11160T|(ORF1ab_polyprotein:A10895T(K3632M))|(ORF1a_polyprotein:A10895T(K3632M)) 2 0.000 3 0.000 6 0.001 3 0.000 6 0.000 2 0.000 6 0.001 0.0 0.001
11177 T11177G|(ORF1ab_polyprotein:T10912G(L3638V))|(ORF1a_polyprotein:T10912G(L3638V)) 2 0.000 2 0.000 6 0.001 5 0.000 1 0.000 5 0.001 0.0 0.001
11188 A11188C|(ORF1ab_polyprotein:A10923C(L3641F))|(ORF1a_polyprotein:A10923C(L3641F)) 4 0.000 4 0.000 8 0.001 1 0.000 2 0.000 3 0.000 6 0.001 0.0 0.001
11208 C11208A|(ORF1ab_polyprotein:C10943A(A3648D))|(ORF1a_polyprotein:C10943A(A3648D)) 5 0.000 4 0.000 8 0.001 1 0.000 7 0.000 4 0.000 6 0.001 0.0 0.001
ubiq 11288 TCTGGTTTT11288-11296del|(ORF1ab_polyprotein:11023-11031del(SGF3675-3677del))|(ORF1a_polyprotein:11023-11031del(SGF3675-3677del)) 274 0.993 310 0.994 153 0.981 154 0.987 433 0.977 290 0.997 331 1.000 7 0.981 5.948 6.929
11410 G11410A|(ORF1ab_polyprotein:G11145A(L3715L))|(ORF1a_polyprotein:G11145A(L3715L)) 1 0.000 1 0.000 5 0.003 1 0.000 1 0.000 5 0.003 0.0 0.003
11623 A11623-11623del|(ORF1ab_polyprotein:11358-11358del(3786fs))|(ORF1a_polyprotein:11358-11358del(3786fs)) 9 0.005 1 0.005 0 0.005
ubiq 11727 G11727A|(ORF1ab_polyprotein:G11462A(R3821K))|(ORF1a_polyprotein:G11462A(R3821K)) 2240 0.995 1911 0.972 1791 0.996 1487 0.979 2044 0.993 2537 0.993 1314 0.989 7 0.996 5.921 6.917
12469 C12469A|(ORF1ab_polyprotein:C12204A(A4068A))|(ORF1a_polyprotein:C12204A(A4068A)) 3 0.002 85 0.042 1 0.000 3 0.001 2 0.001 5 0.042 0.004 0.046
12741 C12741T|(ORF1ab_polyprotein:C12476T(T4159I))|(ORF1a_polyprotein:C12476T(T4159I)) 1 0.000 5 0.001 207 0.088 2 0.001 4 0.001 2 0.000 1 0.001 7 0.088 0.004 0.092
12781 C12781T|(ORF1ab_polyprotein:C12516T(Y4172Y))|(ORF1a_polyprotein:C12516T(Y4172Y)) 4 0.001 13 0.002 261 0.111 2 0.001 4 0.001 1 0.000 6 0.111 0.005 0.116
linkedubiq 12789 C12789T|(ORF1ab_polyprotein:C12524T(T4175I))|(ORF1a_polyprotein:C12524T(T4175I)) 4461 0.993 5891 0.994 2352 0.995 2961 0.991 5270 0.991 5063 0.994 1877 0.987 7 0.995 5.95 6.945
linkedubiq 12815 RATG13 C12815T|(ORF1ab_polyprotein:C12550T(L4184L))|(ORF1a_polyprotein:C12550T(L4184L)) 4432 0.993 5884 0.995 2341 0.995 2923 0.988 5253 0.995 5022 0.993 1887 0.998 7 0.995 5.962 6.957
ubiq 12880 C12880T|(ORF1ab_polyprotein:C12615T(I4205I))|(ORF1a_polyprotein:C12615T(I4205I)) 9 1.000 18 0.947 10 1.000 6 1.000 7 1.000 5 1.000 8 1.000 7 1.0 5.947 6.947
13226 13226-insertT|(ORF1ab_polyprotein:12961insertT(4321fs))|(ORF1a_polyprotein:12961insertT(4321fs)) 32 0.015 1 0.015 0 0.015
ubiq 13339 T13339C|(ORF1ab_polyprotein:T13074C(N4358N))|(ORF1a_polyprotein:T13074C(N4358N)) 2464 0.998 2684 0.995 2017 0.996 1627 0.970 2548 0.993 1652 0.995 1887 0.994 7 0.996 5.945 6.941000000000001
13549 A13549T|(ORF1ab_polyprotein:A13285T(I4429F)) 1 0.002 10 0.036 2 0.036 0.002 0.038
14166 G14166T|(ORF1ab_polyprotein:G13902T(M4634I)) 7 0.051 1 0.004 2 0.051 0.004 0.05499999999999999
14312 A14312T|(ORF1ab_polyprotein:A14048T(D4683V)) 7 0.020 1 0.02 0 0.02
14352 C14352T|(ORF1ab_polyprotein:C14088T(D4696D)) 22 0.069 1 0.002 1 0.002 3 0.069 0.004 0.07300000000000001
linkedubiq 14408 Delta C14408T|(ORF1ab_polyprotein:C14144T(P4715L)) 546 0.991 729 0.993 317 0.991 504 0.994 461 0.991 395 0.992 504 0.998 7 0.991 5.959 6.949999999999999
14710 G14710C|(ORF1ab_polyprotein:G14446C(V4816L)) 5 0.002 1 0.002 0 0.002
14729 A14729T|(ORF1ab_polyprotein:A14465T(K4822M)) 1 0.000 5 0.002 1 0.000 3 0.002 0.0 0.002
15703 ATG15703-15705del|(ORF1ab_polyprotein:15439-15441del(M5147del)) 49 0.038 1 0.038 0 0.038
linkedubiq 15714 RATG13 C15714T|(ORF1ab_polyprotein:C15450T(L5150L)) 1007 0.988 1825 0.993 1281 0.992 1107 0.996 1749 0.993 978 0.993 555 0.998 7 0.992 5.961 6.953
linkedubiq 15756 T15756A|(ORF1ab_polyprotein:T15492A(S5164S)) 1390 0.994 2385 0.975 1775 0.993 1455 0.953 2474 0.993 1624 0.991 889 0.948 7 0.993 5.854 6.847
15850 G15850-15850del|(ORF1ab_polyprotein:15586-15586del(5196fs)) 30 0.058 1 0.058 0 0.058
15850 G15850T|(ORF1ab_polyprotein:G15586T(D5196Y)) 25 0.049 1 0.049 0 0.049
16031 T16031C|(ORF1ab_polyprotein:T15767C(I5256T)) 1 0.001 24 0.042 2 0.003 2 0.001 4 0.042 0.005 0.047
16476 T16476-16476del|(ORF1ab_polyprotein:16212-16212del(5404fs)) 35 0.036 2 0.002 2 0.036 0.002 0.038
