OH-2 - Complete Raw Mutation Data

Full TSV data with all sample columns and abundance information
← Back to Dashboard

Complete Mutations Data

This table shows the complete data from the mutations.tsv file exactly as it appears in the source. Scroll horizontally to see all columns.

SRR31681890(982142) SRR31681912(1542478) SRR31681924(915862) SRR31683471(67123) SRR31683513(9126) SRR31683516(36359) SRR31683545(25055) SRR31683549(26575) SRR31683558(29390) SRR31683566(20771) SRR31683582(7591) SRR31683586(32568) SRR31683651(36466) SRR31683673(14263) SRR31683713(27950) SRR31683714(105466) SRR31683811(99840) SRR31683836(53853) SRR31683883(76475) SRR31683913(53607) SRR31683918(58794) SRR31683927(58221) SRR31683962(42333) SRR31684008(78970) SRR31684011(38446) SRR31684028(28445) SRR31684047(94592) SRR31684097(43667) SRR31684124(13718) SRR31684127(60379) SRR31684128(42641) SRR31684145(65406) SRR31684213(58865) SRR31684216(54745) SRR31684224(82185) SRR31684228(91397) SRR31684233(79845) SRR31684256(63530) SRR31684266(69349) SRR31684268(78631) SRR31684319(24279) SRR31684331(14908) SRR31684378(35181) SRR31684428(72052) SRR31684437(65514) SRR31684455(50359) SRR31684462(34035) SRR31684519(63555) SRR31684529(57743) SRR31684550(76964) SRR31684553(78998) SRR31684598(9021) SRR31684607(78632) SRR31684647(24077) SRR31684676(70299) SRR31684677(77453) SRR31684756(87192) SRR31684771(53503) SRR31684848(137956) SRR31684852(57014)
"('2024-06-09', '488000')" "('2024-06-09', '313158')" "('2024-06-09', '322446')" "('2024-07-14', '322446')" "('2024-11-12', '322446')" "('2024-11-12', '313158')" "('2024-10-27', '313158')" "('2024-10-27', '488000')" "('2024-10-20', '313158')" "('2024-10-20', '488000')" "('2024-10-15', '313158')" "('2024-10-15', '488000')" "('2024-09-08', '313158')" "('2024-11-17', '488000')" "('2024-11-03', '488000')" "('2024-10-27', '322446')" "('2024-09-22', '313158')" "('2024-09-15', '313158')" "('2024-08-18', '322446')" "('2024-08-11', '322446')" "('2024-08-11', '488000')" "('2024-08-04', '322446')" "('2024-07-21', '313158')" "('2024-07-07', '322446')" "('2024-11-17', '313158')" "('2024-11-17', '322446')" "('2024-11-03', '313158')" "('2024-10-15', '322446')" "('2024-09-29', '488000')" "('2024-09-29', '313158')" "('2024-09-29', '322446')" "('2024-09-22', '322446')" "('2024-09-03', '313158')" "('2024-09-03', '322446')" "('2024-08-25', '313158')" "('2024-08-25', '488000')" "('2024-08-25', '322446')" "('2024-10-06', '488000')" "('2024-10-06', '313158')" "('2024-10-06', '322446')" "('2024-09-08', '322446')" "('2024-09-08', '488000')" "('2024-08-18', '488000')" "('2024-07-28', '488000')" "('2024-07-21', '488000')" "('2024-07-21', '322446')" "('2024-08-18', '313158')" "('2024-07-28', '313158')" "('2024-07-28', '322446')" "('2024-07-14', '488000')" "('2024-07-14', '313158')" "('2024-11-12', '488000')" "('2024-11-03', '322446')" "('2024-10-20', '322446')" "('2024-09-15', '488000')" "('2024-09-15', '322446')" "('2024-08-11', '313158')" "('2024-08-04', '313158')" "('2024-07-07', '313158')" "('2024-07-07', '488000')"
Sequences Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Total samples Positives Sum Negatives Sum Total Sum
21 C21T 53 1.000 5 1.000 2 2.0 0 2.0
44 C44T 53 1.000 5 1.000 2 2.0 0 2.0
169 A169T 69 0.188 179 0.411 21 0.068 2 0.006 3 0.004 25 0.087 22 0.038 214 0.686 8 1.482 0.006 1.488
178 A178G 81 0.551 55 1.000 335 0.889 296 0.641 36 0.174 42 0.129 207 0.556 341 1.000 635 0.892 232 0.844 498 0.820 286 0.908 12 8.404 0 8.404
309 A309T|(ORF1ab_polyprotein:A44T(Q15L))|(ORF1a_polyprotein:A44T(Q15L)) 123 0.309 124 0.242 43 0.178 52 0.158 111 0.312 633 0.820 2 0.024 127 0.407 110 0.183 77 0.232 10 2.8410000000000000 0.024 2.8650000000000000
329 C329A|(ORF1ab_polyprotein:C64A(Q22K))|(ORF1a_polyprotein:C64A(Q22K)) 4 0.070 76 0.209 139 0.277 45 0.142 212 0.650 100 0.148 58 0.200 135 0.237 46 0.149 9 2.082 0 2.082
337 C337T|(ORF1ab_polyprotein:C72T(R24R))|(ORF1a_polyprotein:C72T(R24R)) 52 1.000 267 0.853 244 0.552 37 0.167 40 0.135 197 0.597 323 0.997 548 0.868 217 0.841 430 0.817 83 0.303 11 7.13 0 7.13
344 C344T|(ORF1ab_polyprotein:C79T(L27F))|(ORF1a_polyprotein:C79T(L27F)) 48 1.000 258 0.857 182 0.422 35 0.161 39 0.133 185 0.597 315 0.997 535 0.856 195 0.762 415 0.825 210 0.808 11 7.418 0 7.418
378 RATG13 T378C|(ORF1ab_polyprotein:T113C(V38A))|(ORF1a_polyprotein:T113C(V38A)) 870 0.617 40 1.000 139 0.543 181 0.519 21 0.130 22 0.121 21 0.089 146 0.555 35 0.067 25 0.118 114 0.559 195 0.457 139 0.662 13 5.437 0 5.437
437 A437G|(ORF1ab_polyprotein:A172G(K58E))|(ORF1a_polyprotein:A172G(K58E)) 822 0.340 22 0.361 84 0.724 42 0.333 2 0.062 46 0.730 44 0.657 75 0.688 8 3.895 0 3.895
449 C449T|(ORF1ab_polyprotein:C184T(P62S))|(ORF1a_polyprotein:C184T(P62S)) 4 0.114 80 0.833 43 0.352 37 0.771 47 1.000 41 0.526 6 3.596 0 3.596
511 RATG13 T511C|(ORF1ab_polyprotein:T246C(G82G))|(ORF1a_polyprotein:T246C(G82G)) 1729 0.997 3 1.000 32 0.800 115 0.927 51 0.370 2 0.400 47 1.000 80 0.988 3 1.000 87 1.000 66 0.930 11 9.412 0 9.412
561 G561A|(ORF1ab_polyprotein:G296A(R99H))|(ORF1a_polyprotein:G296A(R99H)) 22 0.667 47 0.395 11 0.196 3 1.258 0 1.258
599 G599T|(ORF1ab_polyprotein:GGC334-336TAC(G112Y))|(ORF1a_polyprotein:GGC334-336TAC(G112Y)) 494 0.276 94 0.879 33 0.327 42 0.700 72 1.000 2 0.333 70 0.897 7 4.412 0 4.412
600 G600A|(ORF1ab_polyprotein:GGC334-336TAC(G112Y))|(ORF1a_polyprotein:GGC334-336TAC(G112Y)) 494 0.276 94 0.879 33 0.327 42 0.700 72 1.000 2 0.333 70 0.897 7 4.412 0 4.412
606 RATG13 T606C|(ORF1ab_polyprotein:T341C(I114T))|(ORF1a_polyprotein:T341C(I114T)) 556 0.303 103 0.904 34 0.327 43 0.705 78 1.000 2 0.333 76 0.894 7 4.466 0 4.466
632 C632T|(ORF1ab_polyprotein:C367T(L123F))|(ORF1a_polyprotein:C367T(L123F)) 12 0.600 47 0.405 55 0.982 68 1.000 2 0.286 5 3.273 0 3.273
669 GTT669-671del|(ORF1ab_polyprotein:AGTTAC403-408AACdel(SY135-136Ndel))|(ORF1a_polyprotein:AGTTAC403-408AACdel(SY135-136Ndel)) 171 1.000 129 0.166 15 0.012 3 1.178 0 1.178
670 T670A|(ORF1ab_polyprotein:T405A(S135R))|(ORF1a_polyprotein:T405A(S135R)) 89 0.390 113 0.321 224 0.821 57 0.077 425 0.352 5 1.9610000000000000 0 1.9610000000000000
