NY-6 - Complete Raw Mutation Data

Full TSV data with all sample columns and abundance information
← Back to Dashboard

Complete Mutations Data

This table shows the complete data from the mutations.tsv file exactly as it appears in the source. Scroll horizontally to see all columns.

Unnamed: 0 Unnamed: 1 Unnamed: 2 Unnamed: 3 SRR24834711 Unnamed: 5 SRR24899644 Unnamed: 7 SRR25002405 Unnamed: 9 SRR25185984 Unnamed: 11 SRR24834665 Unnamed: 13 SRR24834723 Unnamed: 15 SRR24834783 Unnamed: 17 SRR24899698 Unnamed: 19 SRR24899699 Unnamed: 21 SRR24899703 Unnamed: 23 SRR25002413 Unnamed: 25 SRR25002458 Unnamed: 27 SRR25002481 Unnamed: 29 SRR25185903 Unnamed: 31 SRR25185970 Unnamed: 33 SRR25240910 Unnamed: 35 Unnamed: 36 Unnamed: 37 Unnamed: 38 Unnamed: 39 Unnamed: 40 Key Unnamed: 42
('2023-05-21/2023-05-22', '728123.0') ('2023-05-30/2023-05-31', '728123.0') ('2023-06-11/2023-06-12', '728123.0') ('2023-06-25/2023-06-26', '728123.0') ('2023-05-21/2023-05-22', '198128.0') ('2023-05-21/2023-05-22', '244918.0') ('2023-05-21/2023-05-22', '192050.0') ('2023-05-30/2023-05-31', '244918.0') ('2023-05-30/2023-05-31', '198128.0') ('2023-05-30/2023-05-31', '192050.0') ('2023-06-11/2023-06-12', '198128.0') ('2023-06-11/2023-06-12', '244918.0') ('2023-06-11/2023-06-12', '192050.0') ('2023-06-25/2023-06-26', '198128.0') ('2023-06-25/2023-06-26', '283428.0') ('2023-06-25/2023-06-26', '244918.0') Cryptic Sewershed
Linked/Ubiquitous Position Flagged Sequences Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Total samples Positives Sum Negatives Sum Total Sum Non-Cryptic Sewershed
786 T786A|(ORF1ab_polyprotein:T521A(M174K))|(ORF1a_polyprotein:T521A(M174K)) 58385 0.144 5067 0.1 60 0.001 28 0.002 288 0.002 62 0.001 6 0.244 0.006 0.25
913 C913T|(ORF1ab_polyprotein:C648T(S216S))|(ORF1a_polyprotein:C648T(S216S)) 42553 0.109 13449 0.037 29255 0.561 3 0.707 0 0.707
943 RATG13 G943A|(ORF1ab_polyprotein:G678A(R226R))|(ORF1a_polyprotein:G678A(R226R)) 33406 0.085 17020 0.332 2 0.417 0 0.417
1629 A1629G|(ORF1ab_polyprotein:A1364G(Q455R))|(ORF1a_polyprotein:A1364G(Q455R)) 3423 0.255 1842 0.22 1152 0.131 3 0.606 0 0.606
2110 RATG13 C2110T|(ORF1ab_polyprotein:C1845T(N615N))|(ORF1a_polyprotein:C1845T(N615N)) 9215 0.103 9555 0.358 2 0.460999999999999 0 0.460999999999999
ubiq 3037 RATG13,Delta C3037T|(ORF1ab_polyprotein:C2772T(F924F))|(ORF1a_polyprotein:C2772T(F924F)) 404 0.998 366 0.989 109 1 1095 0.998 3490 0.997 694 0.997 83 1 85 1 132 0.978 202 1 534 0.993 46 0.979 1151 0.993 1069 0.997 1068 0.992 15 3.985 10.926 14.911
3267 RATG13 C3267T|(ORF1ab_polyprotein:C3002T(T1001I))|(ORF1a_polyprotein:C3002T(T1001I)) 12 0.545 6 0.273 22 0.15 3 0.968 0 0.968
3547 T3547A|(ORF1ab_polyprotein:T3282A(N1094K))|(ORF1a_polyprotein:T3282A(N1094K)) 1847 0.387 13 0.002 9 0.004 18 0.014 5 0.001 4 0.002 3 0.005 2 0.002 11 0.003 2 0.001 10 0.407 0.014 0.421