16658 C16658A|(ORF1ab_polyprotein:C16394A(T5465N)) 7 0.048 1 0.004 2 0.048 0.004 0.052000000000000005
16733 C16733A|(ORF1ab_polyprotein:C16469A(S5490*)) 1 0.000 2 0.000 6 0.001 2 0.000 2 0.000 1 0.000 1 0.000 7 0.001 0.0 0.001
16832 C16832-16832del|(ORF1ab_polyprotein:16568-16568del(5523fs)) 1 0.000 1 0.000 5 0.001 1 0.000 4 0.001 0.0 0.001
17291 T17291A|(ORF1ab_polyprotein:T17027A(L5676*)) 1 0.000 9 0.002 1 0.000 2 0.000 1 0.000 5 0.002 0.0 0.002
17372 C17372-17372del|(ORF1ab_polyprotein:17108-17108del(5703fs)) 1 0.000 6 0.001 1 0.000 3 0.000 1 0.000 5 0.001 0.0 0.001
ubiq 17410 C17410T|(ORF1ab_polyprotein:C17146T(R5716C)) 198 0.980 375 0.997 200 0.995 164 0.965 489 0.992 240 0.996 374 0.984 7 0.995 5.914 6.909
17482 A17482T|(ORF1ab_polyprotein:A17218T(T5740S)) 11 0.000 5 0.000 9 0.001 8 0.000 9 0.000 7 0.000 6 0.000 7 0.001 0.0 0.001
17519 T17519G|(ORF1ab_polyprotein:T17255G(L5752R)) 15 0.000 3 0.000 12 0.001 4 0.000 9 0.000 5 0.000 6 0.000 7 0.001 0.0 0.001
17527 A17527T|(ORF1ab_polyprotein:A17263T(T5755S)) 6 0.000 3 0.000 18 0.001 8 0.000 4 0.000 3 0.000 5 0.000 7 0.001 0.0 0.001
17581 G17581T|(ORF1ab_polyprotein:G17317T(V5773F)) 8 0.000 1 0.000 193 0.013 4 0.000 6 0.000 3 0.000 2 0.000 7 0.013 0.0 0.013
17582 T17582A|(ORF1ab_polyprotein:T17318A(V5773D)) 13 0.000 6 0.000 8 0.001 5 0.000 6 0.000 4 0.000 5 0.000 7 0.001 0.0 0.001
17598 T17598-17598del|(ORF1ab_polyprotein:17334-17334del(5778fs)) 6 0.000 3 0.000 621 0.042 4 0.000 7 0.000 3 0.000 4 0.000 7 0.042 0.0 0.042
17611 A17611T|(ORF1ab_polyprotein:A17347T(N5783Y)) 12 0.000 6 0.000 8 0.001 8 0.000 10 0.000 4 0.000 3 0.000 7 0.001 0.0 0.001
17647 T17647A|(ORF1ab_polyprotein:T17383A(C5795S)) 8 0.000 5 0.000 8 0.001 1 0.000 4 0.000 6 0.000 1 0.000 7 0.001 0.0 0.001
ubiq 18163 A18163G|(ORF1ab_polyprotein:A17899G(I5967V)) 5603 0.996 3855 0.997 3713 0.995 4428 0.998 7512 0.995 3743 0.995 3314 0.995 7 0.995 5.976 6.971
ubiq 18492 A18492G|(ORF1ab_polyprotein:A18228G(P6076P)) 601 0.998 1030 0.999 327 0.991 409 0.953 509 0.994 479 0.994 169 0.994 7 0.991 5.932 6.923
18581 T18581A|(ORF1ab_polyprotein:T18317A(V6106D)) 3 0.001 1 0.000 36 0.028 1 0.000 3 0.001 5 0.028 0.002 0.03
18612 G18612T|(ORF1ab_polyprotein:G18348T(E6116D)) 75 0.079 2 0.001 2 0.001 3 0.079 0.002 0.081
linked 18657 RATG13 C18657T|(ORF1ab_polyprotein:C18393T(T6131T)) 31 0.016 103 0.040 75 0.079 195 0.120 354 0.200 1 0.001 184 0.085 7 0.079 0.462 0.541
ubiq 18894 C18894T|(ORF1ab_polyprotein:C18630T(C6210C)) 2265 0.995 2895 0.990 1424 0.975 1915 0.941 2222 0.996 2077 0.992 1786 0.996 7 0.975 5.91 6.885
19291 A19291G|(ORF1ab_polyprotein:A19027G(S6343G)) 1 0.004 8 0.055 2 0.055 0.004 0.059
19350 TAA19350-19352del|(ORF1ab_polyprotein:GTTAAT19084-19089GTTdel(VN6362-6363Vdel)) 71 0.041 1 0.041 0 0.041
19898 C19898A|(ORF1ab_polyprotein:C19634A(P6545Q)) 3 0.000 2 0.000 5 0.001 1 0.000 5 0.000 3 0.000 1 0.000 7 0.001 0.0 0.001
19912 A19912T|(ORF1ab_polyprotein:A19648T(T6550S)) 1 0.000 2 0.000 7 0.001 2 0.000 4 0.000 1 0.000 1 0.000 7 0.001 0.0 0.001
19943 C19943G|(ORF1ab_polyprotein:C19679G(A6560G)) 1 0.000 1 0.000 8 0.001 1 0.000 2 0.000 1 0.000 6 0.001 0.0 0.001
ubiq 19955 C19955T|(ORF1ab_polyprotein:C19691T(T6564I)) 9711 0.994 8812 0.995 7009 0.994 6244 0.993 10794 0.995 7641 0.994 6778 0.994 7 0.994 5.965 6.959
19998 A19998T|(ORF1ab_polyprotein:A19734T(R6578S)) 4 0.000 3 0.000 5 0.001 2 0.000 1 0.000 5 0.001 0.0 0.001
20012 T20012A|(ORF1ab_polyprotein:T19748A(V6583E)) 3 0.000 4 0.000 5 0.001 3 0.000 3 0.000 5 0.001 0.0 0.001
ubiq 20055 A20055G|(ORF1ab_polyprotein:A19791G(E6597E)) 9152 0.938 8824 0.993 7001 0.992 6232 0.993 10759 0.994 7626 0.994 6828 0.996 7 0.992 5.9079999999999995 6.8999999999999995
20318 A20318T|(ORF1ab_polyprotein:A20054T(E6685V)) 2 0.000 1 0.000 8 0.001 1 0.000 2 0.000 5 0.001 0.0 0.001
20387 A20387G|(ORF1ab_polyprotein:A20123G(K6708R)) 1 0.001 10 0.023 2 0.023 0.001 0.024
20430 T20430G|(ORF1ab_polyprotein:T20166G(P6722P)) 2 0.000 4 0.000 5 0.001 2 0.000 3 0.000 4 0.000 1 0.000 7 0.001 0.0 0.001
20503 A20503C|(ORF1ab_polyprotein:A20239C(I6747L)) 1 0.000 22 0.003 2 0.000 3 0.003 0.0 0.003
