NY-4 - Complete Raw Mutation Data

Full TSV data with all sample columns and abundance information
← Back to Dashboard

Complete Mutations Data

This table shows the complete data from the mutations.tsv file exactly as it appears in the source. Scroll horizontally to see all columns.

Unnamed: 0 Unnamed: 1 Unnamed: 2 Unnamed: 3 SRR25185957 Unnamed: 5 SRR25404394 Unnamed: 7 SRR25657355 Unnamed: 9 SRR25185892 Unnamed: 11 SRR25185903 Unnamed: 13 SRR25185909 Unnamed: 15 SRR25185970 Unnamed: 17 SRR25185981 Unnamed: 19 SRR25185984 Unnamed: 21 SRR25240887 Unnamed: 23 SRR25240903 Unnamed: 25 SRR25240910 Unnamed: 27 SRR25240913 Unnamed: 29 SRR25240927 Unnamed: 31 SRR25241029 Unnamed: 33 SRR25305201 Unnamed: 35 SRR25305213 Unnamed: 37 SRR25305222 Unnamed: 39 SRR25305237 Unnamed: 41 SRR25305242 Unnamed: 43 SRR25404291 Unnamed: 45 SRR25404387 Unnamed: 47 SRR25404389 Unnamed: 49 SRR25404390 Unnamed: 51 SRR25404391 Unnamed: 53 SRR25404392 Unnamed: 55 SRR25657357 Unnamed: 57 SRR25657379 Unnamed: 59 SRR25657386 Unnamed: 61 SRR25657388 Unnamed: 63 SRR25657389 Unnamed: 65 SRR25657393 Unnamed: 67 SRR25657418 Unnamed: 69 SRR25657440 Unnamed: 71 SRR25657461 Unnamed: 73 SRR25657515 Unnamed: 75 SRR25711567 Unnamed: 77 SRR25788454 Unnamed: 79 Unnamed: 80 Unnamed: 81 Unnamed: 82 Unnamed: 83 Unnamed: 84 Key Unnamed: 86
('2023-06-25/2023-06-26', '848328.0') ('2023-07-04/2023-07-05', '848328.0') ('2023-08-06/2023-08-07', '848328.0') ('2023-06-25/2023-06-26', '1068012.0') ('2023-06-25/2023-06-26', '198128.0') ('2023-06-25/2023-06-26', '410812.0') ('2023-06-25/2023-06-26', '283428.0') ('2023-06-25/2023-06-26', '596326.0') ('2023-06-25/2023-06-26', '728123.0') ('2023-06-25/2023-06-26', '588772.0') ('2023-06-25/2023-06-26', '684569.0') ('2023-06-25/2023-06-26', '244918.0') ('2023-06-25/2023-06-26', '758007.0') ('2023-06-25/2023-06-26', '588772.0') ('2023-06-27/2023-06-28', '90474.0') ('2023-07-02/2023-07-03', '758007.0') ('2023-07-04/2023-07-05', '728123.0') ('2023-07-04/2023-07-05', '244918.0') ('2023-07-02/2023-07-03', '596326.0') ('2023-07-04/2023-07-05', '198128.0') ('2023-07-04/2023-07-05', '1068012.0') ('2023-07-02/2023-07-03', '90474.0') ('2023-07-04/2023-07-05', '410812.0') ('2023-07-04/2023-07-05', '283428.0') ('2023-07-04/2023-07-05', '588772.0') ('2023-07-04/2023-07-05', '588772.0') ('2023-08-06/2023-08-07', '1068012.0') ('2023-08-06/2023-08-07', '90474.0') ('2023-08-06/2023-08-07', '283428.0') ('2023-08-06/2023-08-07', '244918.0') ('2023-08-06/2023-08-07', '198128.0') ('2023-08-06/2023-08-07', '728123.0') ('2023-08-06/2023-08-07', '596326.0') ('2023-08-06/2023-08-07', '684569.0') ('2023-08-06/2023-08-07', '588772.0') ('2023-08-06/2023-08-07', '588772.0') ('2023-08-06/2023-08-07', '758007.0') ('2023-08-08/2023-08-09', '410812.0') Cryptic Sewershed
