TX-1 - Complete Raw Mutation Data

Full TSV data with all sample columns and abundance information
← Back to Dashboard

Complete Mutations Data

This table shows the complete data from the mutations.tsv file exactly as it appears in the source. Scroll horizontally to see all columns.

SRR33896801(4907254) SRR33896815(4677155) SRR33896819(4545901) SRR33896825(5642691) SRR33896833(5320594) SRR33896839(4619555) SRR33896855(5446829) SRR33976503(4055489) SRR33976515(6245788)
('2025-06-01', '242000') ('2025-06-02', '350') ('2025-06-02', '140000') ('2025-06-02', '120000') ('2025-06-02', '539116') ('2025-06-01', '15000') ('2025-06-02', '529541') ('2025-06-02', '120000') ('2025-06-02', '200000')
Sequences Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Total samples Positives Sum Negatives Sum Total Sum
137 T137C 2 0.000 10 0.000 1 0.000 4 0.000 3 0.000 14234 0.640 2 0.000 7 0.64 0.0 0.64
315 G315A|(ORF1ab_polyprotein:G50A(S17N))|(ORF1a_polyprotein:G50A(S17N)) 1 0.000 2 0.000 1 0.000 5967 0.211 4 0.211 0.0 0.211
linked 329 C329A|(ORF1ab_polyprotein:C64A(Q22K))|(ORF1a_polyprotein:C64A(Q22K)) 21 0.000 15 0.000 13 0.000 12 0.000 13941 0.494 4 0.000 1 1.000 7 0.494 1.0 1.494
336 G336A|(ORF1ab_polyprotein:CGC70-72CAA(R24Q))|(ORF1a_polyprotein:CGC70-72CAA(R24Q)) 5969 0.211 1 0.211 0 0.211
337 C337A|(ORF1ab_polyprotein:CGC70-72CAA(R24Q))|(ORF1a_polyprotein:CGC70-72CAA(R24Q)) 5969 0.211 1 0.211 0 0.211
344 C344T|(ORF1ab_polyprotein:C79T(L27F))|(ORF1a_polyprotein:C79T(L27F)) 1 0.000 4 0.000 1 0.000 2 0.000 13959 0.494 4 0.000 6 0.494 0.0 0.494
378 RATG13 T378C|(ORF1ab_polyprotein:T113C(V38A))|(ORF1a_polyprotein:T113C(V38A)) 8 0.000 8 0.000 3 0.000 3 0.000 6 0.000 13955 0.494 1 0.000 7 0.494 0.0 0.494
404 A404G|(ORF1ab_polyprotein:A139G(K47E))|(ORF1a_polyprotein:A139G(K47E)) 6 0.000 4 0.000 1 0.000 1 0.000 4 0.000 5972 0.211 1 0.000 7 0.211 0.0 0.211
410 G410-410del|(ORF1ab_polyprotein:145-145del(49fs))|(ORF1a_polyprotein:145-145del(49fs)) 7952 0.282 1 0.282 0 0.282
686 AAGTCATTT686-694del|(ORF1ab_polyprotein:421-429del(KSF141-143del))|(ORF1a_polyprotein:421-429del(KSF141-143del)) 71448 0.633 1 0.633 0 0.633
786 T786C|(ORF1ab_polyprotein:T521C(M174T))|(ORF1a_polyprotein:T521C(M174T)) 28 0.000 38 0.000 17 0.000 22 0.000 9 0.000 71572 0.669 6 0.669 0.0 0.669