20528 T20528A|(ORF1ab_polyprotein:T20264A(V6755D)) 3 0.000 1 0.000 6 0.001 2 0.000 2 0.000 2 0.000 6 0.001 0.0 0.001
20592 T20592A|(ORF1ab_polyprotein:T20328A(Y6776*)) 2 0.000 2 0.000 7 0.001 1 0.000 1 0.000 2 0.000 6 0.001 0.0 0.001
20696 A20696T|(ORF1ab_polyprotein:A20432T(N6811I)) 3 0.000 5 0.000 5 0.001 1 0.000 2 0.000 4 0.000 1 0.000 7 0.001 0.0 0.001
20703 C20703G|(ORF1ab_polyprotein:C20439G(Y6813*)) 1 0.000 3 0.000 5 0.001 2 0.000 2 0.000 3 0.000 6 0.001 0.0 0.001
20819 T20819A|(ORF1ab_polyprotein:T20555A(L6852*)) 4 0.000 5 0.000 7 0.001 4 0.000 2 0.000 5 0.000 6 0.001 0.0 0.001
20833 T20833-20833del|(ORF1ab_polyprotein:20569-20569del(6857fs)) 1 0.000 4 0.000 5 0.001 1 0.000 1 0.000 3 0.000 3 0.000 7 0.001 0.0 0.001
20865 20865-insertT|(ORF1ab_polyprotein:20601insertT(6867fs)) 14 0.002 1 0.002 0 0.002
20872 G20872C|(ORF1ab_polyprotein:G20608C(A6870P)) 1 0.000 9 0.001 1 0.000 1 0.000 4 0.001 0.0 0.001
20997 T20997A|(ORF1ab_polyprotein:T20733A(G6911G)) 2 0.000 5 0.000 5 0.001 1 0.000 3 0.000 1 0.000 1 0.000 7 0.001 0.0 0.001
21019 G21019T|(ORF1ab_polyprotein:G20755T(A6919S)) 1 0.000 2 0.000 5 0.001 1 0.000 5 0.000 5 0.001 0.0 0.001
21040 A21040T|(ORF1ab_polyprotein:A20776T(I6926F)) 1 0.000 3 0.000 5 0.001 2 0.000 6 0.000 3 0.000 1 0.000 7 0.001 0.0 0.001
21050 T21050A|(ORF1ab_polyprotein:T20786A(M6929K)) 2 0.000 6 0.000 7 0.001 4 0.000 2 0.000 4 0.000 6 0.001 0.0 0.001
21063 G21063T|(ORF1ab_polyprotein:G20799T(K6933N)) 2 0.000 1 0.000 6 0.001 3 0.000 3 0.000 3 0.000 2 0.000 7 0.001 0.0 0.001
21101 G21101T|(ORF1ab_polyprotein:G20837T(G6946V)) 4 0.000 4 0.000 6 0.001 4 0.000 1 0.000 3 0.000 6 0.001 0.0 0.001
21102 T21102G|(ORF1ab_polyprotein:T20838G(G6946G)) 3 0.000 3 0.000 5 0.001 5 0.000 4 0.000 6 0.000 1 0.000 7 0.001 0.0 0.001
21127 A21127C|(ORF1ab_polyprotein:A20863C(I6955L)) 2 0.000 5 0.001 1 0.000 1 0.000 1 0.000 5 0.001 0.0 0.001
21127 A21127T|(ORF1ab_polyprotein:A20863T(I6955L)) 5 0.000 5 0.001 3 0.000 3 0.000 6 0.000 2 0.000 6 0.001 0.0 0.001
21129 A21129T|(ORF1ab_polyprotein:A20865T(I6955I)) 1 0.000 5 0.001 3 0.000 5 0.000 6 0.000 5 0.001 0.0 0.001
21131 A21131C|(ORF1ab_polyprotein:A20867C(Q6956P)) 1 0.000 4 0.000 6 0.001 1 0.000 3 0.000 3 0.000 1 0.000 7 0.001 0.0 0.001
21136 A21136T|(ORF1ab_polyprotein:A20872T(K6958*)) 1 0.000 6 0.000 5 0.001 2 0.000 4 0.000 1 0.000 2 0.000 7 0.001 0.0 0.001
21272 T21272A|(ORF1ab_polyprotein:T21008A(F7003Y)) 6 0.000 10 0.000 14 0.001 6 0.000 17 0.000 15 0.000 3 0.000 7 0.001 0.0 0.001
21274 T21274A|(ORF1ab_polyprotein:T21010A(L7004I)) 2 0.000 20 0.001 299 0.012 6 0.000 8 0.000 8 0.000 2 0.000 7 0.012 0.001 0.013000000000000001
21362 A21362C|(ORF1ab_polyprotein:A21098C(N7033T)) 4 0.000 2 0.000 21 0.001 3 0.000 5 0.000 7 0.000 3 0.000 7 0.001 0.0 0.001
21373 T21373A|(ORF1ab_polyprotein:T21109A(L7037M)) 6 0.000 4 0.000 13 0.001 9 0.000 13 0.000 15 0.000 10 0.000 7 0.001 0.0 0.001
ubiq 21609 21609-insertTCATGCCGCTGT|(surface_glycoprotein:GTT46-48GTCATGCCGCTGTTTinsert(V16VMPLF)) 397 0.888 695 0.905 390 0.970 274 0.919 254 0.941 392 0.922 433 0.906 7 0.97 5.481 6.451
ubiq 21618 C21618T|(surface_glycoprotein:C56T(T19I)) 442 0.989 761 0.993 398 0.993 298 1.000 270 1.000 407 0.960 472 0.987 7 0.993 5.929 6.922000000000001
ubiq 21622 RATG13 C21622T|(surface_glycoprotein:C60T(T20T)) 447 1.000 733 0.957 401 1.000 297 0.997 269 0.996 422 0.995 475 0.994 7 1.0 5.939 6.939
ubiq 21624 G21624C|(surface_glycoprotein:G62C(R21T)) 445 0.996 761 0.993 393 0.980 285 0.956 270 1.000 420 0.991 476 0.996 7 0.98 5.932 6.912000000000001
ubiq 21633 TACCCCCTG21633-21641del|(surface_glycoprotein:TTACCCCCTGCA70-81TCAdel(LPPA24-27Sdel)) 422 0.944 765 0.999 384 0.958 289 0.970 270 1.000 404 0.953 476 0.996 7 0.958 5.862 6.82
linkedubiq 21711 RATG13 C21711T|(surface_glycoprotein:C149T(S50L)) 403 0.995 942 1.000 399 0.995 343 0.991 371 0.995 417 1.000 532 0.994 7 0.995 5.975 6.97
21742 C21742T|(surface_glycoprotein:C180T(S60S)) 6 0.086 1 0.006 2 0.086 0.006 0.092
linkedubiq 21765 TACATG21765-21770del|(surface_glycoprotein:ATACATGTC202-210ATCdel(IHV68-70Idel)) 76 0.962 340 0.994 67 0.957 96 0.950 151 0.921 76 1.000 159 0.988 7 0.957 5.8149999999999995 6.771999999999999