Linked/Ubiquitous Position Flagged Sequences Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Total samples Positives Sum Negatives Sum Total Sum Non-Cryptic Sewershed
ubiq 405 A405G|(ORF1ab_polyprotein:A140G(K47R))|(ORF1a_polyprotein:A140G(K47R)) 13 1 908 0.991 2152 0.996 552 1 507 0.996 4 1 12 1 211 1 743 0.997 16 0.168 915 0.991 1965 0.997 5 1 770 0.999 685 0.997 4 1 12 1 47 1 74 0.987 3839 0.931 935 0.995 364 0.997 6 1 3 1 644 1 532 1 184 0.995 4909 0.997 157 0.994 1798 0.994 237 0.996 31 2.987 27.031 30.018
ubiq 670 T670G|(ORF1ab_polyprotein:T405G(S135R))|(ORF1a_polyprotein:T405G(S135R)) 52633 0.998 132436 0.873 101098 0.998 50297 0.997 9407 0.997 40196 0.998 25593 0.997 3540 0.997 44648 0.998 54846 0.539 47905 0.993 3486 0.999 166983 0.998 101935 0.998 29316 0.998 48999 0.998 18304 0.998 20637 0.998 1208 0.998 7048 0.998 21021 0.997 48151 0.996 5599 0.998 51856 0.997 7534 0.685 148533 0.998 158393 0.998 77995 0.998 65903 0.998 61528 0.998 67913 0.998 48845 0.998 23466 0.998 86171 0.998 53248 0.998 144439 0.91 10311 0.995 37 2.86899999999999 33.057 35.926
1862 C1862A|(ORF1ab_polyprotein:C1597A(L533I))|(ORF1a_polyprotein:C1597A(L533I)) 13 0.001 495 0.173 114 0.001 35 0.001 41 0.001 4 0.002 44 0.002 147 0.002 12 0.002 180 0.001 67 0.001 6 0.001 42 0.001 42 0.001 4 0.001 4 0.001 50 0.002 5 0.002 102 0.001 9 0.001 17 0.002 43 0.001 60 0.001 90 0.001 13 0.001 23 0.001 22 0.001 49 0.002 28 0.175 0.033 0.208
2113 C2113A|(ORF1ab_polyprotein:C1848A(I616I))|(ORF1a_polyprotein:C1848A(I616I)) 16 0.001 46 0.001 5515 0.115 55 0.001 12 0.002 23 0.001 80 0.001 193 0.002 48 0.001 2 0.001 18 0.002 17 0.001 21 0.001 62 0.002 56 0.001 79 0.001 23 0.001 63 0.001 22 0.001 105 0.001 237 0.002 21 0.117 0.023 0.14
ubiq 3037 RATG13,Delta C3037T|(ORF1ab_polyprotein:C2772T(F924F))|(ORF1a_polyprotein:C2772T(F924F)) 256 1 3853 0.994 854 0.994 2989 0.996 1069 0.997 2188 1 1068 0.992 14 0.933 1095 0.998 2881 0.997 1280 0.995 86 0.989 559 0.996 1022 0.998 75 0.987 98 0.99 958 0.996 789 0.994 12 1 3150 0.999 1876 0.997 307 0.99 2401 0.996 407 0.998 1118 0.991 1226 0.998 1591 0.998 1307 0.997 477 0.973 29 2.988 25.795 28.783
3170 C3170A|(ORF1ab_polyprotein:C2905A(L969I))|(ORF1a_polyprotein:C2905A(L969I)) 188 0.989 6 0.002 2 0.003 3 0.001 2 0.002 2 0.003 2 0.003 2 0.001 2 0.001 2 0.001 2 0.002 2 0.002 12 0.994 0.016 1.01
3617 G3617A|(ORF1ab_polyprotein:G3352A(V1118I))|(ORF1a_polyprotein:G3352A(V1118I)) 2 0.001 4719 0.342 2 0.343 0 0.343
ubiq 4184 G4184A|(ORF1ab_polyprotein:G3919A(G1307S))|(ORF1a_polyprotein:G3919A(G1307S)) 53801 0.997 126390 0.859 89167 0.998 88456 0.997 9199 0.997 85722 0.997 52404 0.997 1047 0.996 35548 0.706 68182 0.997 52225 0.567 1228 0.998 199219 0.997 106046 0.997 55958 0.997 8930 0.996 3442 0.997 7741 0.997 44415 0.996 93859 0.997 1843 0.997 48809 0.996 4950 0.807 88033 0.997 38593 0.997 52833 0.998 2855 0.998 12627 0.716 70859 0.998 25047 0.998 27872 0.997 73699 0.998 55947 0.998 122941 0.996 25554 0.995 35 2.854 30.712 33.566
