NY-7 - Complete Raw Mutation Data

Full TSV data with all sample columns and abundance information
← Back to Dashboard

Complete Mutations Data

This table shows the complete data from the mutations.tsv file exactly as it appears in the source. Scroll horizontally to see all columns.

Unnamed: 0 Unnamed: 1 Unnamed: 2 Unnamed: 3 SRR25343383 Unnamed: 5 SRR25503755 Unnamed: 7 SRR25826508 Unnamed: 9 SRR26162971 Unnamed: 11 SRR25343222 Unnamed: 13 SRR25343349 Unnamed: 15 SRR25503709 Unnamed: 17 SRR25503723 Unnamed: 19 SRR25503782 Unnamed: 21 SRR25826445 Unnamed: 23 SRR25826536 Unnamed: 25 SRR25826568 Unnamed: 27 SRR26099256 Unnamed: 29 SRR26099379 Unnamed: 31 SRR26099388 Unnamed: 33 Unnamed: 34 Unnamed: 35 Unnamed: 36 Unnamed: 37 Unnamed: 38 Key Unnamed: 40
('2023-07-09/2023-07-10', '588772.0') ('2023-07-23/2023-07-24', '588772.0') ('2023-08-20/2023-08-21', '588772.0') ('2023-09-05/2023-09-06', '588772.0') ('2023-07-09/2023-07-10', '192050.0') ('2023-07-09/2023-07-10', '198128.0') ('2023-07-23/2023-07-24', '192050.0') ('2023-07-23/2023-07-24', '198128.0') ('2023-07-23/2023-07-24', '244918.0') ('2023-08-20/2023-08-21', '192050.0') ('2023-08-20/2023-08-21', '244918.0') ('2023-08-20/2023-08-21', '198128.0') ('2023-09-05/2023-09-06', '192050.0') ('2023-09-05/2023-09-06', '244918.0') ('2023-09-05/2023-09-06', '198128.0') Cryptic Sewershed
Linked/Ubiquitous Position Flagged Sequences Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Total samples Positives Sum Negatives Sum Total Sum Non-Cryptic Sewershed
213 G213A 5 0.002 1139 0.142 2 0.001 15 0.001 3 0.002 5 0.144 0.004 0.148
linked 241 Delta C241T 2571 0.998 6622 0.999 1706 0.998 1525 0.997 10746 0.998 1059 0.995 726 0.996 9722 0.999 1155 0.998 539 1 10 1.99699999999999 7.981 9.978
2113 C2113A|(ORF1ab_polyprotein:C1848A(I616I))|(ORF1a_polyprotein:C1848A(I616I)) 100 0.001 38 0.001 55 0.001 6472 0.129 11 0.001 2 0.001 77 0.001 32 0.002 135 0.001 24 0.001 10 0.132 0.007 0.139
3541 T3541A|(ORF1ab_polyprotein:T3276A(A1092A))|(ORF1a_polyprotein:T3276A(A1092A)) 4 0.001 914 0.117 2 0.118 0 0.118
ubiq 4184 G4184A|(ORF1ab_polyprotein:G3919A(G1307S))|(ORF1a_polyprotein:G3919A(G1307S)) 41343 0.997 83227 0.996 76405 0.996 88796 0.998 12828 0.997 444 1 134829 0.996 36928 0.996 41970 0.996 274301 0.996 60352 0.996 50826 0.997 245492 0.998 25571 0.998 18601 0.998 15 3.987 10.968 14.955
ubiq 4321 C4321T|(ORF1ab_polyprotein:C4056T(A1352A))|(ORF1a_polyprotein:C4056T(A1352A)) 37368 0.994 75966 0.993 68598 0.994 64114 0.996 11625 0.995 376 0.997 120341 0.993 33154 0.993 40048 0.994 243653 0.993 52832 0.993 47148 0.994 229505 0.997 23778 0.997 16938 0.997 15 3.977 10.943 14.92