ubiq 21941 G21941T|(surface_glycoprotein:G379T(V127F)) 2012 0.991 3620 0.994 2413 0.986 2458 0.990 3047 0.993 3261 0.990 4232 0.993 7 0.986 5.951 6.936999999999999
21941 G21941T|(surface_glycoprotein:GTT379-381TAT(V127Y)) 1 0.000 18 0.007 1 0.000 1 0.000 1 0.000 5 0.007 0.0 0.007
21942 T21942A|(surface_glycoprotein:GTT379-381TAT(V127Y)) 1 0.000 18 0.007 1 0.000 1 0.000 1 0.000 5 0.007 0.0 0.007
linkedubiq 21987 G21987A|(surface_glycoprotein:G425A(G142D)) 2057 0.995 3703 0.995 2464 0.996 2521 0.992 3102 0.993 3243 0.981 4257 0.995 7 0.996 5.951 6.946999999999999
linkedubiq 21991 TTA21991-21993del|(surface_glycoprotein:GTTTAT427-432GTTdel(VY143-144Vdel)) 2040 0.990 3678 0.991 2431 0.987 2490 0.986 3088 0.991 3261 0.990 4203 0.986 7 0.987 5.934 6.921
22018 G22018T|(surface_glycoprotein:G456T(W152C)) 1 0.002 6 0.024 2 0.024 0.002 0.026000000000000002
linkedubiq 22031 T22031-22031del|(surface_glycoprotein:TTCAGA469-474TCAGGA(FR157-158SG)) 193 0.990 619 0.994 235 0.983 341 0.991 405 0.993 233 0.979 292 0.964 7 0.983 5.911 6.893999999999999
linkedubiq 22035 22035-insertG|(surface_glycoprotein:TTCAGA469-474TCAGGA(FR157-158SG)) 193 0.990 619 0.994 235 0.983 341 0.991 405 0.993 233 0.979 292 0.964 7 0.983 5.911 6.893999999999999
ubiq 22194 ATT22194-22196del|(surface_glycoprotein:AATTTA631-636ATAdel(NL211-212Idel)) 2203 0.993 2834 0.996 2005 0.996 1622 0.994 2408 0.993 2505 0.986 2047 0.994 7 0.996 5.9559999999999995 6.952
ubiq 22200 T22200G|(surface_glycoprotein:T638G(V213G)) 2219 0.996 2848 0.997 2014 0.994 1627 0.990 2427 0.997 2539 0.995 2062 0.996 7 0.994 5.971 6.965
ubiq 22208 C22208T|(surface_glycoprotein:C646T(L216F)) 2213 0.994 2846 0.996 2011 0.993 1631 0.993 2413 0.991 2533 0.993 2055 0.993 7 0.993 5.96 6.953
22348 T22348G|(surface_glycoprotein:T786G(A262A)) 1 0.000 2 0.000 6 0.001 1 0.000 1 0.000 1 0.000 3 0.000 7 0.001 0.0 0.001
linkedubiq 22353 C22353A|(surface_glycoprotein:C791A(A264D)) 4499 0.989 7090 0.992 4183 0.995 4975 0.987 8925 0.992 5117 0.990 7768 0.991 7 0.995 5.941 6.936
22430 G22430T|(surface_glycoprotein:G868T(D290Y)) 2 0.000 241 0.057 2 0.000 1 0.000 4 0.001 5 0.057 0.001 0.058
ubiq 22556 A22556G|(surface_glycoprotein:A994G(I332V)) 70 0.986 130 0.985 77 1.000 49 0.980 95 0.990 83 0.988 135 1.000 7 1.0 5.929 6.929
ubiq 22577 G22577C|(surface_glycoprotein:GGT1015-1017CAT(G339H)) 70 0.986 130 0.985 76 0.987 50 1.000 94 0.979 82 0.988 135 1.000 7 0.987 5.938 6.925
ubiq 22578 G22578A|(surface_glycoprotein:GGT1015-1017CAT(G339H)) 70 0.986 130 0.985 76 0.987 50 1.000 94 0.979 82 0.988 135 1.000 7 0.987 5.938 6.925
22672 T22672A|(surface_glycoprotein:T1110A(N370K)) 1 0.000 4 0.001 211 0.062 1 0.000 1 0.000 5 0.062 0.001 0.063
linkedubiq 22674 C22674T|(surface_glycoprotein:C1112T(S371F)) 3152 0.996 5008 0.996 3372 0.996 4009 0.996 4176 0.995 2714 0.995 2414 0.997 7 0.996 5.975 6.971
linkedubiq 22679 T22679C|(surface_glycoprotein:T1117C(S373P)) 3149 0.995 4989 0.992 3381 0.999 3918 0.973 4178 0.995 2714 0.995 2409 0.995 7 0.999 5.945 6.944
linkedubiq 22686 C22686T|(surface_glycoprotein:C1124T(S375F)) 3143 0.993 4991 0.992 3358 0.991 3914 0.972 4173 0.994 2714 0.995 2409 0.994 7 0.991 5.9399999999999995 6.930999999999999
22688 A22688C|(surface_glycoprotein:A1126C(T376P)) 1 0.000 1 0.000 6 0.002 1 0.000 1 0.000 5 0.002 0.0 0.002
linkedubiq 22688 A22688G|(surface_glycoprotein:A1126G(T376A)) 3147 0.995 4994 0.993 3362 0.993 4008 0.996 4173 0.994 2713 0.995 2411 0.995 7 0.993 5.968 6.961
22696 G22696T|(surface_glycoprotein:G1134T(K378N)) 1 0.000 213 0.063 2 0.063 0.0 0.063
22712 C22712T|(surface_glycoprotein:C1150T(P384S)) 2 0.001 2 0.000 212 0.064 8 0.002 1 0.000 5 0.064 0.003 0.067
linkedubiq 22775 G22775A|(surface_glycoprotein:G1213A(D405N)) 3083 0.992 4913 0.995 3281 0.994 3789 0.992 4098 0.996 2640 0.993 2294 0.989 7 0.994 5.957 6.951
linked 22819 T22819A|(surface_glycoprotein:T1257A(A419A)) 1 0.056 1 0.059 2 0.041 1 0.030 4 0.056 0.13 0.186
ubiq 22895 G22895C|(surface_glycoprotein:GTT1333-1335CAT(V445H)) 1988 0.990 2280 0.954 2370 0.979 1466 0.900 2448 0.828 1973 0.973 1556 0.989 7 0.979 5.634 6.613