3828 C3828T|(ORF1ab_polyprotein:C3563T(S1188L))|(ORF1a_polyprotein:C3563T(S1188L)) 2731 0.231 152 0.038 2 0.269 0 0.269
4084 C4084T|(ORF1ab_polyprotein:C3819T(D1273D))|(ORF1a_polyprotein:C3819T(D1273D)) 4506 0.447 340 0.317 2 0.764 0 0.764
4233 A4233G|(ORF1ab_polyprotein:A3968G(D1323G))|(ORF1a_polyprotein:A3968G(D1323G)) 13668 0.249 2313 0.177 2 0.426 0 0.426
4582 C4582T|(ORF1ab_polyprotein:C4317T(N1439N))|(ORF1a_polyprotein:C4317T(N1439N)) 1250 0.161 5384 0.36 2 0.002 9 0.002 4 0.521 0.004 0.525
4893 C4893T|(ORF1ab_polyprotein:C4628T(T1543I))|(ORF1a_polyprotein:C4628T(T1543I)) 18315 0.176 4186 0.252 2 0.428 0 0.428
5388 C5388A|(ORF1ab_polyprotein:C5123A(A1708D))|(ORF1a_polyprotein:C5123A(A1708D)) 8940 0.355 14330 0.338 4712 0.358 6 0.002 11 0.002 15 0.002 6 1.053 0.004 1.057
5607 A5607G|(ORF1ab_polyprotein:A5342G(K1781R))|(ORF1a_polyprotein:A5342G(K1781R)) 12900 0.354 17774 0.341 6215 0.364 3 1.059 0 1.059
5648 RATG13 A5648C|(ORF1ab_polyprotein:A5383C(K1795Q))|(ORF1a_polyprotein:A5383C(K1795Q)) 13452 0.353 19333 0.338 6527 0.36 19 0.002 51 0.004 5 1.051 0.006 1.057
7292 T7292C|(ORF1ab_polyprotein:T7027C(L2343L))|(ORF1a_polyprotein:T7027C(L2343L)) 163 0.836 40 0.091 37 0.204 3 1.131 0 1.131
8976 A8976G|(ORF1ab_polyprotein:A8711G(E2904G))|(ORF1a_polyprotein:A8711G(E2904G)) 179 0.18 41 0.169 2 0.349 0 0.349
ubiq 10447 RATG13 G10447A|(ORF1ab_polyprotein:G10182A(R3394R))|(ORF1a_polyprotein:G10182A(R3394R)) 8283 0.996 90431 0.997 15482 0.995 5193 0.997 37855 0.997 21853 0.997 1536 0.999 1892 0.997 3003 0.99 11950 0.998 13796 0.996 7048 0.988 48147 0.997 11098 0.997 7447 0.998 34 1 16 3.985 11.954 15.939
ubiq 10449 C10449A|(ORF1ab_polyprotein:C10184A(P3395H))|(ORF1a_polyprotein:C10184A(P3395H)) 8273 0.995 90437 0.997 15481 0.995 5197 0.998 37847 0.997 21854 0.997 1533 0.997 1891 0.995 2993 0.987 11951 0.997 13813 0.997 7070 0.991 48127 0.996 11098 0.997 7445 0.997 34 1 16 3.985 11.948 15.933
ubiq 11288 TCTGGTTTT11288-11296del|(ORF1ab_polyprotein:11023-11031del(SGF3675-3677del))|(ORF1a_polyprotein:11023-11031del(SGF3675-3677del)) 23718 0.998 25901 0.998 8151 0.997 7780 0.997 7497 0.997 1274 0.997 701 0.999 1446 0.998 302 0.993 2513 0.998 4019 0.997 679 0.987 2322 0.994 1795 0.998 2468 0.999 263 1 16 3.99 11.957 15.947
13033 T13033C|(ORF1ab_polyprotein:T12768C(N4256N))|(ORF1a_polyprotein:T12768C(N4256N)) 411 0.14 481 0.218 2 0.358 0 0.358
13951 A13951G|(ORF1ab_polyprotein:A13687G(I4563V)) 6325 0.166 2655 0.21 2 0.376 0 0.376
ubiq 14408 Delta C14408T|(ORF1ab_polyprotein:C14144T(P4715L)) 2857 0.999 5872 0.998 1262 0.996 10255 0.998 8776 0.998 32 1 295 0.993 2247 0.998 2757 0.996 2913 1 5193 0.997 425 0.988 8197 0.998 71 1 2075 0.998 959 1 16 3.991 11.966 15.9569999999999
14676 C14676T|(ORF1ab_polyprotein:C14412T(P4804P)) 612 0.27 3 0.001 2 0.271 0 0.271