795 T795C|(ORF1ab_polyprotein:T530C(L177P))|(ORF1a_polyprotein:T530C(L177P)) 28 0.000 39 0.000 11 0.000 22 0.000 11 0.000 71380 0.667 6 0.667 0.0 0.667
942 G942A|(ORF1ab_polyprotein:G677A(R226K))|(ORF1a_polyprotein:G677A(R226K)) 6 0.000 5 0.000 2 0.000 10 0.000 4 0.000 106512 0.997 6 0.997 0.0 0.997
979 T979A|(ORF1ab_polyprotein:T714A(I238I))|(ORF1a_polyprotein:T714A(I238I)) 27 0.000 22 0.000 14 0.000 29 0.000 11 0.000 71332 0.668 6 0.668 0.0 0.668
1419 C1419G|(ORF1ab_polyprotein:C1154G(A385G))|(ORF1a_polyprotein:C1154G(A385G)) 397 1.000 1 1.0 0 1.0
1427 C1427T|(ORF1ab_polyprotein:C1162T(H388Y))|(ORF1a_polyprotein:C1162T(H388Y)) 1 0.000 397 1.000 2 1.0 0.0 1.0
1455 T1455C|(ORF1ab_polyprotein:T1190C(L397P))|(ORF1a_polyprotein:T1190C(L397P)) 1 0.001 395 0.995 2 0.995 0.001 0.996
1524 G1524A|(ORF1ab_polyprotein:G1259A(C420Y))|(ORF1a_polyprotein:G1259A(C420Y)) 394 0.995 1 0.995 0 0.995
1599 G1599T|(ORF1ab_polyprotein:G1334T(G445V))|(ORF1a_polyprotein:G1334T(G445V)) 1 0.003 1 0.001 1 0.000 397 0.985 4 0.985 0.004 0.989
1989 A1989G|(ORF1ab_polyprotein:A1724G(Q575R))|(ORF1a_polyprotein:A1724G(Q575R)) 17 0.000 7 0.000 21 0.000 11 0.000 44782 0.992 5 0.992 0.0 0.992
2242 TG2242-2243del|(ORF1ab_polyprotein:1977-1978del(659fs))|(ORF1a_polyprotein:1977-1978del(659fs)) 44778 0.998 1 0.998 0 0.998
2485 RATG13 C2485T|(ORF1ab_polyprotein:C2220T(I740I))|(ORF1a_polyprotein:C2220T(I740I)) 1 0.000 15011 0.534 2 0.000 2 0.000 4 0.534 0.0 0.534
2534 G2534A|(ORF1ab_polyprotein:G2269A(V757I))|(ORF1a_polyprotein:G2269A(V757I)) 1 0.000 4 0.000 15060 0.536 4 0.000 1 0.000 5 0.536 0.0 0.536
2618 A2618G|(ORF1ab_polyprotein:A2353G(I785V))|(ORF1a_polyprotein:A2353G(I785V)) 2 0.000 1075 0.434 2 0.434 0.0 0.434
2658 A2658G|(ORF1ab_polyprotein:A2393G(K798R))|(ORF1a_polyprotein:A2393G(K798R)) 2 0.001 4 0.000 17 0.001 1394 0.564 4 0.564 0.002 0.566
2706 C2706T|(ORF1ab_polyprotein:C2441T(T814I))|(ORF1a_polyprotein:C2441T(T814I)) 2 0.000 1078 0.435 2 0.435 0.0 0.435
2773 RATG13 C2773T|(ORF1ab_polyprotein:C2508T(Y836Y))|(ORF1a_polyprotein:C2508T(Y836Y)) 1382 0.565 1 0.565 0 0.565
linked 2790 C2790T|(ORF1ab_polyprotein:C2525T(T842I))|(ORF1a_polyprotein:C2525T(T842I)) 3770 0.996 8850 0.996 15872 0.996 1381 0.564 4 0.564 2.988 3.552
2832 A2832G|(ORF1ab_polyprotein:A2567G(K856R))|(ORF1a_polyprotein:A2567G(K856R)) 2 0.000 1 0.000 1056 0.432 3 0.432 0.0 0.432