ubiq 9344 C9344T|(ORF1ab_polyprotein:C9079T(L3027F))|(ORF1a_polyprotein:C9079T(L3027F)) 2091 0.999 1924 0.968 6472 0.997 3224 0.997 2788 0.998 1972 0.999 19 1 793 0.997 6137 0.998 287 0.993 683 0.999 2289 0.998 1476 0.998 305 0.993 144 0.993 244 0.996 749 1 31 0.969 587 0.997 843 0.992 680 1 961 0.992 660 0.994 9255 0.998 20540 0.998 4732 0.998 1681 0.998 68 1 6435 0.997 1502 0.995 3011 0.996 7353 0.998 1882 0.998 20513 0.997 542 0.991 35 2.964 31.867 34.831
ubiq 10029 C10029T|(ORF1ab_polyprotein:C9764T(T3255I))|(ORF1a_polyprotein:C9764T(T3255I)) 869 0.994 1047 0.991 1598 0.992 1313 0.995 87 1 90 0.989 64 0.985 154 0.994 31 1 1378 0.995 1135 0.991 189 0.995 109 1 56 1 90 1 24 1 81 1 310 0.984 22 1 1134 0.991 153 0.968 2162 0.994 1275 0.997 572 0.998 149 1 58 1 1443 0.997 1036 0.994 746 0.992 1357 0.996 451 0.996 3052 0.994 57 1 33 2.977 29.845 32.8219999999999
10138 RATG13 C10138T|(ORF1ab_polyprotein:C9873T(N3291N))|(ORF1a_polyprotein:C9873T(N3291N)) 173 0.181 3 0.002 2 0.001 2 0.002 2 0.011 25 0.016 2 0.003 2 0.001 4 0.001 9 0.183 0.035 0.218
ubiq 10198 C10198T|(ORF1ab_polyprotein:C9933T(D3311D))|(ORF1a_polyprotein:C9933T(D3311D)) 813 0.999 1044 0.994 1520 0.995 1232 0.997 85 1 84 1 69 1 153 1 6 0.162 1204 0.997 1095 0.998 182 1 110 1 54 1 84 1 26 1 83 1 273 0.996 21 1 1141 0.99 146 0.961 2084 0.997 1213 0.999 565 0.996 153 1 65 1 1340 0.999 994 0.995 745 0.993 1332 0.999 402 0.998 3188 0.994 62 1 33 2.988 29.071 32.059
ubiq 10447 RATG13 G10447A|(ORF1ab_polyprotein:G10182A(R3394R))|(ORF1a_polyprotein:G10182A(R3394R)) 13687 0.998 50927 0.997 46806 0.998 37442 0.998 11098 0.997 30069 0.998 7447 0.998 846 0.989 5193 0.997 53479 0.741 35675 0.998 34 1 54917 0.997 29439 0.997 11427 0.997 6100 0.998 5118 0.997 3929 0.998 4631 0.998 2651 0.997 3885 0.999 28293 0.995 82326 0.995 1264 0.891 31165 0.977 42755 0.997 51316 0.997 5707 0.998 6029 0.997 43467 0.997 26029 0.997 21239 0.996 25092 0.997 53432 0.997 55498 0.997 7819 0.991 36 2.993 32.513 35.506
ubiq 10449 C10449A|(ORF1ab_polyprotein:C10184A(P3395H))|(ORF1a_polyprotein:C10184A(P3395H)) 13681 0.997 50917 0.997 46778 0.997 37414 0.997 11098 0.997 30016 0.996 7445 0.997 848 0.992 5197 0.998 53455 0.742 35637 0.996 34 1 54847 0.996 29422 0.996 11408 0.995 6095 0.998 5118 0.997 3931 0.998 4632 0.998 2647 0.995 3877 0.997 28312 0.996 82323 0.995 1265 0.891 31171 0.977 42723 0.997 51313 0.997 5705 0.998 6027 0.996 43459 0.997 26018 0.997 21240 0.996 25105 0.997 53408 0.997 55425 0.996 7839 0.994 36 2.991 32.506 35.497