15285 G15285T|(ORF1ab_polyprotein:G15021T(M5007I)) 5950 0.291 5405 0.167 7 0.001 23 0.001 9 0.001 2 0.001 7 0.001 6 0.001 2 0.002 9 0.459999999999999 0.006 0.465999999999999
16176 T16176C|(ORF1ab_polyprotein:T15912C(T5304T)) 8670 0.109 10741 0.583 4 0.002 3 0.692 0.002 0.694
16348 T16348C|(ORF1ab_polyprotein:T16084C(S5362P)) 6246 0.106 8352 0.584 2 0.69 0 0.69
ubiq 17410 C17410T|(ORF1ab_polyprotein:C17146T(R5716C)) 6681 0.997 33592 0.998 4982 0.866 9129 0.998 7344 0.997 10507 0.998 1754 0.997 2226 1 2710 0.99 2040 0.998 5337 0.996 6095 0.989 16701 0.997 2 1 3810 0.997 763 0.997 16 3.859 11.956 15.815
ubiq 17859 T17859C|(ORF1ab_polyprotein:T17595C(Y5865Y)) 148333 0.997 333906 0.998 17406 0.977 131963 0.997 81644 0.996 63918 0.997 25419 0.997 39544 0.998 25187 0.994 66037 0.997 43316 0.995 55282 0.994 110635 0.995 26338 0.996 69974 0.997 32877 0.997 16 3.969 11.953 15.9219999999999
18318 G18318T|(ORF1ab_polyprotein:G18054T(G6018G)) 568 0.413 7 0.002 2 0.004 3 0.001 4 0.001 5 0.415 0.006 0.421
19869 T19869C|(ORF1ab_polyprotein:T19605C(T6535T)) 106 0.131 111 0.114 2 0.001 3 0.245 0.001 0.246
20407 RATG13 T20407C|(ORF1ab_polyprotein:T20143C(F6715L)) 129 0.042 47 0.212 2 0.254 0 0.254
ubiq 21618 C21618T|(surface_glycoprotein:C56T(T19I)) 102812 0.998 66735 0.998 16250 0.997 26577 0.999 43839 0.998 12233 0.998 4548 0.895 9717 0.998 6809 0.994 14049 0.998 26475 0.998 10438 0.997 61150 0.996 5490 0.999 16632 0.998 4993 0.999 16 3.992 11.868 15.86
ubiq 21633 TACCCCCTG21633-21641del|(surface_glycoprotein:TTACCCCCTGCA70-81TCAdel(LPPA24-27Sdel)) 89254 0.997 59752 0.997 13336 0.997 24810 0.998 38014 0.997 11780 0.997 3806 0.875 9323 0.998 6595 0.988 12574 0.997 25099 0.995 10816 0.983 58545 0.995 4701 0.997 15390 0.996 5161 0.995 16 3.989 11.813 15.802
ubiq 21810 T21810C|(surface_glycoprotein:T248C(V83A)) 45193 0.996 36474 0.997 3605 0.994 23381 0.995 19463 0.995 12162 0.996 1294 0.996 5294 0.997 3366 0.989 6012 0.997 19351 0.993 11408 0.792 43280 0.994 2916 0.994 12679 0.996 6640 0.996 16 3.982 11.735 15.7169999999999
21967 TTG21967-21969del|(surface_glycoprotein:TTTTGT403-408TTTdel(FC135-136Fdel)) 289 0.217 4125 0.39 2 0.607 0 0.607
21976 T21976G|(surface_glycoprotein:T414G(D138E)) 286 0.212 4099 0.384 2 0.596 0 0.596
21977 C21977T|(surface_glycoprotein:C415T(P139S)) 289 0.214 4122 0.387 2 0.601 0 0.601
21980 TTT21980-21982del|(surface_glycoprotein:418-420del(F140del)) 289 0.21 4102 0.378 2 0.588 0 0.588
linked 21991 TTA21991-21993del|(surface_glycoprotein:GTTTAT427-432GTTdel(VY143-144Vdel)) 3326 0.948 6687 0.954 1176 0.922 9635 0.923 6174 0.956 7154 0.953 1664 0.95 8378 0.934 7072 0.905 4526 0.945 2788 0.953 11 3.747 6.596 10.343
22016 T22016A|(surface_glycoprotein:T454A(W152R)) 240 0.211 3406 0.378 8 0.001 3 0.589 0.001 0.59
22020 TGG22020-22022del|(surface_glycoprotein:ATGGAA457-462AAAdel(ME153-154Kdel)) 226 0.202 3281 0.368 2 0.57 0 0.57