linked 5115 C5115T|(ORF1ab_polyprotein:ACA4849-4851ATG(T1617M))|(ORF1a_polyprotein:ACA4849-4851ATG(T1617M)) 2 0.018 2 0.003 2 0.0209999999999999 0 0.0209999999999999
5116 RATG13 A5116G|(ORF1ab_polyprotein:ACA4849-4851ATG(T1617M))|(ORF1a_polyprotein:ACA4849-4851ATG(T1617M)) 2 0.667 2 0.006 2 0.673 0 0.673
ubiq 9344 C9344T|(ORF1ab_polyprotein:C9079T(L3027F))|(ORF1a_polyprotein:C9079T(L3027F)) 3676 0.999 300 0.99 8198 0.996 4090 0.877 2434 0.998 182 1 1969 0.996 33 1 1172 0.993 23153 0.997 4996 0.996 2209 0.996 4585 0.999 909 1 673 0.994 15 3.862 10.969 14.831
ubiq 10029 C10029T|(ORF1ab_polyprotein:C9764T(T3255I))|(ORF1a_polyprotein:C9764T(T3255I)) 154 1 113 0.991 787 0.99 614 0.998 348 0.989 210 0.986 41 1 2745 0.994 258 0.996 647 1 578 0.998 202 1 108 1 13 3.979 8.963 12.942
ubiq 10198 C10198T|(ORF1ab_polyprotein:C9933T(D3311D))|(ORF1a_polyprotein:C9933T(D3311D)) 189 0.995 120 1 771 0.995 752 0.996 346 0.997 224 0.996 59 1 2575 0.995 265 0.989 706 0.999 569 0.996 197 1 100 1 13 3.98599999999999 8.972 12.9579999999999
ubiq 10447 RATG13 G10447A|(ORF1ab_polyprotein:G10182A(R3394R))|(ORF1a_polyprotein:G10182A(R3394R)) 41367 0.935 49241 0.997 81914 0.996 35873 0.998 17647 0.998 4333 0.998 31167 0.995 22226 0.997 12301 0.997 86498 0.996 39587 0.996 46999 0.996 45985 0.998 21291 0.998 7690 0.999 15 3.926 10.968 14.894
ubiq 10449 C10449A|(ORF1ab_polyprotein:C10184A(P3395H))|(ORF1a_polyprotein:C10184A(P3395H)) 41337 0.935 49180 0.995 81879 0.995 35879 0.998 17624 0.997 4329 0.997 31155 0.995 22173 0.994 12289 0.996 86462 0.995 39560 0.995 46967 0.995 46006 0.998 21280 0.998 7680 0.997 15 3.923 10.957 14.88
11005 Delta C11005A|(ORF1ab_polyprotein:C10740A(H3580Q))|(ORF1a_polyprotein:C10740A(H3580Q)) 11470 0.998 8 0.001 31 0.001 3 0.999 0.001 1
ubiq 11288 TCTGGTTTT11288-11296del|(ORF1ab_polyprotein:11023-11031del(SGF3675-3677del))|(ORF1a_polyprotein:11023-11031del(SGF3675-3677del)) 11137 0.998 2266 0.996 16539 0.998 5486 0.997 4354 0.998 457 0.998 8973 0.996 519 0.992 1033 0.993 36475 0.997 9237 0.997 6137 0.996 12938 0.998 4336 0.999 2833 0.998 15 3.989 10.962 14.951
ubiq 12880 C12880T|(ORF1ab_polyprotein:C12615T(I4205I))|(ORF1a_polyprotein:C12615T(I4205I)) 6467 0.998 21008 0.871 29300 0.996 20158 0.997 7484 0.998 114 1 9563 0.995 1875 0.994 3521 0.997 53813 0.996 28559 0.996 18111 0.994 17491 0.997 2336 0.921 3071 0.998 15 3.862 10.886 14.748