783 TCATGCGTGAG783-793del|(ORF1ab_polyprotein:518-528del(173fs))|(ORF1a_polyprotein:518-528del(173fs)) 187 0.989 84 0.236 3 0.005 309 0.984 107 1.000 4 0.010 3 0.010 128 0.086 195 0.100 9 3.42 0 3.42
795 T795-795del|(ORF1ab_polyprotein:530-530del(177fs))|(ORF1a_polyprotein:530-530del(177fs)) 187 0.820 84 0.228 3 0.005 309 0.901 107 0.823 4 0.009 3 0.010 128 0.084 194 0.093 9 2.973 0 2.973
804 G804A|(ORF1ab_polyprotein:G539A(G180E))|(ORF1a_polyprotein:G539A(G180E)) 2 0.003 88 0.226 4 0.007 139 0.986 4 0.009 3 0.010 168 0.105 241 0.107 8 1.453 0 1.453
856 T856A|(ORF1ab_polyprotein:T591A(P197P))|(ORF1a_polyprotein:T591A(P197P)) 16194 0.998 287 0.471 292 1.000 131 0.297 3 0.002 395 0.997 4 0.001 192 0.995 5 0.003 2 0.005 2 0.002 4 0.004 4 0.014 12 0.022 4 0.004 5 0.005 5 0.004 4 0.003 4 0.006 2 0.014 2 0.003 628 0.361 5 0.003 2 0.002 827 0.321 25 5.469 0.068 5.537
1087 A1087G|(ORF1ab_polyprotein:A822G(V274V))|(ORF1a_polyprotein:A822G(V274V)) 401 0.745 3 1.000 9 0.500 11 0.131 3 0.054 5 2.43 0 2.43
1562 T1562A|(ORF1ab_polyprotein:T1297A(C433S))|(ORF1a_polyprotein:T1297A(C433S)) 1246 0.434 10 1.000 2 1.000 5 1.000 12 0.600 8 0.258 6 4.292 0 4.292
1599 G1599T|(ORF1ab_polyprotein:G1334T(G445V))|(ORF1a_polyprotein:G1334T(G445V)) 1201 0.438 25 0.926 37 0.529 8 0.533 25 0.694 9 0.150 15 0.333 26 1.000 15 0.283 9 4.886 0 4.886
1620 A1620C|(ORF1ab_polyprotein:A1355C(E452A))|(ORF1a_polyprotein:A1355C(E452A)) 1264 0.521 5 0.152 63 0.913 135 0.818 4 2.404 0 2.404
1912 C1912T|(ORF1ab_polyprotein:C1647T(S549S))|(ORF1a_polyprotein:C1647T(S549S)) 22 0.141 10 0.161 14 0.103 2 0.019 74 1.000 29 1.000 47 0.197 7 2.621 0 2.621
2126 T2126C|(ORF1ab_polyprotein:T1861C(Y621H))|(ORF1a_polyprotein:T1861C(Y621H)) 101 1.000 2 0.004 97 0.336 458 0.787 4 2.123 0.004 2.1270000000000000
2470 RATG13 C2470T|(ORF1ab_polyprotein:C2205T(A735A))|(ORF1a_polyprotein:C2205T(A735A)) 3711 0.996 94 0.979 110 0.659 80 0.899 199 1.000 10 1.000 517 0.985 10 0.286 269 0.928 9 7.732 0 7.732
2658 A2658T|(ORF1ab_polyprotein:A2393T(K798M))|(ORF1a_polyprotein:A2393T(K798M)) 4 0.222 11 1.000 5 0.147 3 1.369 0 1.369
2710 RATG13 C2710T|(ORF1ab_polyprotein:C2445T(L815L))|(ORF1a_polyprotein:C2445T(L815L)) 5 0.278 9 1.000 2 0.057 3 1.335 0 1.335
2753 G2753A|(ORF1ab_polyprotein:G2488A(V830M))|(ORF1a_polyprotein:G2488A(V830M)) 7 0.467 10 1.000 21 0.808 14 0.636 30 0.968 5 3.879 0 3.879
3769 T3769A|(ORF1ab_polyprotein:T3504A(T1168T))|(ORF1a_polyprotein:T3504A(T1168T)) 15 0.002 4 0.001 3 0.008 69 0.203 4 0.005 56 0.700 2 0.018 3 0.020 5 0.009 73 0.483 254 0.600 11 2.01 0.039 2.049
3828 C3828T|(ORF1ab_polyprotein:C3563T(S1188L))|(ORF1a_polyprotein:C3563T(S1188L)) 2726 0.999 8 1.000 91 0.752 252 0.837 417 0.552 60 1.000 53 0.308 88 0.512 86 0.281 358 0.865 10 7.106 0 7.106
3918 G3918A|(ORF1ab_polyprotein:G3653A(S1218N))|(ORF1a_polyprotein:G3653A(S1218N)) 32 1.000 33 0.351 18 0.439 24 0.113 26 0.239 176 0.421 124 0.549 7 3.112 0 3.112
4069 C4069T|(ORF1ab_polyprotein:C3804T(A1268A))|(ORF1a_polyprotein:C3804T(A1268A)) 31 0.969 17 0.155 11 0.041 3 1.165 0 1.165
4181 G4181T|(ORF1ab_polyprotein:G3916T(A1306S))|(ORF1a_polyprotein:G3916T(A1306S)) 82 1.000 51 0.248 419 0.567 692 0.994 114 0.507 597 1.000 326 0.194 95 0.118 8 4.628 0 4.628
4454 G4454A|(ORF1ab_polyprotein:G4189A(A1397T))|(ORF1a_polyprotein:G4189A(A1397T)) 30 0.130 26 0.169 6 0.011 47 0.082 379 1.000 5 1.3920000000000000 0 1.3920000000000000
4484 A4484G|(ORF1ab_polyprotein:A4219G(K1407E))|(ORF1a_polyprotein:A4219G(K1407E)) 76 0.571 44 0.620 52 0.477 23 0.043 97 0.268 62 0.348 268 0.609 7 2.936 0 2.936
4800 A4800G|(ORF1ab_polyprotein:A4535G(K1512R))|(ORF1a_polyprotein:A4535G(K1512R)) 1992 0.998 39 0.194 214 0.293 169 0.528 123 0.654 263 0.996 169 0.223 623 0.792 8 4.678 0 4.678
4962 G4962A|(ORF1ab_polyprotein:G4697A(R1566K))|(ORF1a_polyprotein:G4697A(R1566K)) 2408 0.998 64 0.204 210 0.177 232 0.665 393 0.997 304 0.224 138 0.127 7 3.392 0 3.392
5014 T5014A|(ORF1ab_polyprotein:T4749A(V1583V))|(ORF1a_polyprotein:T4749A(V1583V)) 131 1.000 139 0.582 300 0.303 389 0.995 2 0.002 674 0.830 6 3.71 0.002 3.7120000000000000
5028 T5028G|(ORF1ab_polyprotein:T4763G(M1588R))|(ORF1a_polyprotein:T4763G(M1588R)) 2383 0.998 170 0.191 279 0.996 255 0.237 78 0.103 5 2.525 0 2.525
5039 C5039A|(ORF1ab_polyprotein:C4774A(Q1592K))|(ORF1a_polyprotein:C4774A(Q1592K)) 117 1.000 152 0.788 259 0.327 329 1.000 135 0.622 597 0.868 6 4.605 0 4.605
5309 A5309G|(ORF1ab_polyprotein:A5044G(T1682A))|(ORF1a_polyprotein:A5044G(T1682A)) 14 0.500 23 1.000 47 0.701 25 0.424 51 0.378 86 0.977 58 0.360 24 0.522 206 0.995 111 0.816 10 6.673 0 6.673
5386 T5386G|(ORF1ab_polyprotein:T5121G(A1707A))|(ORF1a_polyprotein:T5121G(A1707A)) 2598 1.000 11 0.733 10 0.093 112 0.949 490 0.605 29 0.057 43 0.032 91 1.000 127 0.467 132 0.957 88 0.254 498 0.929 12 7.076 0 7.076
5512 RATG13 C5512T|(ORF1ab_polyprotein:C5247T(N1749N))|(ORF1a_polyprotein:C5247T(N1749N)) 401 0.286 187 0.995 781 0.800 3 2.081 0 2.081
5608 RATG13 A5608G|(ORF1ab_polyprotein:A5343G(K1781K))|(ORF1a_polyprotein:A5343G(K1781K)) 110 0.636 188 0.550 2 1.186 0 1.186
5648 RATG13 A5648C|(ORF1ab_polyprotein:A5383C(K1795Q))|(ORF1a_polyprotein:A5383C(K1795Q)) 3769 0.996 148 0.987 886 0.693 131 1.000 162 0.553 185 1.000 839 0.896 7 6.125 0 6.125
5931 G5931A|(ORF1ab_polyprotein:G5666A(C1889Y))|(ORF1a_polyprotein:G5666A(C1889Y)) 1718 0.978 41 1.000 31 0.225 85 0.697 438 0.664 94 0.185 88 0.080 242 0.549 86 0.296 249 0.652 79 0.176 192 0.244 12 5.746 0 5.746
6200 T6200C|(ORF1ab_polyprotein:T5935C(F1979L))|(ORF1a_polyprotein:T5935C(F1979L)) 2232 0.975 258 0.524 2 1.499 0 1.499
6513 GTT6513-6515del|(ORF1ab_polyprotein:AGTTTA6247-6252ATAdel(SL2083-2084Idel))|(ORF1a_polyprotein:AGTTTA6247-6252ATAdel(SL2083-2084Idel)) 36079 0.996 45 0.616 2 1.000 184 0.885 159 0.593 434 1.000 63 0.073 317 0.994 98 0.510 128 0.198 634 0.812 752 0.896 12 8.573 0 8.573
6541 C6541T|(ORF1ab_polyprotein:C6276T(H2092H))|(ORF1a_polyprotein:C6276T(H2092H)) 20144 0.633 2 0.167 17 0.086 2 0.009 57 0.068 275 0.948 82 0.463 137 0.175 8 2.549 0 2.549
6551 A6551T|(ORF1ab_polyprotein:A6286T(M2096L))|(ORF1a_polyprotein:A6286T(M2096L)) 8588 0.348 32 0.615 99 0.692 112 0.473 261 0.704 3 0.004 86 0.165 370 0.706 315 0.562 9 4.269 0 4.269