22034 AGAGTT22034-22039del|(surface_glycoprotein:472-477del(RV158-159del)) 192 0.188 2687 0.337 2 0.525 0 0.525
22054 T22054G|(surface_glycoprotein:T492G(N164K)) 234 0.235 3618 0.42 19 0.003 4 0.001 4 0.655 0.004 0.659
22079 C22079A|(surface_glycoprotein:C517A(Q173K)) 280 0.24 4638 0.422 2 0.001 9 0.001 5 0.001 5 0.661999999999999 0.003 0.664999999999999
22121 AAA22121-22123del|(surface_glycoprotein:559-561del(K187del)) 337 0.265 5584 0.473 2 0.738 0 0.738
22132 G22132T|(surface_glycoprotein:G570T(R190S)) 7 0.002 360 0.28 5810 0.482 21 0.003 14 0.002 24 0.003 33 0.004 11 0.002 8 0.764 0.014 0.778
22203 G22203A|(surface_glycoprotein:G641A(R214H)) 2253 0.125 5 0.001 566 0.21 4896 0.466 8 0.001 2 0.001 15 0.002 16 0.001 5 0.003 9 0.802 0.008 0.81
22238 T22238G|(surface_glycoprotein:T676G(L226V)) 3012 0.126 586 0.189 3561 0.504 16 0.007 12 0.002 145 0.014 25 0.003 4 0.001 6 0.004 2 0.003 10 0.819 0.034 0.853
22582 A22582T|(surface_glycoprotein:A1020T(E340D)) 907 0.595 451 0.217 147 0.439 1056 0.996 2 0.005 5 2.247 0.005 2.252
linkedubiq 22599 RATG13 G22599C|(surface_glycoprotein:G1037C(R346T)) 1432 0.999 1968 0.997 332 0.997 1013 0.998 1531 0.998 438 0.995 121 1 296 0.997 10 1 685 0.996 551 0.993 409 0.995 363 1 80 1 14 3.991 9.974 13.965
22629 A22629C|(surface_glycoprotein:A1067C(K356T)) 883 0.562 449 0.205 150 0.427 1084 0.999 2 0.003 2 0.005 6 2.193 0.008 2.201
22674 CCG22674-22676del|(surface_glycoprotein:TCCGCA1111-1116TCAdel(SA371-372Sdel)) 852 0.567 387 0.179 149 0.423 1011 0.997 4 2.166 0 2.166
22690 TTT22690-22692del|(surface_glycoprotein:ACTTTT1126-1131ACTdel(TF376-377Tdel)) 862 0.556 395 0.178 153 0.415 1019 0.996 4 2.145 0 2.145
22713 C22713T|(surface_glycoprotein:C1151T(P384L)) 801 0.566 323 0.164 127 0.399 827 0.999 4 2.128 0 2.128
ubiq 22786 A22786C|(surface_glycoprotein:A1224C(R408S)) 19126 0.964 36767 0.99 4830 0.891 18468 0.963 13105 0.995 10137 0.995 1952 0.993 3524 0.994 3672 0.995 5229 0.997 16922 0.994 2462 0.99 6784 0.995 454 1 5215 0.996 1647 0.996 16 3.808 11.94 15.748
ubiq 22813 G22813T|(surface_glycoprotein:G1251T(K417N)) 27095 0.98 51144 0.994 6879 0.903 27443 0.98 17878 0.998 14274 0.998 2700 0.996 4427 0.999 5025 0.986 7002 0.998 22528 0.995 3573 0.976 8933 0.996 662 1 7253 0.992 2263 0.995 16 3.857 11.929 15.786
ubiq 22882 T22882G|(surface_glycoprotein:T1320G(N440K)) 31304 0.996 56836 0.997 8290 0.993 35182 0.996 20163 0.996 16748 0.995 3036 0.996 3298 0.998 3234 0.984 6564 0.996 20934 0.993 3644 0.977 8068 0.991 853 0.996 8207 0.992 2415 0.991 16 3.982 11.905 15.887
ubiq 22895 G22895C|(surface_glycoprotein:GTT1333-1335CCT(V445P)) 30001 0.997 55129 0.998 7640 0.956 34309 0.996 19525 0.997 16262 0.997 2357 0.791 3035 0.999 2571 0.986 6216 0.998 19748 0.994 3376 0.984 7626 0.995 847 0.998 7948 0.993 2301 0.997 16 3.947 11.729 15.6759999999999