14267 C14267T|(ORF1ab_polyprotein:C14003T(T4668M)) 57 0.001 61 0.001 6242 0.15 13 0.001 34 0.001 21 0.001 70 0.001 12 0.001 9 0.001 9 0.152 0.006 0.158
ubiq 14408 Delta C14408T|(ORF1ab_polyprotein:C14144T(P4715L)) 11912 0.998 3891 0.996 11444 0.997 18170 0.999 775 0.997 11887 0.997 2122 0.996 3768 0.996 11752 0.998 6293 0.997 4249 0.997 18405 0.998 3025 0.999 2357 0.995 14 3.99 9.97 13.96
ubiq 15451 G15451A|(ORF1ab_polyprotein:G15187A(G5063S)) 2201 0.995 4385 0.996 8649 0.996 41766 0.998 1124 0.997 17566 0.994 5219 0.997 20084 0.995 16772 0.996 7372 0.994 40565 0.998 12656 0.998 3722 0.998 13 3.985 8.967 12.952
ubiq 15714 RATG13 C15714T|(ORF1ab_polyprotein:C15450T(L5150L)) 2889 0.998 2374 0.995 5553 0.997 24422 0.986 315 0.991 546 1 11897 0.995 2801 0.995 13114 0.996 7834 0.995 3862 0.996 20961 0.998 5911 0.997 2319 0.999 14 3.976 9.962 13.9379999999999
ubiq 15738 C15738T|(ORF1ab_polyprotein:C15474T(F5158F)) 3041 0.996 339 0.994 3419 0.995 2492 0.839 509 0.996 51 0.981 3082 0.994 184 0.995 6702 0.996 433 0.991 958 0.995 3883 0.994 875 0.995 903 0.998 14 3.824 9.935 13.759
ubiq 15939 T15939C|(ORF1ab_polyprotein:T15675C(D5225D)) 3642 0.998 435 0.993 4959 0.996 2837 0.853 693 0.994 58 1 3842 0.996 213 0.995 8894 0.997 655 0.997 1352 0.994 4746 0.998 1115 0.997 1177 1 14 3.84 9.968 13.808
ubiq 17410 C17410T|(ORF1ab_polyprotein:C17146T(R5716C)) 15277 0.998 5724 0.997 23436 0.996 17512 0.999 2156 0.998 2220 0.998 11605 0.997 2168 0.997 9224 0.997 81800 0.996 16376 0.997 14841 0.997 56124 0.998 7760 0.998 4475 0.999 15 3.99 10.972 14.962
17795 C17795T|(ORF1ab_polyprotein:C17531T(A5844V)) 134301 0.143 324 0.001 561 0.001 423 0.002 355 0.002 895 0.001 62 0.001 125 0.001 8 0.145 0.007 0.152
linkedubiq 17859 T17859C|(ORF1ab_polyprotein:T17595C(Y5865Y)) 506762 0.996 108697 0.996 146628 0.997 307083 0.998 131480 0.992 124034 0.996 236177 0.996 202942 0.996 112077 0.996 383387 0.99 32217 0.996 52842 0.996 268369 0.998 78265 0.998 80191 0.998 15 3.987 10.952 14.939
ubiq 18163 A18163G|(ORF1ab_polyprotein:A17899G(I5967V)) 8752 0.996 2776 0.995 7859 0.996 6298 0.997 444 0.507 893 0.997 2730 0.995 630 0.995 1257 0.997 12595 0.996 2309 0.995 2488 0.997 5408 0.999 2443 0.998 1959 0.999 15 3.984 10.475 14.459
ubiq 19955 C19955T|(ORF1ab_polyprotein:C19691T(T6564I)) 1156 0.998 256 1 2297 0.997 29863 0.998 1933 0.998 8776 0.997 8573 0.846 531 0.994 1705 0.996 9744 0.995 2423 0.992 447 0.998 28205 0.998 1655 0.998 1001 0.997 15 3.993 10.809 14.802