ubiq 22896 RATG13 T22896A|(surface_glycoprotein:GTT1333-1335CAT(V445H)) 1988 0.990 2280 0.954 2370 0.979 1466 0.900 2448 0.828 1973 0.973 1556 0.989 7 0.979 5.634 6.613
ubiq 22898 G22898A|(surface_glycoprotein:G1336A(G446S)) 2001 0.997 2306 0.965 2368 0.978 1621 0.996 2945 0.997 2021 0.997 1565 0.994 7 0.978 5.946 6.9239999999999995
ubiq 22910 A22910G|(surface_glycoprotein:A1348G(N450D)) 2001 0.996 2376 0.994 2417 0.997 1603 0.984 2937 0.994 2016 0.994 1559 0.990 7 0.997 5.952 6.949
ubiq 22916 C22916T|(surface_glycoprotein:CTG1354-1356TGG(L452W)) 1989 0.990 2379 0.995 2377 0.981 1624 0.997 2931 0.992 2017 0.994 1570 0.997 7 0.981 5.965 6.946
ubiq 22917 Delta T22917G|(surface_glycoprotein:CTG1354-1356TGG(L452W)) 1989 0.990 2379 0.995 2377 0.981 1624 0.997 2931 0.992 2017 0.994 1570 0.997 7 0.981 5.965 6.946
ubiq 22926 T22926C|(surface_glycoprotein:T1364C(L455S)) 1967 0.996 2335 0.998 2358 0.978 1612 0.996 2911 0.997 1980 0.989 1528 0.993 7 0.978 5.969 6.947
ubiq 22928 T22928C|(surface_glycoprotein:T1366C(F456L)) 1967 0.996 2281 0.975 2354 0.976 1485 0.918 2670 0.915 1989 0.994 1526 0.992 7 0.976 5.79 6.766
22941 A22941G|(surface_glycoprotein:A1379G(N460S)) 37 0.015 1 0.015 0 0.015
ubiq 22942 T22942A|(surface_glycoprotein:T1380A(N460K)) 1948 0.992 2317 0.991 2314 0.961 1600 0.992 2888 0.992 1985 0.993 1503 0.984 7 0.961 5.944 6.905
ubiq 22992 G22992A|(surface_glycoprotein:G1430A(S477N)) 1969 0.993 2200 0.935 2408 0.995 1635 0.996 2886 0.972 2006 0.995 1506 0.979 7 0.995 5.87 6.865
ubiq 22995 RATG13,Delta C22995A|(surface_glycoprotein:C1433A(T478K)) 1970 0.993 2338 0.994 2408 0.995 1573 0.958 2806 0.945 1940 0.962 1526 0.992 7 0.995 5.843999999999999 6.8389999999999995
ubiq 23005 T23005A|(surface_glycoprotein:T1443A(N481K)) 1927 0.988 2296 0.992 2329 0.974 1595 0.990 2898 0.995 1965 0.990 1510 0.993 7 0.974 5.948 6.922000000000001
ubiq 23008 TGT23008-23010del|(surface_glycoprotein:GGTGTT1444-1449GGTdel(GV482-483Gdel)) 1924 0.986 2295 0.991 2324 0.972 1595 0.990 2882 0.989 1959 0.987 1506 0.989 7 0.972 5.932 6.904
ubiq 23012 RATG13 G23012A|(surface_glycoprotein:G1450A(E484K)) 1940 0.990 2305 0.994 2333 0.975 1598 0.989 2889 0.990 1970 0.989 1513 0.991 7 0.975 5.943 6.917999999999999
23013 A23013C|(surface_glycoprotein:A1451C(E484A)) 40 0.009 1 0.009 0 0.009
ubiq 23018 RATG13 T23018C|(surface_glycoprotein:TTT1456-1458CCT(F486P)) 5286 0.987 4941 0.996 4625 0.988 3540 0.997 6024 0.996 4610 0.997 3649 0.998 7 0.988 5.971 6.959
23018 T23018G|(surface_glycoprotein:TTT1456-1458GCT(F486A)) 40 0.009 1 0.000 2 0.009 0.0 0.009
ubiq 23019 T23019C|(surface_glycoprotein:TTT1456-1458CCT(F486P)) 5286 0.987 4941 0.996 4625 0.988 3540 0.997 6024 0.996 4610 0.997 3649 0.998 7 0.988 5.971 6.959
23019 T23019C|(surface_glycoprotein:TTT1456-1458GCT(F486A)) 40 0.009 1 0.000 2 0.009 0.0 0.009
ubiq 23055 A23055G|(surface_glycoprotein:A1493G(Q498R)) 5396 0.996 4984 0.995 4703 0.997 3572 0.994 6081 0.992 4649 0.994 3679 0.995 7 0.997 5.966 6.963
ubiq 23063 A23063T|(surface_glycoprotein:A1501T(N501Y)) 5382 0.993 4985 0.996 4688 0.994 3572 0.994 6094 0.995 4648 0.994 3686 0.997 7 0.994 5.969 6.963
ubiq 23075 RATG13 T23075C|(surface_glycoprotein:T1513C(Y505H)) 3571 0.997 2786 0.994 2449 0.995 2058 0.998 3336 0.996 2773 0.991 2251 0.998 7 0.995 5.974 6.969
23083 RATG13 A23083T|(surface_glycoprotein:A1521T(P507P)) 6 0.002 1 0.000 2 0.002 0.0 0.002
23148 A23148C|(surface_glycoprotein:A1586C(K529T)) 1 0.000 7 0.003 1 0.000 1 0.000 4 0.003 0.0 0.003
23180 A23180T|(surface_glycoprotein:A1618T(N540Y)) 1 0.000 1 0.000 5 0.001 3 0.000 2 0.000 5 0.001 0.0 0.001
ubiq 23222 G23222A|(surface_glycoprotein:G1660A(E554K)) 5138 0.996 3800 0.990 4174 0.997 2539 0.997 3733 0.996 3182 0.997 3601 0.996 7 0.997 5.9719999999999995 6.968999999999999
ubiq 23271 C23271T|(surface_glycoprotein:C1709T(A570V)) 5082 0.995 3799 0.994 4096 0.995 2485 0.995 3673 0.996 3133 0.995 3516 0.994 7 0.995 5.969 6.964
ubiq 23403 Delta A23403G|(surface_glycoprotein:A1841G(D614G)) 163 0.926 220 0.978 99 0.952 81 0.910 155 0.969 140 0.986 180 0.978 7 0.952 5.747 6.699
ubiq 23423 C23423T|(surface_glycoprotein:C1861T(P621S)) 11473 0.993 10597 0.992 7086 0.993 5952 0.992 6697 0.993 5727 0.988 6551 0.992 7 0.993 5.95 6.9430000000000005