ubiq 22896 T22896C|(surface_glycoprotein:GTT1333-1335CCT(V445P)) 30001 0.997 55129 0.998 7640 0.956 34309 0.996 19525 0.997 16262 0.997 2357 0.791 3035 0.999 2571 0.986 6216 0.998 19748 0.994 3376 0.984 7626 0.995 847 0.998 7948 0.993 2301 0.997 16 3.947 11.729 15.6759999999999
ubiq 22898 G22898A|(surface_glycoprotein:G1336A(G446S)) 30013 0.997 55149 0.998 7642 0.956 34355 0.998 19537 0.998 16271 0.997 2969 0.997 3025 0.996 2589 0.993 6219 0.998 19791 0.997 3405 0.992 7636 0.996 847 0.998 7981 0.998 2307 0.999 16 3.949 11.959 15.908
ubiq 22942 T22942G|(surface_glycoprotein:T1380G(N460K)) 40526 0.997 76712 0.998 10678 0.992 48071 0.996 26231 0.997 21739 0.997 3999 0.997 4257 0.997 3299 0.983 8825 0.998 26976 0.995 4830 0.985 10456 0.995 1169 0.995 10593 0.997 3084 0.998 16 3.983 11.934 15.917
ubiq 22992 G22992A|(surface_glycoprotein:G1430A(S477N)) 27887 0.998 50955 0.999 7033 0.97 32837 0.999 17685 0.998 15097 0.998 2838 0.998 2938 0.999 1551 0.987 5830 0.999 18369 0.997 2956 0.99 7059 0.997 791 0.995 7405 0.997 2121 0.998 16 3.966 11.953 15.919
ubiq 23013 A23013C|(surface_glycoprotein:A1451C(E484A)) 22826 0.997 42558 0.998 5722 0.975 27412 0.997 14288 0.997 12433 0.997 2403 0.998 2337 0.996 1042 0.993 4853 0.998 14897 0.996 2212 0.99 5674 0.996 663 0.998 6088 0.995 1732 0.995 16 3.967 11.949 15.916
ubiq 23018 RATG13 T23018C|(surface_glycoprotein:TTT1456-1458CCT(F486P)) 21544 0.998 40247 0.999 5401 0.976 26149 0.998 13473 0.998 11778 0.998 1657 0.712 2168 0.999 928 0.994 4547 0.999 13868 0.997 2045 0.995 5281 0.999 638 0.998 5708 0.998 1642 0.997 16 3.971 11.684 15.655
ubiq 23019 T23019C|(surface_glycoprotein:TTT1456-1458CCT(F486P)) 21544 0.998 40247 0.999 5401 0.976 26149 0.998 13473 0.998 11778 0.998 1657 0.704 2168 0.999 928 0.994 4547 0.999 13868 0.997 2045 0.995 5281 0.999 638 0.998 5708 0.998 1642 0.997 16 3.971 11.676 15.647
ubiq 23031 T23031C|(surface_glycoprotein:T1469C(F490S)) 20365 0.999 38135 0.999 5108 0.974 24161 0.998 12803 0.998 11126 0.998 1543 0.705 2273 0.997 1209 0.993 4496 0.999 13776 0.999 1947 0.995 5346 0.999 585 0.998 5518 0.999 1532 0.998 16 3.96999999999999 11.678 15.648
ubiq 23055 A23055G|(surface_glycoprotein:A1493G(Q498R)) 17206 0.998 32849 0.998 4358 0.998 19428 0.998 10479 0.999 9071 0.998 1799 0.997 2394 0.998 1560 0.995 4024 0.998 12585 0.998 1742 0.992 4988 0.997 452 0.993 4623 0.998 1302 0.998 16 3.992 11.961 15.953
ubiq 23063 A23063T|(surface_glycoprotein:A1501T(N501Y)) 16206 0.947 32703 0.998 4325 0.997 19351 0.998 10427 0.998 9024 0.999 1790 0.997 2385 0.999 1532 0.979 4000 0.996 12511 0.996 1672 0.976 4946 0.993 453 1 4568 0.996 1293 0.997 16 3.94 11.926 15.866