6586 T6586C|(ORF1ab_polyprotein:T6321C(I2107I))|(ORF1a_polyprotein:T6321C(I2107I)) 156 0.963 19 0.559 2 1.522 0 1.522
6884 G6884T|(ORF1ab_polyprotein:G6619T(G2207C))|(ORF1a_polyprotein:G6619T(G2207C)) 4784 0.998 166 0.994 273 0.982 189 0.460 525 0.320 228 0.399 725 0.723 553 0.838 8 5.714 0 5.714
7099 RATG13 T7099A|(ORF1ab_polyprotein:T6834A(I2278I))|(ORF1a_polyprotein:T6834A(I2278I)) 4182 0.996 250 0.996 388 0.982 307 0.500 679 0.340 328 0.451 1112 0.731 895 0.827 8 5.823 0 5.823
7328 G7328T|(ORF1ab_polyprotein:G7063T(A2355S))|(ORF1a_polyprotein:G7063T(A2355S)) 4 1.000 4 0.667 38 0.905 5 1.000 10 0.769 16 0.667 6 5.008 0 5.008
7906 A7906T|(ORF1ab_polyprotein:A7641T(S2547S))|(ORF1a_polyprotein:A7641T(S2547S)) 271 0.996 79 0.414 187 0.284 87 0.315 167 1.000 330 0.750 353 0.784 7 4.543 0 4.543
8682 T8682C|(ORF1ab_polyprotein:T8417C(I2806T))|(ORF1a_polyprotein:T8417C(I2806T)) 49 1.000 9 1.000 49 0.516 14 0.126 14 0.636 10 0.526 179 0.799 7 4.603 0 4.603
8841 C8841T|(ORF1ab_polyprotein:C8576T(T2859I))|(ORF1a_polyprotein:C8576T(T2859I)) 2 0.051 6 0.188 5 1.000 17 0.347 10 0.159 5 1.7450000000000000 0 1.7450000000000000
8976 A8976G|(ORF1ab_polyprotein:A8711G(E2904G))|(ORF1a_polyprotein:A8711G(E2904G)) 3 0.091 11 0.282 3 1.000 19 0.396 2 0.250 5 0.085 6 2.104 0 2.104
9042 C9042T|(ORF1ab_polyprotein:C8777T(S2926F))|(ORF1a_polyprotein:C8777T(S2926F)) 17 1.000 23 0.697 19 0.365 3 1.000 5 0.500 52 0.776 6 4.338 0 4.338
9166 C9166A|(ORF1ab_polyprotein:C8901A(T2967T))|(ORF1a_polyprotein:C8901A(T2967T)) 4 0.002 15 1.000 2 0.030 2 0.056 15 0.179 5 1.265 0.002 1.267
9605 T9605C|(ORF1ab_polyprotein:T9340C(F3114L))|(ORF1a_polyprotein:T9340C(F3114L)) 986 0.498 13 0.083 26 0.108 183 0.354 38 0.236 56 0.220 37 0.051 7 1.55 0 1.55
9693 RATG13 C9693T|(ORF1ab_polyprotein:C9428T(A3143V))|(ORF1a_polyprotein:C9428T(A3143V)) 1815 0.498 53 0.203 339 0.455 124 0.333 49 0.077 5 1.566 0 1.566
9756 G9756A|(ORF1ab_polyprotein:G9491A(R3164H))|(ORF1a_polyprotein:G9491A(R3164H)) 2638 0.997 124 1.000 89 1.000 204 0.899 404 0.610 77 0.987 303 0.793 466 0.932 8 7.218 0 7.218
9964 T9964C|(ORF1ab_polyprotein:T9699C(H3233H))|(ORF1a_polyprotein:T9699C(H3233H)) 2 0.250 5 0.625 17 0.548 3 1.423 0 1.423
linked 10029 C10029T|(ORF1ab_polyprotein:C9764T(T3255I))|(ORF1a_polyprotein:C9764T(T3255I)) 3 1.000 12 1.000 2 1.000 32 1.000 14 1.000 18 1.000 13 1.000 36 1.000 24 1.000 13 1.000 5 1.000 35 0.455 3 1.000 2 1.000 12 1.000 28 1.000 12 0.923 22 0.957 28 1.000 3 1.000 31 1.000 26 1.000 7 1.000 18 1.000 11 1.000 34 1.000 22 1.000 30 1.000 28 10.0 17.335 27.335
10282 RATG13 G10282A|(ORF1ab_polyprotein:G10017A(R3339R))|(ORF1a_polyprotein:G10017A(R3339R)) 108 1.000 103 0.200 2 1.2 0 1.2
10288 T10288C|(ORF1ab_polyprotein:T10023C(I3341I))|(ORF1a_polyprotein:T10023C(I3341I)) 13269 0.996 198 0.625 200 0.881 173 0.512 117 1.000 326 0.612 337 0.885 7 5.511 0 5.511
11081 RATG13 T11081G|(ORF1ab_polyprotein:T10816G(L3606V))|(ORF1a_polyprotein:T10816G(L3606V)) 6041 0.996 413 0.998 139 0.709 422 0.488 638 0.979 71 0.986 282 0.573 127 0.247 505 0.842 9 6.818 0 6.818
11351 A11351G|(ORF1ab_polyprotein:A11086G(T3696A))|(ORF1a_polyprotein:A11086G(T3696A)) 12 1.000 47 1.000 68 1.000 70 1.000 171 0.499 518 0.985 72 1.000 59 0.136 433 0.846 9 7.466 0 7.466
11514 C11514T|(ORF1ab_polyprotein:C11249T(T3750I))|(ORF1a_polyprotein:C11249T(T3750I)) 11 1.000 9 0.750 5 0.833 23 0.267 37 0.385 11 0.688 36 0.610 7 4.5330000000000000 0 4.5330000000000000
11522 T11522G|(ORF1ab_polyprotein:T11257G(F3753V))|(ORF1a_polyprotein:T11257G(F3753V)) 26 0.963 2 0.250 5 0.109 2 0.667 3 0.100 5 2.089 0 2.089
11537 A11537G|(ORF1ab_polyprotein:A11272G(I3758V))|(ORF1a_polyprotein:A11272G(I3758V)) 28 1.000 2 1.000 10 0.588 4 0.500 4 3.088 0 3.088
11700 ATTACTT11700-11706del|(ORF1ab_polyprotein:11435-11441del(3812fs))|(ORF1a_polyprotein:11435-11441del(3812fs)) 11 0.458 2 0.667 12 0.400 3 1.5250000000000000 0 1.5250000000000000
12109 T12109C|(ORF1ab_polyprotein:T11844C(F3948F))|(ORF1a_polyprotein:T11844C(F3948F)) 4 0.200 19 0.950 2 1.15 0 1.15
12181 RATG13 T12181C|(ORF1ab_polyprotein:T11916C(D3972D))|(ORF1a_polyprotein:T11916C(D3972D)) 2483 0.998 99 1.000 29 0.569 81 0.401 78 0.987 49 0.544 132 0.473 78 0.513 296 0.860 9 6.345 0 6.345
12756 C12756T|(ORF1ab_polyprotein:C12491T(T4164I))|(ORF1a_polyprotein:C12491T(T4164I)) 109 1.000 29 0.500 17 0.096 3 1.596 0 1.596
13195 T13195C|(ORF1ab_polyprotein:T12930C(V4310V))|(ORF1a_polyprotein:T12930C(V4310V)) 24 1.000 12 0.480 10 1.000 61 0.792 34 1.000 4 1.000 14 0.824 7 6.096 0 6.096
13201 RATG13 G13201A|(ORF1ab_polyprotein:G12936A(P4312P))|(ORF1a_polyprotein:G12936A(P4312P)) 13 0.520 6 0.545 26 0.333 3 1.3980000000000000 0 1.3980000000000000
13379 G13379A|(ORF1ab_polyprotein:G13114A(V4372I))|(ORF1a_polyprotein:G13114A(V4372I)) 16 0.941 13 0.565 2 1.5060000000000000 0 1.5060000000000000
13457 T13457C|(ORF1ab_polyprotein:T13192C(S4398P))|(ORF1a_polyprotein:T13192C(S4398P)) 10 0.038 214 0.210 880 0.631 217 0.172 134 0.165 804 0.280 6 1.496 0 1.496
13496 TTACACCGTGCGGCACAGGCACTAGTACTGATGTCGTATA13496-13535del|(ORF1ab_polyprotein:13232-13271del(4411fs)) 35 0.076 364 0.259 160 0.126 618 0.442 110 0.082 584 0.143 168 0.239 101 0.155 145 0.359 9 1.881 0 1.881
13643 C13643A|(ORF1ab_polyprotein:C13379A(S4460Y)) 122 0.191 1316 0.552 378 0.209 2067 0.654 2243 0.816 341 0.180 3 0.003 4259 0.711 3 0.003 12 0.013 10 3.329 0.003 3.3320000000000000
13727 TTGCTA13727-13732del|(ORF1ab_polyprotein:GTTGCTAAA13462-13470GAAdel(VAK4488-4490Edel)) 390 0.181 1594 0.624 801 0.372 259 0.165 53 0.062 5 1.404 0 1.404
13783 T13783G|(ORF1ab_polyprotein:T13519G(S4507A)) 6264 0.154 40 0.110 346 0.240 137 0.113 914 0.519 412 0.250 547 0.196 7 1.582 0 1.582
13827 TGCTTTAAGGCATTT13827-13841del|(ORF1ab_polyprotein:TATGCTTTAAGGCATTTT13561-13578TATdel(YALRHF4521-4526Ydel)) 22212 0.534 49 0.301 67 0.147 158 0.431 307 0.469 184 0.335 39 0.086 7 2.303 0 2.303
13926 G13926A|(ORF1ab_polyprotein:G13662A(W4554*)) 27 0.143 86 0.194 236 0.506 391 0.412 4 1.255 0 1.255
13929 T13929A|(ORF1ab_polyprotein:T13665A(Y4555*)) 31 0.001 10 0.001 3 0.004 2 0.007 2 0.011 75 0.172 2 0.002 373 0.548 89 0.194 4 0.008 2 0.004 133 0.216 12 1.155 0.013000000000000000 1.168