ubiq 11288 TCTGGTTTT11288-11296del|(ORF1ab_polyprotein:11023-11031del(SGF3675-3677del))|(ORF1a_polyprotein:11023-11031del(SGF3675-3677del)) 1666 0.998 6378 0.996 10701 0.998 15552 0.998 1795 0.998 3989 0.998 2468 0.999 164 1 7780 0.997 4051 0.592 263 1 13961 0.997 4786 0.996 1024 0.996 3092 0.997 1146 0.996 1405 0.996 3227 0.998 6039 0.998 10934 0.997 708 0.999 7626 0.996 3096 0.837 25891 0.997 15040 0.998 8603 0.998 7464 0.998 19605 0.997 5628 0.998 8214 0.997 20405 0.998 2991 0.998 55707 0.997 674 0.999 34 2.992 30.36 33.352
12106 G12106T|(ORF1ab_polyprotein:G11841T(E3947D))|(ORF1a_polyprotein:G11841T(E3947D)) 16 0.001 3724 0.177 2 0.001 13 0.001 5 0.001 3 0.001 2 0.001 17 0.001 7 0.001 7 0.001 12 0.001 11 0.178 0.009 0.187
ubiq 14408 Delta C14408T|(ORF1ab_polyprotein:C14144T(P4715L)) 235 1 26499 0.998 7351 0.998 16851 0.998 71 1 12810 0.998 2075 0.998 184 1 10255 0.998 8597 0.991 959 1 19467 0.998 7317 0.998 3053 0.997 1066 0.999 1089 0.998 209 1 1710 0.998 51 0.981 575 0.997 5125 0.997 331 0.308 13245 0.999 575 1 7814 0.998 4209 1 2388 0.998 14698 0.998 1677 1 3578 0.997 9954 0.998 9633 0.998 5194 0.997 2135 0.995 34 2.996 30.232 33.228
14622 G14622T|(ORF1ab_polyprotein:G14358T(T4786T)) 2 0.001 221 0.134 2 0.001 3 0.001 2 0.002 7 0.001 6 0.135 0.005 0.14
ubiq 17859 T17859C|(ORF1ab_polyprotein:T17595C(Y5865Y)) 147881 0.997 274584 0.996 218797 0.879 215950 0.996 26338 0.996 121779 0.997 69974 0.997 6034 0.996 131963 0.997 194944 0.997 26 0.003 32877 0.997 483542 0.997 312856 0.997 57567 0.572 165965 0.997 88730 0.997 84449 0.997 147894 0.997 14762 0.996 53338 0.996 94356 0.996 131436 0.996 29214 0.996 86834 0.996 28579 0.832 333727 0.997 171107 0.997 136985 0.997 247403 0.997 193107 0.903 178880 0.997 91487 0.997 48981 0.997 264820 0.997 189200 0.997 444935 0.992 43538 0.995 38 2.872 33.201 36.073
ubiq 18163 A18163G|(ORF1ab_polyprotein:A17899G(I5967V)) 4243 0.997 6301 0.891 5444 0.998 2450 0.997 320 0.997 2368 0.997 1788 0.997 99 1 1577 0.997 8408 0.998 378 0.984 1220 0.998 3401 0.998 1044 0.996 858 1 1056 0.994 217 0.995 440 1 65 0.985 658 0.995 329 0.997 136 1 4017 0.997 275 0.887 7412 0.998 4033 0.997 3312 0.998 1379 0.999 2165 0.999 6923 0.998 1727 0.999 3003 0.996 5788 0.996 3515 0.997 19475 0.996 862 0.994 36 2.886 32.776 35.662
ubiq 19326 A19326G|(ORF1ab_polyprotein:A19062G(P6354P)) 10104 0.994 8219 0.994 5176 0.996 10008 0.993 888 0.996 11079 0.996 3186 0.996 177 1 1343 0.998 7402 0.995 12601 0.994 8509 0.993 2879 0.996 4049 0.996 655 0.995 435 0.993 4163 0.996 9 1 7544 0.996 14615 0.996 3211 0.996 821 1 2040 0.998 4597 0.996 1847 0.998 3261 0.836 4220 0.996 1369 0.996 2048 0.453 1277 0.855 30 2.984 26.053 29.037