ubiq 20055 A20055G|(ORF1ab_polyprotein:A19791G(E6597E)) 2773 0.991 477 0.977 5241 0.99 44182 0.997 2433 0.995 9733 0.996 11756 0.871 896 0.976 1761 0.989 12270 0.988 3497 0.98 1676 0.983 30238 0.991 1958 0.989 1201 0.994 15 3.955 10.752 14.707
20409 T20409A|(ORF1ab_polyprotein:T20145A(F6715L)) 576 0.138 3 0.003 61 0.015 3 0.156 0 0.156
ubiq 21618 C21618T|(surface_glycoprotein:C56T(T19I)) 31496 0.999 43097 0.998 86164 0.997 59879 0.94 1101 1 8029 0.998 45279 0.997 2 1 2294 0.998 126428 0.997 68188 0.998 28978 0.997 100788 0.999 41595 0.999 18376 0.998 15 3.934 10.981 14.915
ubiq 21633 TACCCCCTG21633-21641del|(surface_glycoprotein:TTACCCCCTGCA70-81TCAdel(LPPA24-27Sdel)) 32563 0.998 40591 0.994 79781 0.996 60736 0.998 1140 1 7181 0.998 39494 0.995 2 1 2387 0.996 119813 0.996 69102 0.994 25675 0.995 93716 0.998 39998 0.997 17414 0.998 15 3.98599999999999 10.967 14.953
ubiq 21810 T21810C|(surface_glycoprotein:T248C(V83A)) 40481 0.995 33662 0.994 64286 0.993 36144 0.997 1300 0.992 4798 0.996 16940 0.994 2 1 3101 0.995 110302 0.994 74456 0.993 15687 0.993 74251 0.997 38411 0.997 14758 0.998 15 3.979 10.949 14.928
22191 T22191C|(surface_glycoprotein:T629C(I210T)) 306 0.099 914 0.084 2 0.183 0 0.183
linkedubiq 22200 T22200A|(surface_glycoprotein:T638A(V213E)) 11558 0.997 3377 0.997 9870 0.996 20645 0.998 5262 0.997 1744 0.998 17572 0.996 3645 0.993 2722 0.997 40120 0.997 8640 0.996 3433 0.998 19213 0.999 5718 0.998 2407 0.999 15 3.988 10.968 14.956
ubiq 22577 G22577C|(surface_glycoprotein:GGT1015-1017CAT(G339H)) 1777 0.996 487 0.986 1750 0.993 844 1 440 0.998 566 0.993 2222 0.996 545 0.995 3310 0.994 495 0.988 15 1 3801 0.997 411 0.995 419 0.995 14 3.975 9.951 13.926
ubiq 22578 G22578A|(surface_glycoprotein:GGT1015-1017CAT(G339H)) 1777 0.996 487 0.986 1750 0.993 844 1 440 0.998 566 0.993 2222 0.996 545 0.995 3310 0.994 495 0.988 15 1 3801 0.997 411 0.995 419 0.995 14 3.975 9.951 13.926
ubiq 22599 RATG13 G22599C|(surface_glycoprotein:G1037C(R346T)) 1705 0.996 468 0.996 1732 0.997 813 0.999 415 1 573 1 2194 0.994 529 0.998 3300 0.994 481 0.998 14 1 3655 0.998 416 1 377 0.911 14 3.988 9.893 13.881
ubiq 22664 C22664A|(surface_glycoprotein:C1102A(L368I)) 2081 0.999 515 0.996 2080 0.997 949 0.998 526 0.998 718 0.996 2426 0.995 642 0.997 3812 0.996 596 0.995 19 1 4414 0.999 484 0.998 485 1 14 3.99 9.974 13.964
ubiq 22674 C22674T|(surface_glycoprotein:C1112T(S371F)) 1934 0.999 488 0.998 1942 0.996 888 0.999 510 1 668 0.997 2265 0.996 584 0.992 3545 0.996 564 0.995 18 1 4164 0.997 451 0.998 453 0.998 14 3.992 9.969 13.9609999999999