23448 T23448A|(surface_glycoprotein:T1886A(L629H)) 2 0.000 5 0.001 2 0.000 1 0.000 2 0.000 5 0.001 0.0 0.001
23460 G23460T|(surface_glycoprotein:G1898T(W633L)) 2 0.000 1 0.000 5 0.001 1 0.000 1 0.000 1 0.000 6 0.001 0.0 0.001
23511 T23511A|(surface_glycoprotein:T1949A(L650*)) 2 0.000 5 0.000 21 0.003 2 0.000 1 0.000 1 0.000 3 0.000 7 0.003 0.0 0.003
ubiq 23525 C23525T|(surface_glycoprotein:C1963T(H655Y)) 11408 0.993 10401 0.992 7061 0.993 5947 0.995 6632 0.996 5675 0.994 6460 0.994 7 0.993 5.964 6.957000000000001
23535 A23535T|(surface_glycoprotein:A1973T(N658I)) 3 0.000 9 0.001 1 0.000 1 0.000 4 0.001 0.0 0.001
linkedubiq 23599 T23599G|(surface_glycoprotein:T2037G(N679K)) 87 0.989 222 0.991 74 0.987 51 0.981 48 0.980 46 0.807 93 0.989 7 0.987 5.737 6.724
linkedubiq 23604 Delta C23604G|(surface_glycoprotein:C2042G(P681R)) 88 1.000 222 0.991 75 1.000 52 1.000 48 0.980 57 1.000 93 0.989 7 1.0 5.96 6.96
23610 G23610A|(surface_glycoprotein:G2048A(R683Q)) 10 0.127 1 0.127 0 0.127
23680 T23680A|(surface_glycoprotein:T2118A(A706A)) 1 0.000 2 0.001 482 0.149 1 0.000 4 0.149 0.001 0.15
23813 A23813T|(surface_glycoprotein:A2251T(N751Y)) 1 0.000 1 0.000 12 0.004 3 0.004 0.0 0.004
ubiq 23854 C23854A|(surface_glycoprotein:C2292A(N764K)) 966 0.978 1423 0.986 1016 0.978 833 0.978 1158 0.973 1095 0.973 920 0.980 7 0.978 5.868 6.846
ubiq 23948 G23948T|(surface_glycoprotein:G2386T(D796Y)) 5070 0.989 4606 0.994 3200 0.985 4503 0.994 3884 0.995 3507 0.992 3347 0.991 7 0.985 5.955 6.94
23998 A23998T|(surface_glycoprotein:A2436T(P812P)) 2 0.000 2 0.000 5 0.002 1 0.000 1 0.000 1 0.000 6 0.002 0.0 0.002
24183 C24183T|(surface_glycoprotein:C2621T(T874I)) 2 0.004 22 0.051 2 0.051 0.004 0.05499999999999999
24197 G24197T|(surface_glycoprotein:G2635T(A879S)) 14 0.033 1 0.033 0 0.033
24360 A24360C|(surface_glycoprotein:A2798C(K933T)) 6 0.023 1 0.023 0 0.023
24376 T24376C|(surface_glycoprotein:T2814C(L938L)) 8 0.056 1 0.056 0 0.056
linkedubiq 24378 C24378T|(surface_glycoprotein:C2816T(S939F)) 171 0.977 531 0.987 140 0.986 146 0.993 135 1.000 130 0.992 380 0.987 7 0.986 5.936 6.922
linkedubiq 24424 A24424T|(surface_glycoprotein:A2862T(Q954H)) 175 1.000 539 0.996 143 0.993 147 1.000 136 1.000 129 0.977 383 0.997 7 0.993 5.97 6.963
linkedubiq 24469 T24469A|(surface_glycoprotein:T2907A(N969K)) 528 0.987 840 0.991 351 0.994 312 0.990 405 0.988 291 0.957 541 0.994 7 0.994 5.907 6.901
24556 A24556C|(surface_glycoprotein:A2994C(T998T)) 22 0.037 1 0.037 0 0.037
24618 G24618T|(surface_glycoprotein:G3056T(R1019I)) 1 0.001 8 0.012 2 0.012 0.001 0.013000000000000001
24793 T24793A|(surface_glycoprotein:T3231A(T1077T)) 2 0.000 5 0.002 2 0.002 0.0 0.002
ubiq 24990 C24990T|(surface_glycoprotein:C3428T(P1143L)) 120 0.976 127 0.992 35 1.000 35 0.946 69 1.000 30 1.000 79 0.988 7 1.0 5.902 6.902
ubiq 25000 RATG13 C25000T|(surface_glycoprotein:C3438T(D1146D)) 122 0.992 127 0.992 35 1.000 36 0.973 68 0.986 30 1.000 80 1.000 7 1.0 5.943 6.943
linked 25006 C25006T|(surface_glycoprotein:C3444T(F1148F)) 50 0.208 6 0.025 68 0.291 9 0.073 4 0.033 1 0.011 9 0.059 7 0.291 0.409 0.7
25166 G25166C|(surface_glycoprotein:G3604C(E1202Q)) 120 0.191 1 0.191 0 0.191
ubiq 25207 C25207T|(surface_glycoprotein:C3645T(Y1215Y)) 287 0.993 433 0.993 161 0.982 139 0.986 192 0.990 134 0.993 414 0.988 7 0.982 5.943 6.925
linkedubiq 25584 C25584T|(ORF3a_protein:C192T(T64T)) 1337 0.925 962 0.995 1060 0.995 1100 0.991 1376 0.977 766 0.995 956 0.983 7 0.995 5.866 6.861
25595 G25595T|(ORF3a_protein:G203T(R68I)) 1 0.001 1 0.001 63 0.059 3 0.059 0.002 0.061
25866 A25866T|(ORF3a_protein:A474T(I158I)) 3 0.000 1 0.000 5 0.001 2 0.000 2 0.000 1 0.000 1 0.000 7 0.001 0.0 0.001
25888 T25888G|(ORF3a_protein:T496G(S166A)) 3 0.000 1 0.000 5 0.001 4 0.000 1 0.000 5 0.001 0.0 0.001
25918 A25918T|(ORF3a_protein:A526T(T176S)) 1 0.000 2 0.000 5 0.001 1 0.000 3 0.000 2 0.000 6 0.001 0.0 0.001
25981 G25981T|(ORF3a_protein:G589T(V197L)) 2 0.000 5 0.001 1 0.000 1 0.000 4 0.001 0.0 0.001
ubiq 26060 C26060T|(ORF3a_protein:C668T(T223I)) 8 1.000 34 1.000 16 1.000 18 1.000 12 1.000 14 1.000 16 1.000 7 1.0 6.0 7.0