ubiq 21618 C21618T|(surface_glycoprotein:C56T(T19I)) 38666 0.999 42687 0.997 80875 0.998 38435 0.999 5490 0.999 32673 0.999 16632 0.998 920 0.889 26577 0.999 116564 0.99 69789 0.999 4993 0.999 33340 0.998 1926 0.999 59780 0.997 13220 0.999 15486 0.999 8617 0.999 2378 0.999 1646 1 1960 0.996 8714 0.999 61676 0.997 3186 0.997 76655 0.999 92451 0.999 70330 0.999 25118 0.998 40327 0.998 82780 0.998 48691 0.998 25754 0.912 92362 0.985 44002 0.998 204704 0.998 15028 0.996 36 2.99399999999999 32.728 35.722
ubiq 21633 TACCCCCTG21633-21641del|(surface_glycoprotein:TTACCCCCTGCA70-81TCAdel(LPPA24-27Sdel)) 30852 0.998 35126 0.996 69631 0.997 34541 0.997 4701 0.997 30832 0.997 15390 0.996 1047 0.996 24810 0.998 111596 0.985 60090 0.997 5161 0.995 29627 0.997 1991 0.995 48303 0.997 11738 0.998 13377 0.998 8364 0.997 2464 0.995 1688 0.996 2022 0.993 9049 0.997 60261 0.994 2570 0.996 72422 0.997 82966 0.998 63273 0.996 21444 0.997 32448 0.87 73328 0.997 41341 0.997 26320 0.993 83004 0.997 39674 0.998 170879 0.997 14629 0.985 36 2.991 32.733 35.724
ubiq 21810 T21810C|(surface_glycoprotein:T248C(V83A)) 5217 0.995 9769 0.997 33766 0.996 23745 0.995 2916 0.994 23260 0.839 12679 0.996 1349 0.993 23381 0.995 90840 0.845 27702 0.995 6640 0.996 19941 0.995 2493 0.994 8592 0.996 8760 0.996 8023 0.996 8798 0.994 3261 0.996 2212 0.994 2434 0.996 11308 0.996 47623 0.809 379 0.99 57286 0.996 59434 0.996 39847 0.996 10996 0.996 20196 0.778 43715 0.995 18035 0.996 16584 0.934 49666 0.996 26664 0.996 44589 0.994 13743 0.995 36 2.988 32.068 35.056
ubiq 22200 T22200A|(surface_glycoprotein:T638A(V213E)) 16099 0.997 328 0.997 28292 0.998 12519 0.998 1718 0.997 17412 0.998 2185 0.999 85 1 5508 0.525 15078 0.996 14442 0.997 436 1 12678 0.997 5679 0.606 11117 0.998 1340 0.999 2058 0.999 1077 0.999 97 0.99 174 1 96 1 4 1 39409 0.994 9869 0.998 11522 0.998 20268 0.998 1917 0.997 20302 0.998 4368 0.965 3863 0.927 28850 0.983 9635 0.998 15408 0.997 4928 0.995 34 2.992 29.946 32.938
22799 G22799C|(surface_glycoprotein:GGG1237-1239CGT(G413R)) 4801 0.141 9150 0.14 350 0.016 3 0.297 0 0.297
22801 G22801T|(surface_glycoprotein:GGG1237-1239CGT(G413R)) 4801 0.14 9150 0.139 350 0.016 3 0.295 0 0.295
22812 A22812C|(surface_glycoprotein:A1250C(K417T)) 6599 0.171 12315 0.168 303 0.013 3 0.352 0 0.352
22910 A22910G|(surface_glycoprotein:A1348G(N450D)) 8713 0.159 15096 0.164 2 0.323 0 0.323
linkedubiq 22942 T22942G|(surface_glycoprotein:T1380G(N460K)) 59510 0.997 99091 0.997 33079 0.997 31737 0.996 1169 0.995 25073 0.997 10593 0.997 528 0.996 48071 0.996 96905 0.997 59317 0.996 3084 0.998 11488 0.996 30794 0.996 6964 0.998 9887 0.997 10500 0.998 2682 0.998 631 0.997 17868 0.997 21117 0.995 39344 0.996 1475 0.993 37646 0.997 44722 0.998 39129 0.997 4254 0.997 11002 0.753 22616 0.997 15257 0.996 19501 0.996 35682 0.997 34007 0.998 48727 0.996 7090 0.993 35 2.991 31.644 34.635
22986 C22986T|(surface_glycoprotein:C1424T(A475V)) 5620 0.118 9235 0.117 95 0.003 3 0.001 9 0.001 5 0.235 0.005 0.24