ubiq 22679 T22679C|(surface_glycoprotein:T1117C(S373P)) 1950 0.996 488 0.992 1945 0.996 893 0.999 508 0.998 665 0.998 2264 0.996 589 0.992 3575 0.998 570 0.997 18 1 4184 0.997 451 1 454 1 14 3.983 9.97599999999999 13.959
ubiq 22686 C22686T|(surface_glycoprotein:C1124T(S375F)) 2006 0.998 518 0.998 1984 0.992 944 0.998 522 1 665 0.993 2314 0.996 604 0.995 3653 0.997 575 0.995 17 1 4299 0.994 450 0.998 456 0.998 14 3.98599999999999 9.966 13.9519999999999
ubiq 22688 A22688G|(surface_glycoprotein:A1126G(T376A)) 1999 0.995 517 0.996 1985 0.992 944 0.998 522 1 669 0.999 2310 0.994 603 0.993 3647 0.995 577 0.998 17 1 4312 0.997 362 0.803 456 0.998 14 3.981 9.777 13.758
ubiq 22786 A22786C|(surface_glycoprotein:A1224C(R408S)) 39491 0.956 25061 0.929 26343 0.993 30662 0.926 14820 0.994 1155 0.995 26169 0.931 4402 0.995 51078 0.993 11890 0.994 7829 0.994 48676 0.997 13392 0.996 1872 0.995 14 3.804 9.884 13.688
22812 A22812C|(surface_glycoprotein:A1250C(K417T)) 2966 0.05 3371 0.089 4082 0.089 3 0.227999999999999 0 0.227999999999999
22907 T22907A|(surface_glycoprotein:T1345A(Y449N)) 3523 0.047 3365 0.073 3201 0.079 3 0.199 0 0.199
22910 A22910G|(surface_glycoprotein:A1348G(N450D)) 3508 0.045 3332 0.07 3199 0.077 3 0.192 0 0.192
22920 A22920T|(surface_glycoprotein:A1358T(Y453F)) 3783 0.044 3750 0.071 3544 0.077 3 0.192 0 0.192
ubiq 22992 G22992A|(surface_glycoprotein:G1430A(S477N)) 52420 0.951 36961 0.997 50097 0.997 29424 0.914 19013 0.998 887 0.998 33257 0.997 5396 0.997 80066 0.997 21186 0.998 12899 0.998 63991 0.998 18613 0.999 2166 0.998 14 3.859 9.978 13.837
23010 T23010C|(surface_glycoprotein:T1448C(V483A)) 1720 0.036 1762 0.066 60 0.001 3 0.102 0.001 0.103
linkedubiq 23013 A23013C|(surface_glycoprotein:A1451C(E484A)) 43758 0.996 27409 0.935 42207 0.995 24565 0.998 15240 0.996 714 0.994 27028 0.996 4495 0.997 67044 0.995 17912 0.995 10818 0.994 51192 0.997 15272 0.998 1763 0.998 14 3.924 9.96 13.884
ubiq 23018 RATG13 T23018C|(surface_glycoprotein:TTT1456-1458CCT(F486P)) 39655 0.971 25895 0.932 40173 0.997 20964 0.956 14302 0.997 678 1 25307 0.997 4230 0.996 63755 0.997 17080 0.997 10299 0.997 48213 0.998 14376 0.998 1661 0.999 14 3.856 9.97599999999999 13.8319999999999
ubiq 23019 T23019C|(surface_glycoprotein:TTT1456-1458CCT(F486P)) 39655 0.971 25895 0.932 40173 0.997 20964 0.956 14302 0.997 678 1 25307 0.997 4230 0.996 63755 0.997 17080 0.997 10299 0.997 48213 0.998 14376 0.998 1661 0.999 14 3.856 9.97599999999999 13.8319999999999
23039 C23039A|(surface_glycoprotein:C1477A(Q493K)) 928 0.023 1537 0.054 742 0.028 3 0.105 0 0.105