14169 TATAT14169-14173del|(ORF1ab_polyprotein:13905-13909del(4635fs)) 4635 0.299 29 0.075 54 0.099 327 0.430 144 0.207 122 0.196 6 1.306 0 1.306
14184 RATG13 C14184T|(ORF1ab_polyprotein:C13920T(T4640T)) 6021 0.335 76 0.171 193 0.293 384 0.456 169 0.215 152 0.223 1715 0.829 292 0.484 205 0.191 9 3.197 0 3.197
14408 CTACAAG14408-14414del|(ORF1ab_polyprotein:14144-14150del(4715fs)) 36 0.220 72 0.298 100 0.326 51 0.126 52 0.156 36 0.121 47 0.194 8 0.023 8 1.464 0 1.464
14576 CTATGCACGCTGCTTCTGGTAAT14576-14598del|(ORF1ab_polyprotein:14312-14334del(4771fs)) 1992 0.318 3 0.273 42 0.913 29 0.690 48 1.000 62 0.849 7 0.412 56 0.836 35 0.761 9 6.052 0 6.052
14666 C14666T|(ORF1ab_polyprotein:C14402T(T4801I)) 22 0.815 31 0.912 53 1.000 61 0.836 4 3.5630000000000000 0 3.5630000000000000
14747 A14747C|(ORF1ab_polyprotein:A14483C(E4828A)) 3315 0.999 16 0.889 23 0.920 39 0.696 3 0.029 11 0.289 19 0.292 14 1.000 15 0.500 97 0.843 10 6.457 0 6.457
15240 C15240T|(ORF1ab_polyprotein:C14976T(N4992N)) 9574 0.456 85 0.570 17 0.111 61 0.455 157 0.534 359 0.469 198 0.414 582 0.991 8 4.0 0 4.0
15323 ACATGCTT15323-15330del|(ORF1ab_polyprotein:15059-15066del(5020fs)) 10 0.065 16 0.060 40 1.000 52 0.183 4 1.308 0 1.308
15323 ACATGCTTAGAATT15323-15336del|(ORF1ab_polyprotein:15059-15072del(5020fs)) 6 0.045 8 0.053 9 0.034 40 0.156 114 0.708 7 0.200 53 0.138 31 0.054 8 1.388 0 1.388
15537 T15537C|(ORF1ab_polyprotein:T15273C(A5091A)) 5539 0.814 29 0.257 90 0.257 98 0.320 49 0.170 207 1.000 26 0.151 11 0.024 8 2.993 0 2.993
15712 C15712T|(ORF1ab_polyprotein:C15448T(L5150F)) 7 0.067 88 0.335 110 0.337 2 0.005 98 0.990 5 1.734 0 1.734
15728 TTGTGTGTTTCAA15728-15740del|(ORF1ab_polyprotein:15464-15476del(5155fs)) 2011 0.260 41 0.183 64 0.681 46 0.299 45 0.146 5 1.569 0 1.569
15736 TTCAATAGCAC15736-15746del|(ORF1ab_polyprotein:15472-15482del(5158fs)) 19 0.317 17 0.362 48 0.444 31 0.574 226 0.890 31 0.138 18 0.058 7 2.783 0 2.783
15856 ACTA15856-15859del|(ORF1ab_polyprotein:15592-15595del(5198fs)) 22 0.200 9 0.129 45 0.459 304 0.910 4 1.698 0 1.698
15955 15955-insertTGGGCGGGC|(ORF1ab_polyprotein:15691insertTGGGCGGGC(5231WAG)) 1800 0.190 25 0.272 23 0.397 61 0.379 131 0.342 211 0.547 117 0.450 89 0.567 88 0.379 182 0.364 10 3.887 0 3.887
15960 RATG13 C15960T|(ORF1ab_polyprotein:C15696T(A5232A)) 26 0.306 40 0.714 66 0.423 60 0.588 295 0.858 128 0.339 131 0.520 38 0.171 83 0.170 9 4.089 0 4.089
16017 RATG13 C16017T|(ORF1ab_polyprotein:C15753T(F5251F)) 16 0.314 17 0.072 41 0.071 41 0.152 164 0.291 47 0.088 91 0.376 42 0.060 8 1.424 0 1.424
16175 C16175A|(ORF1ab_polyprotein:C15911A(T5304N)) 499 0.912 1290 0.995 751 0.995 1692 0.997 576 0.750 1142 0.948 6 5.5970000000000000 0 5.5970000000000000
16341 A16341G|(ORF1ab_polyprotein:A16077G(I5359M)) 531 0.998 308 0.903 837 0.998 2 0.002 531 0.993 1294 0.998 2 0.002 451 0.722 771 0.935 9 6.551 0 6.551
16374 T16374C|(ORF1ab_polyprotein:T16110C(N5370N)) 695 0.997 2 0.286 209 0.897 540 0.998 3 0.005 367 0.984 12 0.078 835 0.996 3 0.003 280 0.685 498 0.901 11 6.83 0 6.83
17550 RATG13 C17550T|(ORF1ab_polyprotein:C17286T(L5762L)) 1722 0.998 554 0.569 170 0.515 737 0.652 114 1.000 533 0.998 2101 0.746 363 0.497 102 0.990 331 0.326 1160 0.900 11 8.191 0 8.191
20221 RATG13 C20221A|(ORF1ab_polyprotein:C19957A(Q6653K)) 34 0.971 73 1.000 2 0.667 20 1.000 18 1.000 7 0.333 2 0.111 122 0.917 8 5.999 0 5.999
20408 T20408G|(ORF1ab_polyprotein:T20144G(F6715C)) 450 0.998 33 0.805 42 1.000 10 0.667 32 0.711 9 1.000 3 1.000 13 0.619 2 0.100 120 0.945 10 7.845 0 7.845
20758 G20758A|(ORF1ab_polyprotein:G20494A(A6832T)) 109 0.319 11 0.134 156 0.994 624 0.452 124 0.208 67 0.063 6 2.17 0 2.17
21325 G21325A|(ORF1ab_polyprotein:G21061A(V7021I)) 176 0.597 89 0.239 235 0.228 656 0.997 349 1.000 5 3.061 0 3.061
21604 G21604T|(surface_glycoprotein:G42T(Q14H)) 4 0.043 62 0.639 41 0.932 540 0.982 4 2.596 0 2.596
21621 C21621A|(surface_glycoprotein:C59A(T20N)) 145 0.960 70 0.875 63 0.700 41 0.953 514 0.990 5 4.478 0 4.478
21627 C21627T|(surface_glycoprotein:C65T(T22I)) 6 0.074 66 0.710 27 1.000 42 0.955 514 0.987 5 3.726 0 3.726
21657 RATG13 T21657C|(surface_glycoprotein:T95C(F32S)) 2 1.000 121 0.960 51 0.836 41 0.621 28 0.966 391 0.982 6 5.365 0 5.365
21695 T21695C|(surface_glycoprotein:T133C(S45P)) 4 0.103 16 0.500 14 1.000 141 0.946 4 2.549 0 2.549
21930 C21930T|(surface_glycoprotein:C368T(A123V)) 205 0.608 221 0.729 286 0.528 121 0.263 383 0.312 550 0.905 6 3.345 0 3.345
21987 GTGTTTATT21987-21995del|(surface_glycoprotein:GGTGTTTATTAC424-435GACdel(GVYY142-145Ddel)) 145 0.374 296 0.705 210 0.312 147 0.267 865 0.591 846 0.917 6 3.166 0 3.166
22029 Delta AGTTCA22029-22034del|(surface_glycoprotein:GAGTTCAGA466-474GGAdel(EFR156-158Gdel)) 146 0.388 348 0.800 170 0.296 528 0.353 807 0.888 5 2.725 0 2.725
22082 C22082A|(surface_glycoprotein:C520A(P174T)) 270 0.624 426 0.801 511 0.589 205 0.303 558 0.343 1051 0.901 6 3.561 0 3.561
22189 TATTAA22189-22194del|(surface_glycoprotein:CCTATTAAT625-633CCTdel(PIN209-211Pdel)) 664 0.996 40 0.256 193 0.594 36 0.142 183 0.313 50 0.129 270 0.794 7 3.224 0 3.224
22196 T22196C|(surface_glycoprotein:T634C(L212L)) 665 0.997 41 0.263 194 0.597 36 0.142 185 0.316 51 0.131 276 0.812 7 3.258 0 3.258
22205 22205-insertGAGCCAGAA|(surface_glycoprotein:643insertGAGCCAGAA(215EPE)) 653 0.216 13 0.030 39 0.217 88 0.299 191 0.228 185 0.295 50 0.089 278 0.331 8 1.705 0 1.705
22283 TTACTTGCTTTACATAGAAGTTA22283-22305del|(surface_glycoprotein:721-743del(241fs)) 1134 0.996 243 0.603 602 0.995 250 0.996 397 0.730 5 4.32 0 4.32
22309 G22309-22309del|(surface_glycoprotein:747-747del(249fs)) 1134 0.742 244 0.525 603 0.853 249 0.865 397 0.582 5 3.567 0 3.567
22332 G22332A|(surface_glycoprotein:G770A(G257D)) 1828 0.997 624 0.823 304 0.993 568 0.826 4 3.639 0 3.639
22388 C22388T|(surface_glycoprotein:C826T(L276L)) 3003 0.996 226 0.488 2 0.004 705 0.996 282 0.993 584 0.834 6 4.307 0.004 4.311
22482 C22482T|(surface_glycoprotein:C920T(T307I)) 1785 0.978 138 0.495 403 0.993 172 0.961 341 0.822 5 4.249 0 4.249