linkedubiq 22992 G22992A|(surface_glycoprotein:G1430A(S477N)) 39515 0.999 64460 0.998 22330 0.999 22469 0.998 791 0.995 17352 0.999 7405 0.997 352 0.994 32837 0.999 64387 0.998 40563 0.998 2121 0.998 7878 0.999 20743 0.997 4495 0.999 6566 0.999 7093 0.998 1816 0.998 465 0.996 12083 0.998 15290 0.996 26561 0.996 982 1 25466 0.999 28666 0.999 26916 0.999 2832 0.999 9971 0.999 14907 0.998 10433 0.999 13384 0.996 23572 0.999 23188 0.998 37218 0.998 4320 0.989 35 2.996 31.924 34.92
linked 22995 RATG13,Delta C22995A|(surface_glycoprotein:C1433A(T478K)) 26809 0.678 21329 0.33 7965 0.356 16815 0.747 792 0.996 10539 0.607 7389 0.995 8334 0.253 23306 0.361 15449 0.38 1262 0.594 7873 0.998 11258 0.541 1161 0.258 1761 0.268 6316 0.889 466 0.998 12071 0.997 9738 0.635 8315 0.312 941 0.958 23675 0.929 537 0.019 13536 0.502 135 0.048 9960 0.998 8011 0.536 6331 0.606 6390 0.476 12236 0.518 15967 0.688 16405 0.44 1922 0.44 33 1.364 17.987 19.351
23013 A23013T|(surface_glycoprotein:A1451T(E484V)) 3846 0.12 5389 0.105 7 0.001 2 0.001 2 0.001 5 0.224999999999999 0.003 0.227999999999999
23018 T23018G|(surface_glycoprotein:TTT1456-1458GCT(F486A)) 3205 0.107 5362 0.11 2 0.217 0 0.217
23019 T23019C|(surface_glycoprotein:TTT1456-1458GCT(F486A)) 3205 0.107 5362 0.11 2 0.217 0 0.217
23039 C23039A|(surface_glycoprotein:C1477A(Q493K)) 3709 0.125 7120 0.137 2 0.262 0 0.262
23054 RATG13 C23054T|(surface_glycoprotein:CAA1492-1494TAC(Q498Y)) 3466 0.144 6574 0.153 2 0.297 0 0.297
23056 RATG13 A23056C|(surface_glycoprotein:CAA1492-1494TAC(Q498Y)) 3466 0.146 6574 0.155 2 0.301 0 0.301
23064 A23064C|(surface_glycoprotein:A1502C(N501T)) 3387 0.144 6449 0.153 2 0.297 0 0.297
23119 T23119A|(surface_glycoprotein:T1557A(H519Q)) 1204 0.035 21625 0.194 54 0.001 8 0.003 39 0.001 9 0.001 6 0.229 0.006 0.235
ubiq 23403 Delta A23403G|(surface_glycoprotein:A1841G(D614G)) 25425 0.997 87839 0.997 100638 0.997 72727 0.997 7356 0.996 10142 0.997 11111 0.997 713 1 53693 0.997 38339 0.997 38231 0.997 1648 0.997 112406 0.996 87169 0.997 25534 0.998 16811 0.997 15393 0.998 11124 0.997 15304 0.997 463 0.998 29851 0.997 73 0.986 32159 0.997 2940 0.995 20615 0.995 6478 0.997 129391 0.997 215207 0.997 35287 0.997 68671 0.997 46621 0.998 57080 0.997 45872 0.998 17963 0.997 101351 0.998 41307 0.997 286511 0.995 11772 0.96 38 2.991 34.848 37.839
ubiq 23525 C23525T|(surface_glycoprotein:C1963T(H655Y)) 941 1 1028 0.996 1467 0.999 1228 0.997 316 0.997 1539 0.999 160 1 122 1 707 0.997 1605 0.997 22 1 129 1 327 0.997 1543 0.999 224 0.996 467 1 1083 0.998 1290 0.997 371 1 78 1 23 1 118 1 4 0.8 4429 0.998 1992 0.996 636 1 556 0.998 1982 0.999 1693 0.999 681 0.996 386 0.997 1286 0.998 165 0.994 104 1 1034 0.988 35 2.995 31.737 34.732