ubiq 26270 C26270T|(envelope_protein:C26T(T9I)) 208 0.986 253 0.996 159 0.994 141 0.979 210 0.991 136 0.986 253 0.996 7 0.994 5.934 6.928
26448 T26448A|(envelope_protein:T204A(S68S)) 11 0.007 1 0.000 2 0.007 0.0 0.007
ubiq 26529 G26529C|(membrane_glycoprotein:G7C(D3H)) 1761 0.985 1970 0.993 1392 0.995 1417 0.991 2024 0.990 1395 0.991 2102 0.989 7 0.995 5.939 6.934
ubiq 26577 C26577G|(membrane_glycoprotein:C55G(Q19E)) 4 1.000 6 1.000 6 1.000 7 1.000 3 0.750 3 1.000 6 1.0 4.75 5.75
ubiq 26610 A26610G|(membrane_glycoprotein:A88G(T30A)) 2 1.000 6 1.000 4 1.000 6 1.000 3 1.000 2 1.000 6 1.0 5.0 6.0
ubiq 26681 C26681T|(membrane_glycoprotein:C159T(F53F)) 202 0.995 220 1.000 140 0.993 143 1.000 136 1.000 110 1.000 178 1.000 7 0.993 5.995 6.988
ubiq 26709 G26709A|(membrane_glycoprotein:G187A(A63T)) 388 0.992 303 1.000 325 0.997 279 0.993 304 1.000 187 0.989 329 0.994 7 0.997 5.968 6.965
26774 G26774A|(membrane_glycoprotein:G252A(M84I)) 5 0.015 1 0.015 0 0.015
ubiq 26833 C26833T|(membrane_glycoprotein:C311T(A104V)) 38 1.000 59 1.000 20 1.000 20 1.000 28 1.000 13 1.000 39 1.000 7 1.0 6.0 7.0
ubiq 26858 C26858T|(membrane_glycoprotein:C336T(F112F)) 38 0.927 58 0.983 20 0.952 20 1.000 28 1.000 13 0.929 38 0.950 7 0.952 5.789 6.741
26950 T26950G|(membrane_glycoprotein:T428G(V143G)) 4 0.000 1 0.000 5 0.001 1 0.000 1 0.000 2 0.000 6 0.001 0.0 0.001
linkedubiq 27259 A27259C|(ORF6_protein:A58C(R20R)) 3637 0.992 3250 0.997 2428 0.993 1936 0.994 2676 0.995 2145 0.994 2902 0.993 7 0.993 5.965 6.958
27297 C27297-27297del|(ORF6_protein:96-96del(32fs)) 70 0.029 1 0.029 0 0.029
ubiq 27382 G27382C|(ORF6_protein:GAT181-183CTC(D61L)) 83 1.000 91 0.989 64 1.000 65 0.985 71 0.910 56 1.000 111 1.000 7 1.0 5.884 6.884
ubiq 27383 A27383T|(ORF6_protein:GAT181-183CTC(D61L)) 83 1.000 91 0.989 64 1.000 65 0.985 71 0.910 56 1.000 111 1.000 7 1.0 5.884 6.884
ubiq 27384 T27384C|(ORF6_protein:GAT181-183CTC(D61L)) 83 1.000 91 0.989 64 1.000 65 0.985 71 0.910 56 1.000 111 1.000 7 1.0 5.884 6.884
27480 A27480C|(ORF7a_protein:A87C(V29V)) 2 0.000 1 0.000 6 0.002 1 0.000 1 0.000 5 0.002 0.0 0.002
27525 A27525T|(ORF7a_protein:A132T(S44S)) 1 0.000 5 0.001 1 0.000 1 0.000 4 0.001 0.0 0.001
27583 G27583T|(ORF7a_protein:G190T(A64S)) 1 0.000 121 0.035 1 0.000 1 0.000 1 0.000 5 0.035 0.0 0.035
27679 C27679T|(ORF7a_protein:C286T(L96F)) 6 0.004 1 0.004 0 0.004
27698 TTA27698-27700del|(ORF7a_protein:CTTATT304-309CTTdel(LI102-103Ldel)) 58 0.041 1 0.041 0 0.041
linkedubiq 27807 C27807T|(ORF7b:C52T(L18L)) 1728 0.989 2125 0.994 1435 0.994 1365 0.996 1937 0.992 1058 0.996 1377 0.991 7 0.994 5.958 6.952
27965 A27965C|(ORF8_protein:A72C(S24S)) 2 0.000 2 0.000 82 0.015 1 0.000 1 0.000 1 0.000 6 0.015 0.0 0.015
28001 G28001T|(ORF8_protein:G108T(P36P)) 1 0.000 4 0.000 174 0.033 3 0.000 5 0.001 1 0.000 6 0.033 0.001 0.034
28017 T28017A|(ORF8_protein:T124A(Y42N)) 1 0.000 1 0.000 6 0.001 1 0.000 2 0.000 1 0.000 1 0.000 7 0.001 0.0 0.001
28088 T28088A|(ORF8_protein:T195A(A65A)) 3 0.000 3 0.000 8 0.002 2 0.000 2 0.000 2 0.000 6 0.002 0.0 0.002
ubiq 28271 A28271T 66257 0.998 36233 0.999 33226 0.999 33918 0.998 52701 0.998 33354 0.998 33919 0.998 7 0.999 5.989 6.9879999999999995
28290 C28290A|(nucleocapsid_phosphoprotein:C17A(P6H)) 22 0.000 10 0.000 206 0.006 10 0.000 14 0.000 10 0.000 15 0.000 7 0.006 0.0 0.006
ubiq 28311 C28311T|(nucleocapsid_phosphoprotein:C38T(P13L)) 66025 0.995 36116 0.996 33077 0.994 33797 0.995 52528 0.995 33207 0.994 33797 0.995 7 0.994 5.97 6.9639999999999995
28342 A28342C|(nucleocapsid_phosphoprotein:A69C(S23S)) 24 0.000 17 0.000 17 0.001 10 0.000 22 0.000 13 0.000 14 0.000 7 0.001 0.0 0.001
ubiq 28362 GAGAACGCA28362-28370del|(nucleocapsid_phosphoprotein:GGAGAACGCAGT88-99GGTdel(GERS30-33Gdel)) 65821 0.993 35999 0.991 32969 0.995 33695 0.993 51225 0.972 33182 0.994 33807 0.994 7 0.995 5.937 6.932
28480 A28480C|(nucleocapsid_phosphoprotein:A207C(G69G)) 1 0.000 1 0.000 5 0.001 2 0.000 1 0.000 1 0.000 6 0.001 0.0 0.001
28513 A28513T|(nucleocapsid_phosphoprotein:A240T(P80P)) 3 0.000 3 0.000 5 0.001 1 0.000 3 0.000 2 0.000 2 0.000 7 0.001 0.0 0.001
28513 AG28513-28514del|(nucleocapsid_phosphoprotein:240-241del(80fs)) 38 0.007 1 0.007 0 0.007