22578 G22578A|(surface_glycoprotein:G1016A(G339D)) 74 1.000 12 0.522 2 0.333 20 0.833 4 2.688 0 2.688
22599 G22599A|(surface_glycoprotein:G1037A(R346K)) 62 0.984 17 0.515 2 0.154 3 0.143 23 0.821 5 2.617 0 2.617
22661 G22661T|(surface_glycoprotein:G1099T(V367F)) 68 1.000 14 0.467 4 0.364 7 0.259 22 0.815 5 2.905 0 2.905
22672 22672-insertG|(surface_glycoprotein:AAT1108-1110AAGCinsert(N370Kfsinsert)) 16 0.533 2 0.167 8 0.286 20 0.741 4 1.727 0 1.727
22672 T22672C|(surface_glycoprotein:AAT1108-1110AAGCinsert(N370Kfsinsert)) 16 0.533 2 0.167 8 0.286 20 0.741 4 1.727 0 1.727
22676 G22676-22676del|(surface_glycoprotein:1114-1114del(372fs)) 16 0.552 3 0.333 8 0.286 21 0.778 4 1.949 0 1.949
linked 22679 T22679C|(surface_glycoprotein:T1117C(S373P)) 66 1.000 10 1.000 34 1.000 17 1.000 3 1.000 2 1.000 22 1.000 6 1.000 9 0.900 29 1.000 8 1.000 10 1.000 23 0.958 9 1.000 4 1.000 8 1.000 16 1.000 24 1.000 23 1.000 22 1.000 34 1.000 9 1.000 8 1.000 13 1.000 18 0.947 50 1.000 52 1.000 9 1.000 42 0.977 4 1.000 6 1.000 12 1.000 9 1.000 3 1.000 8 1.000 37 1.000 11 1.000 36 1.000 12 1.000 22 1.000 23 1.000 9 1.000 14 1.000 28 1.000 5 1.000 27 1.000 78 1.000 47 16.0 30.782 46.782
22812 A22812C|(surface_glycoprotein:AAG1249-1251ACT(K417T)) 882 0.999 2 0.001 29 0.690 27 0.871 14 0.778 64 0.831 144 0.966 7 5.135 0.001 5.136
22813 G22813T|(surface_glycoprotein:AAG1249-1251ACT(K417T)) 882 0.999 2 0.001 29 0.906 27 0.871 14 0.778 64 0.831 144 0.966 7 5.351 0.001 5.352
22824 ATA22824-22826del|(surface_glycoprotein:TATAAT1261-1266TATdel(YN421-422Ydel)) 999 0.985 29 0.879 16 0.800 68 0.840 150 0.968 5 4.4720000000000000 0 4.4720000000000000
22886 G22886A|(surface_glycoprotein:G1324A(D442N)) 4 0.154 28 1.000 2 1.154 0 1.154
22889 RATG13 T22889G|(surface_glycoprotein:T1327G(S443A)) 4 0.154 28 1.000 2 1.154 0 1.154
22892 A22892T|(surface_glycoprotein:AAG1330-1332TCA(K444S)) 4 0.154 28 1.000 2 1.154 0 1.154
22893 A22893C|(surface_glycoprotein:AAG1330-1332TCA(K444S)) 4 0.154 28 1.000 2 1.154 0 1.154
22894 RATG13 G22894A|(surface_glycoprotein:AAG1330-1332TCA(K444S)) 4 0.154 28 1.000 2 1.154 0 1.154
22895 GTT22895-22897del|(surface_glycoprotein:1333-1335del(V445del)) 733 0.939 26 1.000 19 0.731 20 1.000 113 0.991 5 4.661 0 4.661
22899 G22899A|(surface_glycoprotein:G1337A(G446D)) 4 0.154 28 1.000 2 1.154 0 1.154
22901 G22901T|(surface_glycoprotein:GGT1339-1341TCT(G447S)) 4 0.174 28 1.000 2 1.174 0 1.174
22902 G22902C|(surface_glycoprotein:GGT1339-1341TCT(G447S)) 4 0.174 28 1.000 2 1.174 0 1.174
22907 TATA22907-22910del|(surface_glycoprotein:TATAATTAC1345-1353AACdel(YNY449-451Ndel)) 516 0.985 16 0.889 10 0.714 16 1.000 81 0.988 5 4.576 0 4.576
22912 TT22912-22913del|(surface_glycoprotein:TATAATTAC1345-1353AACdel(YNY449-451Ndel)) 516 0.985 16 0.889 10 0.714 16 1.000 81 0.988 5 4.576 0 4.576
22917 T22917A|(surface_glycoprotein:T1355A(L452Q)) 523 0.998 18 1.000 10 0.714 16 1.000 11 0.393 82 1.000 6 5.105 0 5.105
22920 A22920C|(surface_glycoprotein:A1358C(Y453S)) 18 1.000 10 0.714 2 1.714 0 1.714
22925 TTGTTTAGGAAGTCTAATCTCAAACCT22925-22951del|(surface_glycoprotein:1363-1389del(LFRKSNLKP455-463del)) 104 0.343 6 0.333 3 0.333 3 0.107 9 0.173 5 1.2890000000000000 0 1.2890000000000000
22927 22927-insertTAAGAGA|(surface_glycoprotein:1365insertTAAGAGA(455fs)) 196 0.647 10 0.556 10 0.714 6 0.667 8 0.286 43 0.827 6 3.697 0 3.697
22928 22928-insertATA|(surface_glycoprotein:1366insertATA(456I)) 197 0.650 11 0.611 6 0.667 8 0.286 43 0.827 5 3.041 0 3.041
22931 22931-insertCA|(surface_glycoprotein:AGG1369-1371CAACTGinsert(R457QLinsert)) 198 0.653 11 0.611 6 0.667 8 0.286 43 0.827 5 3.044 0 3.044
22932 22932-insertAC|(surface_glycoprotein:AGG1369-1371AACTGinsert(R457Nfsinsert)) 14 1.000 17 0.607 2 1.607 0 1.607
22932 22932-insertC|(surface_glycoprotein:AGG1369-1371CAACTGinsert(R457QLinsert)) 198 0.653 11 0.611 6 0.667 8 0.286 43 0.827 5 3.044 0 3.044
22932 G22932T|(surface_glycoprotein:AGG1369-1371AACTGinsert(R457Nfsinsert)) 14 1.000 17 0.607 2 1.607 0 1.607
22932 G22932T|(surface_glycoprotein:AGG1369-1371CAACTGinsert(R457QLinsert)) 198 0.653 11 0.611 6 0.667 8 0.286 43 0.827 5 3.044 0 3.044
22936 G22936T|(surface_glycoprotein:G1374T(K458N)) 198 0.653 11 0.611 14 1.000 6 0.667 25 0.893 43 0.827 6 4.651 0 4.651
22941 ATC22941-22943del|(surface_glycoprotein:AATCTC1378-1383ATCdel(NL460-461Idel)) 198 0.653 11 0.611 14 1.000 6 0.667 25 0.893 43 0.827 6 4.651 0 4.651
22947 A22947G|(surface_glycoprotein:AAA1384-1386AGG(K462R)) 198 0.653 11 0.611 14 1.000 6 0.667 25 0.893 43 0.827 6 4.651 0 4.651
22948 A22948G|(surface_glycoprotein:AAA1384-1386AGG(K462R)) 198 0.653 11 0.611 14 1.000 6 0.667 25 0.893 43 0.827 6 4.651 0 4.651
22951 T22951-22951del|(surface_glycoprotein:1389-1389del(463fs)) 198 0.653 4 0.222 10 0.714 6 0.667 25 0.893 43 0.827 6 3.976 0 3.976
22952 T22952G|(surface_glycoprotein:T1390G(F464V)) 198 0.653 3 0.002 4 0.222 10 0.714 6 0.667 25 0.893 43 0.827 7 3.976 0.002 3.9780000000000000
22955 G22955A|(surface_glycoprotein:G1393A(E465K)) 104 0.343 6 0.333 10 0.714 3 0.333 3 0.107 9 0.173 6 2.003 0 2.003
22955 G22955A|(surface_glycoprotein:GAG1393-1395AAT(E465N)) 199 0.657 5 0.278 5 0.556 25 0.893 43 0.827 5 3.2110000000000000 0 3.2110000000000000
22957 G22957T|(surface_glycoprotein:GAG1393-1395AAT(E465N)) 199 0.657 5 0.278 5 0.556 25 0.893 43 0.827 5 3.2110000000000000 0 3.2110000000000000
22976 A22976T|(surface_glycoprotein:A1414T(I472F)) 294 1.000 17 0.944 14 1.000 9 1.000 28 1.000 51 1.000 6 5.944 0 5.944
23036 T23036A|(surface_glycoprotein:T1474A(L492I)) 3 1.000 3 1.000 2 1.000 3 3.0 0 3.0
23048 G23048T|(surface_glycoprotein:GGT1486-1488TAT(G496Y)) 3 1.000 3 1.000 2 1.000 3 3.0 0 3.0
23049 G23049A|(surface_glycoprotein:GGT1486-1488TAT(G496Y)) 3 1.000 3 1.000 2 1.000 3 3.0 0 3.0
23061 CTAATGGTGTTGG23061-23073del|(surface_glycoprotein:1499-1511del(500fs)) 3 1.000 3 1.000 2 1.000 3 3.0 0 3.0
23076 ACCAACCA23076-23083del|(surface_glycoprotein:1514-1521del(505fs)) 3 1.000 3 1.000 2 1.000 3 3.0 0 3.0
23202 C23202A|(surface_glycoprotein:C1640A(T547K)) 5207 0.997 85 0.179 5 0.008 117 0.466 91 0.376 140 0.196 36 0.065 2 0.001 2 0.003 7 0.002 2 0.005 82 0.177 324 0.839 13 3.295 0.019 3.314