25094 A25094G|(surface_glycoprotein:A3532G(N1178D)) 79 0.075 789 0.291 2 0.366 0 0.366
25162 C25162A|(surface_glycoprotein:C3600A(L1200L)) 109 0.342 57 0.145 2 0.001 2 0.002 3 0.004 3 0.002 6 0.488 0.008 0.496
linked 25163 C25163A|(surface_glycoprotein:C3601A(Q1201K)) 110 0.346 57 0.146 4 0.005 3 0.6 2 0.002 2 0.007 6 0.492 0.614 1.10599999999999
25223 A25223G|(surface_glycoprotein:A3661G(I1221V)) 145 0.401 69 0.172 2 0.573 0 0.573
25243 A25243G|(surface_glycoprotein:A3681G(I1227M)) 136 0.412 67 0.182 2 0.594 0 0.594
25254 C25254T|(surface_glycoprotein:C3692T(T1231I)) 152 0.39 76 0.184 2 0.574 0 0.574
ubiq 26060 C26060T|(ORF3a_protein:C668T(T223I)) 4687 0.991 5042 0.984 8834 0.995 5068 0.997 186 1 1222 0.946 485 0.966 223 1 2977 0.992 1832 0.937 1768 0.927 266 1 4618 0.992 4873 0.843 2135 0.995 2859 0.997 1441 0.994 2242 0.996 2131 0.977 3014 0.992 765 0.862 21937 0.977 8467 0.989 5343 0.995 8656 0.998 4385 0.995 9001 0.992 2748 0.992 2799 0.987 17849 0.995 3410 0.982 6208 0.988 1084 0.98 33 2.96999999999999 29.283 32.253
ubiq 26270 C26270T|(envelope_protein:C26T(T9I)) 5315 0.997 5275 0.996 9436 0.998 5637 0.997 158 0.988 1358 0.998 560 0.998 260 1 3259 0.997 1803 0.995 1722 0.997 293 0.997 5213 0.995 5270 0.855 2392 0.998 3159 0.997 1580 0.996 2518 0.996 2263 0.991 3336 0.995 796 0.858 23323 0.979 9754 0.997 5762 0.996 9789 0.997 4945 0.996 9447 0.996 3056 0.995 2945 0.993 18632 0.997 3782 0.996 6849 0.992 997 0.982 33 2.991 29.564 32.555
ubiq 26275 A26275G|(envelope_protein:A31G(T11A)) 4996 0.994 5041 0.995 8962 0.995 5388 0.996 153 0.987 1305 0.999 536 0.994 241 0.996 3040 0.994 1737 0.999 1662 0.996 268 0.996 4899 0.994 5075 0.852 2217 0.997 2959 0.993 1483 0.991 2409 0.996 2182 0.996 3154 0.995 765 0.851 22298 0.978 9278 0.996 5523 0.996 9273 0.997 4681 0.996 9006 0.995 2892 0.994 2872 0.995 17319 0.972 3565 0.996 6593 0.995 984 0.987 33 2.984 29.519 32.503
26526 G26526T|(membrane_glycoprotein:G4T(A2S)) 27 0.002 13168 0.996 33 0.002 50 0.002 34 0.002 29 0.002 9 0.002 81 0.002 11 0.001 11 0.002 13 0.002 5 0.001 3 0.001 24 0.002 12 0.002 5 0.002 16 0.002 4 0.003 18 0.998 0.03 1.028
ubiq 26858 C26858T|(membrane_glycoprotein:C336T(F112F)) 37415 0.998 38048 0.997 121018 0.998 133089 0.998 2 1 35836 0.998 18537 0.998 85 0.934 71111 0.857 31438 0.998 8 1 138092 0.998 89789 0.957 27825 0.997 22467 0.999 14765 0.998 7908 0.997 15073 0.998 1265 1 13111 0.997 14921 0.993 2896 0.998 66528 0.995 8842 0.825 129651 0.998 150227 0.998 68450 0.998 44501 0.998 45564 0.928 101808 0.998 71274 0.998 38447 0.995 121511 0.985 66403 0.998 241084 0.998 7367 0.986 36 2.993 32.413 35.406