ubiq 23075 RATG13 T23075C|(surface_glycoprotein:T1513C(Y505H)) 14072 0.998 26889 0.999 3437 0.963 15394 0.999 8494 0.999 7376 0.998 1451 0.998 2148 0.998 1498 0.995 3370 0.999 10953 0.998 1451 0.995 4394 0.998 348 0.994 3790 0.997 1054 0.998 16 3.959 11.967 15.926
ubiq 23403 Delta A23403G|(surface_glycoprotein:A1841G(D614G)) 42201 0.997 87032 0.998 16837 0.995 53693 0.997 25037 0.998 9175 0.997 6089 0.997 7248 0.997 11086 0.992 16925 0.998 21838 0.995 6343 0.988 59282 0.996 7356 0.996 11111 0.997 1648 0.997 16 3.987 11.948 15.935
ubiq 23599 T23599G|(surface_glycoprotein:T2037G(N679K)) 39096 0.867 19110 0.999 4716 0.998 21821 0.999 13138 0.998 5377 0.999 1770 0.998 3988 0.999 1692 0.995 4210 0.999 5727 0.998 8159 0.994 16231 0.998 2768 0.999 16201 0.998 836 1 16 3.863 11.975 15.838
ubiq 23604 C23604A|(surface_glycoprotein:C2042A(P681H)) 46429 0.999 19751 0.999 4851 0.997 22461 0.999 13635 0.999 5566 0.999 1844 0.999 4096 0.998 1745 0.994 4309 0.999 5901 0.997 8441 0.992 16773 0.998 2835 0.999 16840 0.998 864 1 16 3.99399999999999 11.972 15.966
ubiq 23854 C23854A|(surface_glycoprotein:C2292A(N764K)) 49186 0.851 21008 0.996 5115 0.99 21525 0.997 16502 0.996 6584 0.996 2110 0.996 4646 0.997 2378 0.983 4484 0.995 6875 0.989 9255 0.964 20612 0.991 2822 0.997 20231 0.993 1044 0.992 16 3.834 11.889 15.7229999999999
24198 C24198T|(surface_glycoprotein:C2636T(A879V)) 2 0.011 12 0.279 20 1 3 1.29 0 1.29
24506 T24506G|(surface_glycoprotein:T2944G(S982A)) 8 0.286 11 0.028 2 0.314 0 0.314
24914 G24914C|(surface_glycoprotein:G3352C(D1118H)) 704 0.129 556 0.431 14 0.004 3 0.56 0.004 0.564
25026 A25026T|(surface_glycoprotein:A3464T(Y1155F)) 559 0.11 440 0.398 5 0.002 3 0.508 0.002 0.51
25169 C25169T|(surface_glycoprotein:C3607T(L1203F)) 100 0.279 23 0.155 38 0.286 3 0.72 0 0.72
25631 T25631C|(ORF3a_protein:T239C(V80A)) 20244 0.294 2872 0.261 2 0.554999999999999 0 0.554999999999999
26110 C26110T|(ORF3a_protein:C718T(P240S)) 536 0.136 622 0.336 2 0.472 0 0.472
26116 G26116A|(ORF3a_protein:G724A(E242K)) 540 0.133 442 0.233 2 0.366 0 0.366
ubiq 26577 C26577G|(membrane_glycoprotein:C55G(Q19E)) 9642 0.862 17204 0.997 2425 0.995 15072 0.997 10536 0.997 9533 0.996 449 1 2716 0.999 1134 0.999 1054 0.984 18662 0.994 19880 0.996 12 3.851 7.965 11.8159999999999
27382 G27382-27382del|(ORF6_protein:181-181del(61fs)) 2233 0.998 5 0.002 7 0.002 2 0.001 8 0.003 9 0.002 7 0.002 7 1.002 0.008 1.01
27385 27385-insertC|(ORF6_protein:184insertC(62fs)) 2223 0.895 3 0.001 7 0.001 2 0.001 8 0.002 22 0.005 7 0.002 7 0.897 0.01 0.907
27431 C27431T|(ORF7a_protein:C38T(A13V)) 1331 0.488 3013 0.61 4 0.002 3 1.09799999999999 0.002 1.09999999999999
28048 G28048T|(ORF8_protein:G155T(R52I)) 71 0.321 4 0.003 2 0.324 0 0.324
28791 C28791T|(nucleocapsid_phosphoprotein:C518T(A173V)) 22310 0.1 11742 0.192 2 0.292 0 0.292
29728 TTCACCGAGGCCACGCGGAGTACGATCGAGTGTACAGTGAACA29728-29770del 14417 0.567 16428 0.103 2 0.669999999999999 0 0.669999999999999