23223 A23223C|(surface_glycoprotein:A1661C(E554A)) 5044 0.998 100 0.214 128 0.483 102 0.408 131 0.194 46 0.082 82 0.179 283 0.733 8 3.291 0 3.291
23248 C23248T|(surface_glycoprotein:C1686T(F562F)) 5087 0.997 90 0.217 115 0.469 84 0.393 115 0.191 42 0.087 71 0.178 263 0.741 8 3.273 0 3.273
23280 C23280T|(surface_glycoprotein:C1718T(T573I)) 6185 0.995 113 0.221 129 0.454 104 0.375 4 0.308 146 0.198 52 0.091 9 0.009 67 0.144 104 0.264 10 3.059 0 3.059
23311 G23311C|(surface_glycoprotein:G1749C(E583D)) 18 0.069 126 0.455 5 0.333 152 0.223 48 0.090 58 0.132 6 1.302 0 1.302
23490 23490-insertTGAAGACAG|(surface_glycoprotein:TTT1927-1929TTGAAGACAGTTinsert(F643LKTV)) 6 0.667 15 0.294 13 0.722 16 0.457 42 0.636 5 2.776 0 2.776
linked 23525 C23525T|(surface_glycoprotein:C1963T(H655Y)) 111 0.982 240 1.000 7 1.000 10 0.714 12 1.000 8 0.889 60 1.000 46 1.000 13 1.000 15 1.000 22 1.000 5 1.000 17 1.000 10 1.000 12 1.000 20 1.000 13 1.000 21 0.955 8 1.000 54 1.000 12 1.000 5 1.000 34 1.000 3 1.000 46 1.000 6 1.000 3 1.000 6 1.000 20 1.000 35 1.000 28 0.966 23 1.000 11 1.000 5 1.000 11 1.000 49 1.000 36 15.551 19.955 35.506
23534 A23534G|(surface_glycoprotein:A1972G(N658D)) 112 1.000 7 0.778 21 0.525 11 0.917 27 1.000 43 0.977 6 5.197 0 5.197
23538 C23538T|(surface_glycoprotein:C1976T(S659L)) 112 1.000 7 0.778 21 0.525 11 0.917 27 1.000 43 0.977 6 5.197 0 5.197
23587 G23587C|(surface_glycoprotein:G2025C(Q675H)) 151 0.599 9 0.346 6 0.113 2 1.000 5 0.032 13 0.092 4 0.030 34 0.472 8 2.6840000000000000 0 2.6840000000000000
23597 A23597G|(surface_glycoprotein:AAT2035-2037GAG(N679E)) 302 1.000 6 0.188 4 0.066 10 0.046 8 0.043 8 0.042 58 0.384 7 1.769 0 1.769
23599 T23599G|(surface_glycoprotein:AAT2035-2037GAG(N679E)) 302 1.000 6 0.188 4 0.069 10 0.046 8 0.043 8 0.042 58 0.384 7 1.772 0 1.772
23604 C23604A|(surface_glycoprotein:C2042A(P681H)) 325 1.000 8 0.242 5 0.083 13 0.057 9 0.048 9 0.046 75 0.478 7 1.954 0 1.954
23798 T23798A|(surface_glycoprotein:T2236A(S746T)) 632 0.992 3 0.027 5 0.063 8 0.092 32 0.062 3 0.005 8 0.026 11 0.030 123 0.436 9 1.728 0.005 1.7330000000000000
23933 A23933C|(surface_glycoprotein:A2371C(T791P)) 93 0.600 160 0.988 50 0.735 25 0.049 4 2.372 0 2.372
23934 C23934T|(surface_glycoprotein:C2372T(T791I)) 879 0.915 184 0.276 304 0.598 3 1.7890000000000000 0 1.7890000000000000
23946 A23946C|(surface_glycoprotein:A2384C(K795T)) 571 0.993 4 0.002 80 0.357 109 0.626 3 0.003 3 0.003 167 0.988 5 0.007 2 0.002 2 0.004 3 0.002 3 0.009 2 0.002 202 0.299 54 0.964 401 0.785 16 5.012 0.034 5.046000000000000
linked 23948 G23948T|(surface_glycoprotein:G2386T(D796Y)) 571 0.993 1414 0.983 235 1.000 283 0.983 207 0.986 553 0.988 165 0.988 1196 0.986 1096 0.982 192 0.990 791 0.990 226 0.983 841 0.994 543 0.993 551 0.991 167 0.988 372 0.997 195 0.990 640 0.988 147 0.980 674 0.948 903 0.989 436 0.982 1181 0.973 232 0.963 312 0.931 61 0.968 164 0.988 994 0.990 384 0.987 85 1.000 773 0.991 188 0.995 906 0.990 641 0.992 618 0.984 512 0.990 56 1.000 154 0.994 491 0.996 40 14.869 24.555 39.424
24094 T24094G|(surface_glycoprotein:T2532G(I844M)) 781 1.000 177 0.978 233 0.324 51 1.000 471 0.804 5 4.106 0 4.106
24130 C24130A|(surface_glycoprotein:C2568A(N856K)) 842 0.993 84 0.309 108 0.607 2 0.002 169 0.994 221 0.314 50 1.000 490 0.809 8 5.026 0.002 5.028
24212 T24212G|(surface_glycoprotein:T2650G(S884A)) 125 0.104 26 0.356 36 0.554 4 0.073 4 0.500 32 0.889 12 0.126 3 0.060 50 0.227 18 0.692 151 0.778 11 4.359 0 4.359
24323 A24323C|(surface_glycoprotein:A2761C(K921Q)) 4 0.800 22 1.000 13 0.295 8 0.615 18 0.667 5 3.3770000000000000 0 3.3770000000000000
24353 A24353G|(surface_glycoprotein:A2791G(I931V)) 4 0.667 23 1.000 10 0.250 5 0.500 19 0.704 3 0.060 6 3.181 0 3.181
24422 C24422A|(surface_glycoprotein:CAA2860-2862AAT(Q954N)) 6 1.000 14 0.875 2 0.500 3 0.333 24 0.960 6 0.194 4 0.400 4 0.364 17 0.586 50 0.943 10 6.155 0 6.155
24424 A24424T|(surface_glycoprotein:CAA2860-2862AAT(Q954N)) 6 1.000 14 0.875 2 0.500 3 0.429 24 0.960 6 0.194 4 0.444 4 0.364 17 0.607 50 0.943 10 6.316 0 6.316
linked 24469 T24469A|(surface_glycoprotein:T2907A(N969K)) 2165 0.996 2623 0.998 29 1.000 95 1.000 32 1.000 21 1.000 110 1.000 34 1.000 26 1.000 129 1.000 112 1.000 39 1.000 125 1.000 41 0.976 19 1.000 3 1.000 84 1.000 74 1.000 112 0.991 85 1.000 158 0.988 147 1.000 2 1.000 82 1.000 5 1.000 27 1.000 74 1.000 55 1.000 113 1.000 57 0.851 148 0.980 112 0.991 47 1.000 21 1.000 7 1.000 63 1.000 195 1.000 18 1.000 75 1.000 32 1.000 55 1.000 49 1.000 33 1.000 93 0.989 23 1.000 35 1.000 13 1.000 80 1.000 137 1.000 23 0.958 81 1.000 116 1.000 52 17.913 33.805 51.718
24479 A24479G|(surface_glycoprotein:A2917G(I973V)) 1191 0.502 7 0.167 23 0.885 17 0.347 48 0.327 184 0.995 22 0.222 134 1.000 2 0.018 15 0.625 125 0.899 11 5.987 0 5.987
24503 C24503T|(surface_glycoprotein:C2941T(L981F)) 2399 0.697 5 0.076 23 0.719 26 0.292 72 0.312 311 0.997 46 0.322 217 1.000 2 0.011 12 0.632 193 0.877 11 5.935 0 5.935
24912 C24912A|(surface_glycoprotein:C3350A(T1117K)) 130 1.000 54 0.621 29 0.763 67 0.435 91 1.000 38 0.388 11 0.141 104 0.698 88 0.863 9 5.909 0 5.909
linked 25000 RATG13 C25000T|(surface_glycoprotein:C3438T(D1146D)) 105 1.000 78 0.975 69 0.972 22 1.000 50 1.000 35 1.000 101 0.971 17 1.000 5 1.000 6 1.000 3 1.000 51 1.000 12 1.000 334 1.000 148 1.000 40 0.465 101 1.000 94 1.000 86 0.989 78 0.963 181 0.995 49 1.000 76 1.000 262 0.985 129 0.985 51 0.981 17 0.895 17 1.000 2 1.000 71 1.000 18 1.000 6 1.000 52 1.000 50 1.000 69 1.000 12 1.000 37 0.949 13 0.929 97 1.000 84 0.988 40 15.323 23.719 39.042
25010 G25010A|(surface_glycoprotein:G3448A(E1150K)) 41 0.477 50 0.490 19 0.218 91 0.711 4 1.896 0 1.896
25067 A25067T|(surface_glycoprotein:A3505T(I1169F)) 89 0.978 44 0.620 28 0.800 62 0.408 62 0.969 46 0.489 18 0.228 2 0.034 69 0.657 4 0.200 59 0.881 11 6.23 0.034 6.264
25168 A25168C|(surface_glycoprotein:A3606C(E1202D)) 3 0.500 16 0.188 11 1.000 13 0.464 4 2.152 0 2.152