linkedubiq 3037 RATG13,Delta C3037T|(ORF1ab_polyprotein:C2772T(F924F))|(ORF1a_polyprotein:C2772T(F924F)) 8403 0.986 7403 0.984 1159 0.981 10220 0.986 9931 0.987 5180 0.993 6 0.986 4.931 5.917
3096 C3096T|(ORF1ab_polyprotein:C2831T(S944L))|(ORF1a_polyprotein:C2831T(S944L)) 3069 0.303 1 0.000 2 0.303 0.0 0.303
3177 C3177T|(ORF1ab_polyprotein:C2912T(P971L))|(ORF1a_polyprotein:C2912T(P971L)) 4249 0.419 1 0.419 0 0.419
linked 3565 T3565C|(ORF1ab_polyprotein:T3300C(G1100G))|(ORF1a_polyprotein:T3300C(G1100G)) 1 1.000 47846 0.998 43717 0.998 6634 0.999 41686 0.662 33371 0.746 66253 0.998 7 0.662 5.739 6.401
3598 T3598C|(ORF1ab_polyprotein:T3333C(A1111A))|(ORF1a_polyprotein:T3333C(A1111A)) 7 0.000 5 0.000 25884 0.411 12 0.000 1 0.000 5 0.411 0.0 0.411
3744 A3744G|(ORF1ab_polyprotein:A3479G(H1160R))|(ORF1a_polyprotein:A3479G(H1160R)) 2 0.000 9 0.000 21086 0.335 10 0.000 3 0.000 5 0.335 0.0 0.335
3927 C3927T|(ORF1ab_polyprotein:C3662T(S1221L))|(ORF1a_polyprotein:C3662T(S1221L)) 1 0.000 2 0.000 1 0.000 16140 0.996 2 0.000 5 0.996 0.0 0.996
ubiq 4184 G4184A|(ORF1ab_polyprotein:G3919A(G1307S))|(ORF1a_polyprotein:G3919A(G1307S)) 1 1.000 130477 0.998 225764 0.998 20210 0.998 72930 0.998 144997 0.998 315063 0.998 2 1.000 8 0.998 6.99 7.988
ubiq 4321 C4321T|(ORF1ab_polyprotein:C4056T(A1352A))|(ORF1a_polyprotein:C4056T(A1352A)) 1 0.500 130045 0.996 224871 0.996 20116 0.995 72609 0.995 144263 0.995 310969 0.996 1 0.500 8 0.995 5.978 6.973
4442 RATG13 G4442A|(ORF1ab_polyprotein:G4177A(V1393M))|(ORF1a_polyprotein:G4177A(V1393M)) 11 0.000 20 0.000 14 0.000 20 0.000 7 0.000 20915 0.130 5 0.000 7 0.000 8 0.13 0.0 0.13
4475 C4475T|(ORF1ab_polyprotein:C4210T(R1404C))|(ORF1a_polyprotein:C4210T(R1404C)) 3 0.000 30 0.000 3 0.000 4 0.000 35058 0.376 6 0.000 1 0.000 7 0.376 0.0 0.376
4485 A4485C|(ORF1ab_polyprotein:A4220C(K1407T))|(ORF1a_polyprotein:A4220C(K1407T)) 55 0.001 98 0.000 19 0.000 37 0.000 36528 0.391 31 0.000 8 0.000 7 0.391 0.001 0.392
4495 A4495T|(ORF1ab_polyprotein:A4230T(K1410N))|(ORF1a_polyprotein:A4230T(K1410N)) 81 0.001 216 0.001 37 0.001 96 0.001 36443 0.390 87 0.001 21 0.000 7 0.39 0.005 0.395
4795 RATG13 C4795T|(ORF1ab_polyprotein:C4530T(S1510S))|(ORF1a_polyprotein:C4530T(S1510S)) 11 0.000 6 0.000 8 0.000 69990 0.997 6 0.000 5 0.997 0.0 0.997
4822 A4822C|(ORF1ab_polyprotein:A4557C(Q1519H))|(ORF1a_polyprotein:A4557C(Q1519H)) 113 0.000 34 0.000 34 0.000 19 0.000 70193 0.999 34 0.000 18 0.000 7 0.999 0.0 0.999