ubiq 23055 A23055G|(surface_glycoprotein:A1493G(Q498R)) 31247 0.972 21368 0.938 30421 0.997 20762 0.968 12162 0.999 548 0.995 22209 0.996 3576 0.998 48912 0.997 13422 0.997 8196 0.997 40997 0.998 11640 0.999 1435 0.997 14 3.875 9.973 13.848
ubiq 23063 A23063T|(surface_glycoprotein:A1501T(N501Y)) 31902 0.998 22166 0.996 30250 0.995 21342 0.998 12098 0.998 546 0.995 22050 0.994 3547 0.995 48593 0.997 13342 0.996 8139 0.995 40797 0.998 11589 0.998 1434 1 14 3.987 9.966 13.953
ubiq 23075 RATG13 T23075C|(surface_glycoprotein:T1513C(Y505H)) 25654 0.978 18620 0.997 24156 0.997 18319 0.973 10058 0.998 478 0.996 18868 0.997 3006 0.999 38911 0.997 10912 0.998 6691 0.997 34371 0.999 9738 0.999 1225 0.999 14 3.945 9.979 13.924
ubiq 23403 Delta A23403G|(surface_glycoprotein:A1841G(D614G)) 107177 0.997 21348 0.996 58132 0.995 76732 0.998 30156 0.996 14303 0.997 56364 0.995 42343 0.994 1067 0.998 84165 0.995 32238 0.995 24509 0.996 81099 0.998 23084 0.997 9956 0.999 15 3.98599999999999 10.96 14.946
ubiq 23525 C23525T|(surface_glycoprotein:C1963T(H655Y)) 876 1 171 1 607 0.997 5158 0.91 577 0.997 196 1 1080 0.997 325 0.997 129 0.992 3637 0.998 237 1 1514 0.998 1005 0.997 177 1 134 1 15 3.907 10.9759999999999 14.883
ubiq 23599 T23599G|(surface_glycoprotein:T2037G(N679K)) 7702 0.999 8875 0.997 9869 0.998 41182 0.994 3361 0.997 10267 0.999 47790 0.998 5507 0.999 4936 0.997 28797 0.998 10386 0.998 6691 0.999 21524 0.999 6428 0.998 2581 1 15 3.988 10.982 14.9699999999999
ubiq 23604 C23604A|(surface_glycoprotein:C2042A(P681H)) 7945 0.999 9190 0.998 10137 0.998 42623 0.996 3484 0.999 10681 0.999 49742 0.998 5679 0.997 5139 0.997 29702 0.998 10650 0.997 6881 0.998 22382 0.999 6641 0.998 2662 0.999 15 3.991 10.979 14.9699999999999
ubiq 23854 C23854A|(surface_glycoprotein:C2292A(N764K)) 8599 0.997 10286 0.994 8769 0.995 50185 0.997 3880 0.997 13495 0.996 64916 0.994 6370 0.994 6330 0.995 30516 0.995 9181 0.994 6222 0.995 27965 0.996 7443 0.997 2799 0.998 15 3.983 10.951 14.934
ubiq 25416 C25416T|(ORF3a_protein:C24T(F8F)) 87685 0.998 8652 0.996 25526 0.869 47860 0.998 3085 0.986 339 0.997 63158 0.995 5497 0.995 4976 0.727 49740 0.996 8537 0.997 12547 0.997 54317 0.998 6756 0.997 7200 0.999 15 3.86099999999999 10.684 14.5449999999999
ubiq 25584 C25584T|(ORF3a_protein:C192T(T64T)) 217639 0.997 20187 0.995 83353 0.92 71620 0.919 7273 0.996 622 0.998 131408 0.995 11685 0.995 15381 0.995 141913 0.996 26707 0.995 36817 0.995 122448 0.998 15634 0.998 14729 0.926 15 3.831 10.887 14.718
26527 C26527A|(membrane_glycoprotein:C5A(A2E)) 1243 0.116 3019 0.254 5 0.001 140 0.001 4 0.37 0.002 0.372