linked 25207 C25207T|(surface_glycoprotein:C3645T(Y1215Y)) 706 0.982 1358 0.982 20 1.000 2 1.000 73 0.986 54 1.000 23 1.000 65 1.000 8 1.000 57 1.000 28 0.966 24 1.000 223 0.991 11 1.000 92 1.000 2 1.000 88 0.989 14 1.000 28 1.000 19 0.950 2 1.000 5 1.000 12 0.923 85 0.977 105 1.000 51 1.000 33 1.000 76 1.000 8 1.000 14 0.933 21 1.000 56 0.982 49 1.000 44 0.978 23 1.000 32 1.000 10 1.000 28 1.000 56 1.000 79 0.988 52 1.000 80 0.976 15 1.000 8 1.000 24 1.000 45 16.939 27.664 44.603
25254 C25254T|(surface_glycoprotein:C3692T(T1231I)) 2 0.091 5 0.714 24 0.238 10 1.000 14 0.412 3 0.120 6 2.5750000000000000 0 2.5750000000000000
25432 A25432C|(ORF3a_protein:A40C(T14P)) 29 0.315 80 0.217 202 0.203 170 0.188 19 0.058 127 0.268 100 0.180 136 0.220 8 1.649 0 1.649
25522 G25522A|(ORF3a_protein:G130A(G44R)) 239 0.718 139 0.322 485 0.511 273 0.254 4 1.805 0 1.805
linked 25584 C25584T|(ORF3a_protein:C192T(T64T)) 7819 0.992 44 0.978 408 0.978 323 0.994 93 1.000 320 0.691 1053 0.994 380 0.995 557 0.995 273 0.996 390 0.987 198 0.995 792 0.992 64 1.000 3031 0.995 917 0.991 22 0.917 1067 0.994 41 1.000 1087 0.990 337 0.983 1534 0.990 544 0.975 121 0.953 1393 0.987 518 0.994 458 0.996 2066 0.990 908 0.992 355 0.992 265 0.974 209 0.968 404 0.990 1853 0.995 150 1.000 65 1.000 164 1.000 498 0.996 874 0.991 185 0.995 646 0.992 696 0.983 1690 0.998 790 0.992 1312 0.998 45 17.565 26.633 44.198
25595 G25595A|(ORF3a_protein:G203A(R68K)) 95 1.000 12 0.025 69 0.176 733 0.674 443 0.627 31 0.038 6 2.54 0 2.54
25922 G25922A|(ORF3a_protein:G530A(S177N)) 491 0.446 13 0.351 69 0.345 24 0.250 9 0.450 12 0.414 18 0.474 217 0.858 8 3.588 0 3.588
25936 C25936G|(ORF3a_protein:C544G(H182D)) 529 0.436 16 0.457 72 0.367 25 0.263 9 0.474 11 0.379 18 0.474 212 0.858 8 3.708 0 3.708
25947 G25947C|(ORF3a_protein:G555C(Q185H)) 579 0.439 13 0.481 73 0.365 23 0.232 10 0.435 11 0.407 17 0.415 221 0.867 8 3.641 0 3.641
25979 G25979A|(ORF3a_protein:G587A(G196E)) 782 0.456 13 0.500 73 0.386 22 0.239 7 0.350 7 0.280 16 0.457 200 0.833 8 3.501 0 3.501
25991 G25991A|(ORF3a_protein:G599A(C200Y)) 766 0.462 11 0.458 73 0.401 21 0.226 5 0.278 7 0.292 16 0.500 202 0.849 8 3.466 0 3.466
26047 T26047G|(ORF3a_protein:T655G(L219V)) 1755 0.575 24 0.343 24 0.774 78 0.431 30 0.455 13 0.929 23 0.821 23 0.404 18 0.581 201 0.845 10 6.158 0 6.158
26113 G26113T|(ORF3a_protein:G721T(E241*)) 1463 0.394 2 0.001 20 0.370 113 0.598 32 0.941 56 0.966 36 0.468 19 0.500 269 0.849 9 5.086 0.001 5.087000000000000
26129 T26129A|(ORF3a_protein:T737A(I246N)) 1632 0.614 3 0.002 44 0.393 38 0.731 112 0.602 41 1.000 31 0.939 52 0.981 34 0.466 17 0.531 223 0.848 11 7.1050000000000000 0.002 7.107000000000000
26171 T26171A|(ORF3a_protein:T779A(M260K)) 1255 0.628 45 0.429 38 0.704 123 0.600 42 1.000 25 0.962 52 1.000 31 0.463 17 0.531 223 0.788 10 7.105 0 7.105
26464 C26464T|(envelope_protein:C220T(L74L)) 113 0.236 20 0.040 726 0.995 3 1.271 0 1.271
26527 C26527T|(membrane_glycoprotein:C5T(A2V)) 1249 0.461 207 0.461 387 0.810 777 0.984 682 0.999 258 0.570 179 0.370 224 0.419 565 0.919 9 5.993 0 5.993
26530 A26530G|(membrane_glycoprotein:A8G(D3G)) 1251 0.455 208 0.465 389 0.816 780 0.987 681 0.997 260 0.580 176 0.365 223 0.425 565 0.919 9 6.009 0 6.009
26533 C26533A|(membrane_glycoprotein:C11A(S4Y)) 1246 0.446 207 0.450 388 0.807 777 0.984 681 0.997 261 0.577 180 0.367 224 0.409 2 0.002 562 0.914 10 5.953 0 5.953
26655 T26655G|(membrane_glycoprotein:T133G(F45V)) 152 0.311 80 0.092 110 0.072 434 0.637 322 0.225 213 0.208 801 0.633 7 2.178 0 2.178
26873 C26873T|(membrane_glycoprotein:C351T(N117N)) 16560 0.984 45 0.106 73 0.676 555 0.904 925 0.882 181 0.984 896 0.993 1168 0.997 255 0.351 112 0.352 534 0.702 861 0.886 12 8.817 0 8.817
26895 C26895T|(membrane_glycoprotein:C373T(H125Y)) 16153 0.986 43 0.103 71 0.696 519 0.896 874 0.885 179 0.994 848 0.993 1100 0.995 249 0.353 116 0.369 500 0.702 818 0.882 12 8.854 0 8.854
26959 G26959A|(membrane_glycoprotein:G437A(R146H)) 16197 0.991 32 0.110 45 0.662 368 0.906 624 0.914 132 1.000 662 0.997 858 0.992 177 0.348 89 0.366 319 0.725 636 0.869 12 8.88 0 8.88
26964 C26964A|(membrane_glycoprotein:CAT442-444AAA(H148K)) 9371 0.584 29 0.103 131 1.000 197 0.310 4 1.9970000000000000 0 1.9970000000000000
26964 C26964A|(membrane_glycoprotein:CAT442-444AAG(H148K)) 44 0.667 333 0.893 553 0.864 438 0.689 819 0.995 162 0.332 287 0.705 519 0.791 8 5.936 0 5.936
26966 T26966A|(membrane_glycoprotein:CAT442-444AAA(H148K)) 9371 0.583 29 0.106 131 0.891 197 0.310 4 1.89 0 1.89
26966 T26966G|(membrane_glycoprotein:CAT442-444AAG(H148K)) 44 0.629 333 0.902 553 0.859 438 0.689 819 0.988 162 0.338 287 0.680 519 0.798 8 5.883 0 5.883
27247 C27247T|(ORF6_protein:C46T(L16L)) 5 0.042 99 0.980 57 0.090 129 0.313 86 0.112 11 0.031 6 1.568 0 1.568
linked 27259 A27259C|(ORF6_protein:A58C(R20R)) 9301 0.998 13108 0.999 318 1.000 62 1.000 13 1.000 231 1.000 108 1.000 423 0.995 152 0.987 365 0.995 28 1.000 204 0.986 2 1.000 1138 0.996 492 0.998 264 1.000 298 0.997 295 1.000 172 1.000 231 0.996 143 1.000 370 0.997 258 0.996 105 1.000 63 1.000 674 0.999 141 1.000 490 1.000 569 0.993 375 1.000 452 0.991 637 0.992 430 1.000 130 1.000 393 1.000 392 1.000 115 0.991 94 0.989 187 1.000 769 0.999 348 1.000 331 0.997 757 1.000 330 0.997 360 0.994 473 0.996 1028 0.996 543 1.000 139 1.000 854 0.996 742 0.996 480 1.000 371 1.000 53 17.938 34.928 52.866
27389 C27389T 11601 0.742 237 0.793 321 0.560 187 0.995 591 0.666 207 0.525 242 0.996 165 1.000 308 0.430 422 0.896 10 7.603 0 7.603
27679 C27679T|(ORF7a_protein:C286T(L96F)) 52 0.093 101 0.149 477 0.990 152 0.383 473 0.996 22 0.031 6 2.642 0 2.642
27753 A27753G|(ORF7a_protein:A360G(T120T)) 120 0.513 123 0.350 404 0.724 525 0.823 405 0.305 455 0.987 147 0.402 53 0.123 442 0.998 301 0.609 132 0.358 568 0.887 12 7.079 0 7.079
27893 C27893T 122 0.530 102 0.540 96 0.353 302 0.841 430 0.704 288 0.306 296 0.955 119 0.436 100 0.242 320 0.997 223 0.584 95 0.321 529 0.900 13 7.709 0 7.709
27900 TTTCTTG27900-27906del|(ORF8_protein:7-13del(3fs)) 122 0.521 98 0.533 90 0.341 269 0.815 399 0.680 276 0.302 284 0.953 113 0.428 95 0.237 309 0.997 211 0.577 83 0.296 505 0.899 13 7.579 0 7.579
28011 C28011T|(ORF8_protein:C118T(H40Y)) 200 0.484 19 0.792 35 0.648 38 0.884 112 0.444 47 1.000 102 0.857 64 1.000 43 0.741 31 0.525 264 0.892 11 8.267 0 8.267