5182 T5182G|(ORF1ab_polyprotein:T4917G(D1639E))|(ORF1a_polyprotein:T4917G(D1639E)) 11 0.001 34 0.001 17 0.001 13 0.001 8 0.001 12884 0.998 9 0.001 7 0.000 8 0.998 0.006 1.004
5386 T5386G|(ORF1ab_polyprotein:T5121G(A1707A))|(ORF1a_polyprotein:T5121G(A1707A)) 4 0.000 66 0.000 10 0.000 9 0.000 21 0.000 34599 0.998 30 0.000 17 0.000 8 0.998 0.0 0.998
5455 A5455C|(ORF1ab_polyprotein:A5190C(E1730D))|(ORF1a_polyprotein:A5190C(E1730D)) 6 0.000 44 0.000 2 0.000 3 0.000 9 0.000 21816 0.998 17 0.000 10 0.000 8 0.998 0.0 0.998
5600 RATG13 T5600C|(ORF1ab_polyprotein:T5335C(F1779L))|(ORF1a_polyprotein:T5335C(F1779L)) 6 0.000 25 0.000 3 0.000 6 0.000 10 0.000 21779 0.995 20 0.000 15 0.000 8 0.995 0.0 0.995
5648 RATG13 A5648C|(ORF1ab_polyprotein:A5383C(K1795Q))|(ORF1a_polyprotein:A5383C(K1795Q)) 3 0.000 48 0.000 7 0.000 14 0.000 12 0.000 21827 0.997 17 0.000 14 0.000 8 0.997 0.0 0.997
5693 C5693T|(ORF1ab_polyprotein:C5428T(P1810S))|(ORF1a_polyprotein:C5428T(P1810S)) 2 0.000 13 0.000 3 0.000 2 0.000 21667 0.991 3 0.000 6 0.991 0.0 0.991
5883 A5883G|(ORF1ab_polyprotein:A5618G(Y1873C))|(ORF1a_polyprotein:A5618G(Y1873C)) 4 0.000 8 0.000 2 0.500 14 0.000 1 0.000 5 0.5 0.0 0.5
5889 5889-insertTCAC|(ORF1ab_polyprotein:ACAACC5623-5628ATCACCAATTCCinsert(TT1875-1876ITNSinsert))|(ORF1a_polyprotein:ACAACC5623-5628ATCACCAATTCCinsert(TT1875-1876ITNSinsert)) 2 0.500 1 0.5 0 0.5
linked 5892 5892-insertTT|(ORF1ab_polyprotein:ACAACC5623-5628ATCACCAATTCCinsert(TT1875-1876ITNSinsert))|(ORF1a_polyprotein:ACAACC5623-5628ATCACCAATTCCinsert(TT1875-1876ITNSinsert)) 2 0.056 1 0.056 0 0.056
6064 T6064C|(ORF1ab_polyprotein:T5799C(D1933D))|(ORF1a_polyprotein:T5799C(D1933D)) 3 0.000 57 0.000 2 0.000 11 0.000 5 0.000 57136 0.254 7 0.000 7 0.254 0.0 0.254
6070 C6070A|(ORF1ab_polyprotein:C5805A(I1935I))|(ORF1a_polyprotein:C5805A(I1935I)) 52 0.001 331 0.001 38 0.001 93 0.001 31 0.001 92577 0.408 44 0.001 7 0.408 0.006 0.414
6145 C6145T|(ORF1ab_polyprotein:C5880T(F1960F))|(ORF1a_polyprotein:C5880T(F1960F)) 3 0.000 23 0.000 5 0.000 5 0.000 5 0.000 57131 0.254 4 0.000 7 0.254 0.0 0.254
6312 C6312T|(ORF1ab_polyprotein:C6047T(T2016I))|(ORF1a_polyprotein:C6047T(T2016I)) 3 0.000 5 0.000 58028 0.365 4 0.000 5 0.000 5 0.365 0.0 0.365