ubiq 27915 G27915T|(ORF8_protein:G22T(G8*)) 66 1 15268 0.997 792 0.977 11516 0.588 82 0.988 4017 0.977 177 0.545 64 0.97 301 0.357 121 0.992 109 1 13743 0.998 5292 0.998 314 0.771 2029 0.999 103 1 1001 0.997 83 1 118 0.983 262 0.449 104 0.99 570 0.837 260 0.974 6469 0.957 2208 0.949 2271 0.857 411 0.672 4613 0.998 650 0.998 867 0.998 8199 0.963 2696 0.573 3356 0.922 317 0.313 34 2.974 26.613 29.587
ubiq 28271 A28271T 7577 0.997 19222 0.996 73887 0.998 70756 0.997 27879 0.997 52890 0.998 5591 0.998 4842 0.998 25699 0.997 37446 0.997 6860 0.998 15297 0.997 24187 0.756 67939 0.997 18477 0.998 8259 0.997 23174 0.998 3 1 11405 0.997 30595 0.705 89 1 1434 0.994 350 0.997 114288 0.997 83471 0.998 19292 0.997 37315 0.998 71062 0.842 93246 0.922 16743 0.997 9604 0.997 133392 0.998 15716 0.997 14640 0.996 31748 0.993 35 2.991 31.148 34.139
ubiq 28311 C28311T|(nucleocapsid_phosphoprotein:C38T(P13L)) 6306 0.998 15368 0.997 57285 0.998 56957 0.998 22982 0.998 44078 0.998 4611 0.997 4102 0.998 20286 0.998 29733 0.998 5788 0.997 12639 0.998 25548 0.997 54875 0.997 15208 0.998 6457 0.997 19013 0.998 3 1 9085 0.998 34706 0.996 80 1 1176 0.998 249 1 88236 0.998 67684 0.998 15452 0.999 30451 0.998 57478 0.843 69164 0.909 13561 0.998 7636 0.997 100323 0.96 12722 0.998 11446 0.997 22466 0.995 35 2.993 31.649 34.642
ubiq 28362 GAGAACGCA28362-28370del|(nucleocapsid_phosphoprotein:GGAGAACGCAGT88-99GGTdel(GERS30-33Gdel)) 5723 0.996 13786 0.997 52792 0.998 52364 0.997 20520 0.997 38446 0.997 4122 0.994 3657 0.998 18035 0.997 26465 0.997 5134 0.997 11153 0.997 23367 0.997 49535 0.995 13889 0.998 5830 0.997 17124 0.997 2 1 8109 0.997 31164 0.993 62 1 1038 0.994 238 0.988 81783 0.998 60661 0.998 11860 0.856 27480 0.998 51485 0.815 65098 0.901 12380 0.998 6524 0.944 97089 0.998 11613 0.997 10494 0.996 20658 0.984 35 2.991 31.41 34.401
ubiq 29510 A29510C|(nucleocapsid_phosphoprotein:A1237C(S413R)) 161734 0.997 411597 0.89 254631 0.998 184871 0.997 71886 0.997 139279 0.997 58299 0.998 17659 0.998 204925 0.794 255912 0.843 244498 0.865 12700 0.998 123934 0.998 302514 0.912 43588 0.997 144008 0.998 219725 0.998 210888 0.998 48094 0.998 23410 0.998 122039 0.997 66268 0.997 215148 0.997 14534 0.997 233689 0.996 10691 0.73 322859 0.998 593199 0.998 130852 0.998 400347 0.998 170267 0.808 266895 0.998 86427 0.998 45059 0.998 282487 0.998 115985 0.998 272865 0.996 80266 0.997 38 2.885 33.881 36.766
ubiq 29734 GAGGCCACGCGGAGTACGATCGAGTG29734-29759del 101058 0.998 252348 0.998 136904 0.923 104759 0.998 43313 0.998 90657 0.998 67832 0.997 23981 0.998 127557 0.801 220598 0.998 191019 0.663 20284 0.998 147530 0.998 140414 0.969 69877 0.999 76678 0.998 55557 0.998 27014 0.998 4751 0.999 41676 0.998 42947 0.998 95111 0.997 11381 0.998 162846 0.991 3668 0.912 151109 0.999 211840 0.999 100674 0.999 71515 0.998 85321 0.751 153733 0.999 45340 0.999 40002 0.998 157097 0.999 67000 0.998 181438 0.998 47072 0.987 37 2.919 33.026 35.945