28057 C28057T|(ORF8_protein:C164T(A55V)) 29 0.674 41 0.173 57 1.000 3 1.847 0 1.847
28085 GGCT28085-28088del|(ORF8_protein:192-195del(64fs)) 27 0.675 37 0.153 41 1.000 3 0.009 4 1.837 0 1.837
28090 GTTC28090-28093del|(ORF8_protein:197-200del(66fs)) 89 0.317 15 0.577 29 0.853 45 0.188 51 0.944 80 0.748 27 0.482 15 0.294 211 0.764 9 5.167 0 5.167
28093 C28093G|(ORF8_protein:C200G(S67C)) 27 0.675 37 0.155 41 1.000 3 0.011 4 1.841 0 1.841
28095 AA28095-28096del|(ORF8_protein:202-203del(68fs)) 89 0.266 15 0.577 27 0.675 29 0.853 82 0.343 51 0.944 80 0.755 41 1.000 27 0.491 14 0.280 214 0.778 11 6.962 0 6.962
linked 28271 A28271T 2644 0.999 2932 0.999 464 1.000 135 1.000 268 1.000 394 1.000 857 0.998 113 1.000 109 1.000 263 0.992 791 0.992 2195 0.999 850 0.998 652 0.998 312 1.000 340 0.994 420 0.995 149 1.000 264 1.000 309 0.997 244 0.996 173 0.994 5 1.000 354 1.000 37 1.000 794 0.996 357 0.997 49 1.000 132 1.000 400 1.000 408 0.993 379 1.000 243 1.000 93 1.000 65 1.000 85 1.000 409 1.000 251 0.996 75 1.000 30 1.000 352 0.997 165 1.000 564 0.998 883 0.998 209 1.000 431 1.000 466 1.000 210 1.000 559 0.996 358 1.000 817 0.995 51 18.967 31.95 50.917
28282 T28282C|(nucleocapsid_phosphoprotein:T9C(D3D)) 2066 0.999 62 0.239 207 0.818 684 0.802 155 0.443 597 0.682 97 0.171 715 0.941 8 5.095 0 5.095
28285 T28285C|(nucleocapsid_phosphoprotein:T12C(N4N)) 2065 0.998 62 0.244 206 0.817 681 0.805 155 0.445 598 0.683 98 0.175 741 0.981 8 5.148 0 5.148
28297 RATG13 T28297C|(nucleocapsid_phosphoprotein:T24C(N8N)) 198 0.528 368 0.997 94 0.280 3 1.8050000000000000 0 1.8050000000000000
28300 RATG13 G28300A|(nucleocapsid_phosphoprotein:G27A(Q9Q)) 886 0.425 66 0.257 92 0.365 438 0.512 159 0.458 97 0.177 8 0.010 7 2.204 0 2.204
linked 28311 C28311T|(nucleocapsid_phosphoprotein:C38T(P13L)) 2084 0.999 2400 0.998 457 0.996 138 1.000 249 0.988 366 0.995 865 0.998 99 1.000 252 0.977 817 0.992 2114 0.996 853 0.995 629 1.000 298 0.993 354 1.000 406 1.000 136 0.993 249 1.000 302 1.000 231 1.000 164 1.000 7 1.000 355 0.997 35 1.000 791 0.997 343 0.983 54 1.000 128 1.000 419 1.000 383 0.995 371 0.997 246 1.000 101 1.000 65 0.985 76 1.000 410 0.995 238 0.992 81 1.000 28 1.000 347 0.994 150 0.987 540 0.998 868 0.998 198 0.995 409 0.998 455 1.000 193 0.995 539 0.996 349 0.997 789 0.994 50 18.91 30.903 49.813
28321 G28321A|(nucleocapsid_phosphoprotein:G48A(T16T)) 1188 0.514 67 0.240 200 0.791 704 0.794 168 0.438 595 0.664 86 0.148 766 0.978 8 4.567 0 4.567
linked 28362 GAGAACGCA28362-28370del|(nucleocapsid_phosphoprotein:GGAGAACGCAGT88-99GGTdel(GERS30-33Gdel)) 1918 0.995 1962 0.998 371 1.000 121 0.992 189 0.995 277 0.996 693 0.999 89 1.000 79 1.000 200 0.995 652 0.997 1688 0.998 704 0.999 509 0.998 229 1.000 270 0.989 327 0.997 119 1.000 203 1.000 248 0.992 171 1.000 134 1.000 7 1.000 309 1.000 24 1.000 659 0.995 260 0.977 41 0.976 101 1.000 349 0.989 285 0.997 317 0.997 208 1.000 82 0.988 53 1.000 68 1.000 335 0.997 194 1.000 65 1.000 17 1.000 256 0.996 130 1.000 425 1.000 727 0.995 173 0.989 309 1.000 363 1.000 156 1.000 468 1.000 289 0.997 666 1.000 51 18.908 31.925 50.833
28791 C28791T|(nucleocapsid_phosphoprotein:C518T(A173V)) 11843 0.998 207 0.649 322 0.187 874 1.000 491 0.634 1017 0.465 830 0.434 1411 0.880 8 5.247 0 5.247
linkedubiq 28881 G28881A|(nucleocapsid_phosphoprotein:AGG607-609AAA(R203K)) 5238 0.991 6765 0.991 170 0.994 123 1.000 86 1.000 375 0.989 80 0.988 272 0.989 113 0.991 195 0.995 276 0.996 741 0.989 713 0.930 872 0.993 745 0.995 68 0.986 282 0.989 493 0.996 643 0.997 409 0.986 216 0.995 239 0.996 269 1.000 180 0.776 68 1.000 167 0.994 105 0.955 117 0.983 381 0.990 413 0.990 1138 0.989 213 0.986 366 0.992 537 0.994 64 1.000 95 0.950 264 0.992 299 1.000 491 0.994 435 0.995 180 0.994 304 0.997 411 0.913 143 1.000 289 0.997 620 0.995 669 0.999 229 0.996 213 0.995 525 0.996 50 20.467 28.771 49.238
linkedubiq 28882 G28882A|(nucleocapsid_phosphoprotein:AGG607-609AAA(R203K)) 5238 0.991 6765 0.991 170 0.994 123 1.000 86 1.000 375 0.989 80 0.988 272 0.989 113 0.991 195 0.995 276 0.996 741 0.989 713 0.930 872 0.993 745 0.995 68 0.986 282 0.989 493 0.996 643 0.997 409 0.986 216 0.995 239 0.996 269 1.000 180 0.776 68 1.000 167 0.994 105 0.955 117 0.983 381 0.990 413 0.990 1138 0.989 213 0.986 366 0.992 537 0.994 64 1.000 95 0.950 264 0.992 299 1.000 491 0.994 435 0.995 180 0.994 304 0.997 411 0.917 143 1.000 289 0.997 620 0.995 669 0.999 229 0.996 213 0.995 525 0.996 50 20.471 28.771 49.242000000000000
linked 28883 G28883C|(nucleocapsid_phosphoprotein:G610C(G204R)) 3027 0.573 6817 0.998 171 1.000 80 0.650 74 0.860 378 0.997 80 0.988 275 1.000 114 1.000 172 0.878 275 0.993 749 1.000 716 0.934 878 1.000 748 0.999 69 1.000 285 1.000 494 0.998 641 0.994 156 0.376 240 1.000 114 0.491 68 1.000 168 1.000 110 1.000 83 0.697 384 0.997 416 0.998 1148 0.997 369 1.000 540 1.000 62 0.969 98 0.980 266 1.000 299 1.000 494 1.000 437 1.000 181 1.000 304 0.997 448 1.000 143 1.000 509 0.817 669 0.999 230 1.000 214 1.000 517 0.981 46 18.722 24.439 43.161
28883 G28883C|(nucleocapsid_phosphoprotein:GGA610-612CAA(G204Q)) 12 0.140 23 0.117 258 0.622 68 0.293 4 1.172 0 1.172
linked 28884 G28884A|(nucleocapsid_phosphoprotein:GGA610-612CAA(G204Q)) 12 0.122 23 0.102 258 0.592 68 0.286 4 1.1020000000000000 0 1.1020000000000000
28887 C28887G|(nucleocapsid_phosphoprotein:C614G(T205S)) 28 0.189 23 0.223 77 0.310 236 0.255 62 0.242 207 0.393 49 0.181 79 0.120 8 1.913 0 1.913
28928 C28928A|(nucleocapsid_phosphoprotein:C655A(L219I)) 3730 0.510 44 0.203 41 0.333 216 0.692 2 0.002 540 0.484 368 0.618 164 0.566 449 0.737 121 0.370 723 0.911 11 5.4240000000000000 0.002 5.426000000000000
28998 A28998G|(nucleocapsid_phosphoprotein:A725G(Q242R)) 4127 0.578 45 0.177 42 0.341 211 0.690 781 0.623 354 0.621 283 0.791 2 0.001 399 0.699 109 0.356 750 0.919 11 5.795 0.001 5.796
29425 G29425T|(nucleocapsid_phosphoprotein:G1152T(Q384H)) 25 0.036 10 0.013 64 0.031 33 1.000 251 0.187 184 0.176 105 0.042 2 0.002 4 0.002 45 0.020 10 1.507 0.002 1.509
29758 RATG13 T29758G 29158 0.998 472 0.689 159 0.981 651 0.775 2330 0.893 2712 0.989 3620 0.846 3598 0.979 780 0.525 3198 0.994 2199 0.999 2326 0.739 2437 0.976 13 11.383 0 11.383