28588 T28588G|(nucleocapsid_phosphoprotein:T315G(S105R)) 1 0.000 2 0.000 7 0.001 1 0.000 1 0.000 3 0.000 2 0.000 7 0.001 0.0 0.001
28734 A28734T|(nucleocapsid_phosphoprotein:A461T(N154I)) 8 0.000 4 0.000 9 0.001 2 0.000 6 0.000 3 0.000 1 0.000 7 0.001 0.0 0.001
28748 C28748A|(nucleocapsid_phosphoprotein:C475A(L159I)) 8 0.000 4 0.000 8 0.001 2 0.000 6 0.000 1 0.000 3 0.000 7 0.001 0.0 0.001
28761 A28761C|(nucleocapsid_phosphoprotein:A488C(Q163P)) 5 0.000 5 0.000 9 0.001 2 0.000 6 0.000 3 0.000 6 0.001 0.0 0.001
28773 T28773G|(nucleocapsid_phosphoprotein:T500G(L167W)) 2 0.000 5 0.000 7 0.001 1 0.000 5 0.000 3 0.000 2 0.000 7 0.001 0.0 0.001
28786 C28786A|(nucleocapsid_phosphoprotein:C513A(F171L)) 2 0.000 5 0.000 7 0.001 2 0.000 7 0.000 3 0.000 5 0.000 7 0.001 0.0 0.001
28788 A28788C|(nucleocapsid_phosphoprotein:A515C(Y172S)) 3 0.000 1 0.000 8 0.001 1 0.000 2 0.000 2 0.000 3 0.000 7 0.001 0.0 0.001
28807 C28807A|(nucleocapsid_phosphoprotein:C534A(G178G)) 15 0.001 4 0.000 338 0.025 4 0.000 10 0.001 3 0.000 7 0.001 7 0.025 0.003 0.028
28807 C28807G|(nucleocapsid_phosphoprotein:C534G(G178G)) 3 0.000 2 0.000 7 0.001 1 0.000 4 0.000 2 0.000 6 0.001 0.0 0.001
28847 A28847T|(nucleocapsid_phosphoprotein:A574T(N192Y)) 4 0.000 2 0.000 9 0.001 1 0.000 3 0.000 2 0.000 1 0.000 7 0.001 0.0 0.001
28850 A28850C|(nucleocapsid_phosphoprotein:A577C(S193R)) 5 0.000 7 0.001 3 0.000 6 0.000 2 0.000 1 0.000 6 0.001 0.0 0.001
28860 A28860T|(nucleocapsid_phosphoprotein:A587T(N196I)) 3 0.000 3 0.000 7 0.001 1 0.000 2 0.000 5 0.000 6 0.001 0.0 0.001
linkedubiq 28881 G28881A|(nucleocapsid_phosphoprotein:AGG607-609AAA(R203K)) 19166 0.991 12042 0.988 13697 0.991 9233 0.991 16533 0.991 7204 0.991 11358 0.991 7 0.991 5.943 6.933999999999999
linkedubiq 28882 G28882A|(nucleocapsid_phosphoprotein:AGG607-609AAA(R203K)) 19166 0.991 12042 0.988 13697 0.991 9233 0.991 16533 0.991 7204 0.991 11358 0.991 7 0.991 5.943 6.933999999999999
linked 28883 G28883C|(nucleocapsid_phosphoprotein:GGA610-612CCA(G204P)) 857 0.044 713 0.059 5220 0.377 1236 0.133 529 0.032 193 0.027 1063 0.093 7 0.377 0.388 0.765
28883 G28883C|(nucleocapsid_phosphoprotein:GGA610-612CGC(G204R)) 2 0.000 2 0.000 8 0.001 2 0.000 1 0.000 2 0.000 6 0.001 0.0 0.001
linked 28884 G28884C|(nucleocapsid_phosphoprotein:GGA610-612CCA(G204P)) 857 0.044 713 0.058 5220 0.377 1236 0.133 529 0.032 193 0.027 1063 0.093 7 0.377 0.387 0.764
28885 A28885C|(nucleocapsid_phosphoprotein:GGA610-612CGC(G204R)) 2 0.000 2 0.000 8 0.001 2 0.000 1 0.000 2 0.000 6 0.001 0.0 0.001
28908 G28908T|(nucleocapsid_phosphoprotein:G635T(G212V)) 7 0.000 2 0.000 21 0.002 1 0.000 2 0.000 1 0.000 6 0.002 0.0 0.002
28910 A28910-28910del|(nucleocapsid_phosphoprotein:637-637del(213fs)) 6 0.000 1 0.000 15 0.001 1 0.000 4 0.000 1 0.000 6 0.001 0.0 0.001
linkedubiq 28958 C28958A|(nucleocapsid_phosphoprotein:C685A(Q229K)) 1085 0.997 905 0.957 344 0.994 585 0.983 798 0.994 470 0.992 757 0.959 7 0.994 5.882 6.8759999999999994
29015 A29015T|(nucleocapsid_phosphoprotein:A742T(K248*)) 8 0.000 9 0.000 10 0.001 4 0.000 3 0.000 3 0.000 1 0.000 7 0.001 0.0 0.001
29087 C29087A|(nucleocapsid_phosphoprotein:C814A(Q272K)) 11 0.000 7 0.000 7 0.001 3 0.000 5 0.000 5 0.000 5 0.000 7 0.001 0.0 0.001
29105 G29105T|(nucleocapsid_phosphoprotein:G832T(G278C)) 12 0.000 7 0.000 8 0.001 2 0.000 6 0.000 4 0.000 5 0.000 7 0.001 0.0 0.001
29133 G29133T|(nucleocapsid_phosphoprotein:G860T(G287V)) 7 0.000 1 0.000 8 0.001 2 0.000 4 0.000 2 0.000 6 0.001 0.0 0.001
29146 A29146-29146del|(nucleocapsid_phosphoprotein:873-873del(291fs)) 2 0.000 2 0.000 12 0.001 3 0.000 2 0.000 5 0.001 0.0 0.001
29449 G29449A|(nucleocapsid_phosphoprotein:G1176A(V392V)) 1 0.001 11 0.087 1 0.005 3 0.087 0.006 0.093
linkedubiq 29510 A29510C|(nucleocapsid_phosphoprotein:A1237C(S413R)) 1547 0.993 2160 0.995 1250 0.994 847 0.991 1494 0.992 1116 0.988 1446 0.983 7 0.994 5.942 6.936
29627 C29627T|(ORF10_protein:C70T(R24C)) 1 0.001 64 0.056 1 0.001 2 0.002 1 0.001 5 0.056 0.005 0.061
29703 G29703A 6 0.045 1 0.045 0 0.045
linkedubiq 29734 GAGGCCACGCGGAGTACGATCGAGTG29734-29759del 287 1.000 478 0.998 132 0.992 188 0.995 94 1.000 200 1.000 184 1.000 7 0.992 5.993 6.985