26529 G26529A|(membrane_glycoprotein:G7A(D3N)) 1233 0.113 3011 0.25 2 0.363 0 0.363
26538 G26538A|(membrane_glycoprotein:G16A(G6S)) 1206 0.11 2942 0.248 2 0.358 0 0.358
26549 C26549T|(membrane_glycoprotein:C27T(T9T)) 1088 0.103 2282 0.224 2 0.327 0 0.327
26554 A26554G|(membrane_glycoprotein:GAA31-33GGT(E11G)) 970 0.096 2108 0.217 2 0.313 0 0.313
26555 A26555T|(membrane_glycoprotein:GAA31-33GGT(E11G)) 970 0.093 2108 0.212 2 0.305 0 0.305
26558 G26558T|(membrane_glycoprotein:G36T(E12D)) 978 0.095 2124 0.216 7 0.002 118 0.001 4 0.311 0.003 0.314
26604 T26604C|(membrane_glycoprotein:T82C(F28L)) 1183 0.117 2659 0.264 2 0.381 0 0.381
ubiq 26709 G26709A|(membrane_glycoprotein:G187A(A63T)) 114965 0.994 7896 0.876 48076 0.949 93667 0.984 41097 0.994 5512 0.994 82490 0.99 31733 0.989 3665 0.994 211996 0.993 27090 0.993 32984 0.991 111422 0.996 18919 0.997 4472 0.996 15 3.803 10.927 14.73
ubiq 26858 C26858T|(membrane_glycoprotein:C336T(F112F)) 118360 0.998 2426 0.995 50586 0.997 69620 0.984 41451 0.998 5759 0.999 87608 0.996 34016 0.995 1092 0.994 182282 0.996 26097 0.996 36993 0.996 100044 0.998 18852 0.998 4405 0.999 15 3.974 10.965 14.939
27032 T27032C|(membrane_glycoprotein:T510C(V170V)) 3247 0.116 3240 0.082 2 0.198 0 0.198
27213 C27213T|(ORF6_protein:C12T(L4L)) 8254 0.315 2832 0.105 6130 0.151 3 0.571 0 0.571
ubiq 28271 A28271T 12087 0.998 2948 0.996 22716 0.997 146350 0.998 2906 0.999 10355 0.997 6087 0.997 9552 0.996 37333 0.997 139110 0.997 49557 0.997 18305 0.997 78250 0.999 40780 0.999 7981 0.999 15 3.989 10.974 14.963
ubiq 28311 C28311T|(nucleocapsid_phosphoprotein:C38T(P13L)) 9260 0.998 2387 0.996 17289 0.997 100926 0.999 2296 0.999 8337 0.999 4927 0.996 7535 0.997 31217 0.996 111513 0.997 36933 0.997 13429 0.998 63389 0.999 32051 0.999 5948 0.999 15 3.99 10.9759999999999 14.966
ubiq 28362 GAGAACGCA28362-28370del|(nucleocapsid_phosphoprotein:GGAGAACGCAGT88-99GGTdel(GERS30-33Gdel)) 8343 0.998 2086 0.994 14678 0.995 96010 0.998 2062 0.998 7470 0.997 4489 0.996 6803 0.995 27400 0.995 95488 0.996 32222 0.995 11757 0.995 57950 0.998 29131 0.998 5514 0.998 15 3.985 10.961 14.946
29527 G29527T|(nucleocapsid_phosphoprotein:G1254T(Q418H)) 17767 0.047 13518 0.071 3119 0.006 3 0.124 0 0.124
ubiq 29734 GAGGCCACGCGGAGTACGATCGAGTG29734-29759del 110876 0.998 105061 0.892 113581 0.998 216723 0.999 45385 0.998 49794 0.998 183742 0.997 44067 0.997 106730 0.998 353754 0.998 115007 0.998 110508 0.998 340096 0.999 86394 0.999 52995 0.995 15 3.887 10.975 14.862