linkedubiq 6336 C6336T|(ORF1ab_polyprotein:C6071T(S2024L))|(ORF1a_polyprotein:C6071T(S2024L)) 1 0.333 3 0.000 1 1.000 9 0.000 158160 0.994 2 0.000 1 0.000 7 0.994 1.333 2.327
linkedubiq 6513 GTT6513-6515del|(ORF1ab_polyprotein:AGTTTA6247-6252ATAdel(SL2083-2084Idel))|(ORF1a_polyprotein:AGTTTA6247-6252ATAdel(SL2083-2084Idel)) 1 0.250 1 1.000 21646 0.264 158236 0.993 4 0.993 1.514 2.507
7834 C7834T|(ORF1ab_polyprotein:C7569T(N2523N))|(ORF1a_polyprotein:C7569T(N2523N)) 3 0.000 5 0.000 69781 0.995 13 0.000 2 0.000 5 0.995 0.0 0.995
ubiq 8293 C8293T|(ORF1ab_polyprotein:C8028T(T2676T))|(ORF1a_polyprotein:C8028T(T2676T)) 49946 0.993 337129 0.993 50306 0.993 2 0.500 103062 0.993 2 1.000 116744 0.993 2 1.000 4 0.800 9 1.0 7.265 8.265
ubiq 8393 G8393A|(ORF1ab_polyprotein:G8128A(A2710T))|(ORF1a_polyprotein:G8128A(A2710T)) 49408 0.996 333493 0.997 49789 0.996 2 0.500 102052 0.997 2 1.000 115444 0.997 2 1.000 2 1.000 9 1.0 7.483 8.483
8894 A8894G|(ORF1ab_polyprotein:A8629G(T2877A))|(ORF1a_polyprotein:A8629G(T2877A)) 3 0.000 7 0.000 2 0.000 4373 0.998 1 0.000 5 0.998 0.0 0.998
8970 T8970G|(ORF1ab_polyprotein:T8705G(L2902R))|(ORF1a_polyprotein:T8705G(L2902R)) 2 0.000 7 0.000 1 0.000 4369 0.997 4 0.997 0.0 0.997
10012 T10012A|(ORF1ab_polyprotein:T9747A(L3249L))|(ORF1a_polyprotein:T9747A(L3249L)) 2 0.001 4 0.000 5 0.001 5 0.000 2 0.001 3941 0.999 6 0.001 7 0.999 0.004 1.003
linkedubiq 10029 C10029T|(ORF1ab_polyprotein:C9764T(T3255I))|(ORF1a_polyprotein:C9764T(T3255I)) 2899 0.997 12597 0.997 5176 0.995 13558 0.996 2250 0.997 3933 0.997 6985 0.993 7 0.997 5.975 6.9719999999999995
10082 T10082A|(ORF1ab_polyprotein:T9817A(S3273T))|(ORF1a_polyprotein:T9817A(S3273T)) 5 0.002 7 0.001 7 0.001 13 0.001 3971 0.993 12 0.002 6 0.993 0.007 1.0
10279 RATG13 C10279T|(ORF1ab_polyprotein:C10014T(L3338L))|(ORF1a_polyprotein:C10014T(L3338L)) 2 0.000 1 0.000 4 0.000 37895 0.995 1 0.000 5 0.995 0.0 0.995
linkedubiq 10447 RATG13 G10447A|(ORF1ab_polyprotein:G10182A(R3394R))|(ORF1a_polyprotein:G10182A(R3394R)) 46231 0.998 52724 0.998 32724 0.998 70922 0.998 18596 0.997 38013 0.998 26284 0.998 7 0.998 5.987 6.985
linkedubiq 10449 C10449A|(ORF1ab_polyprotein:C10184A(P3395H))|(ORF1a_polyprotein:C10184A(P3395H)) 46231 0.998 52731 0.998 32713 0.998 70911 0.997 18606 0.998 38004 0.998 26289 0.998 7 0.998 5.987 6.985
10563 G10563T|(ORF1ab_polyprotein:G10298T(G3433V))|(ORF1a_polyprotein:G10298T(G3433V)) 35 0.000 78 0.000 25 0.000 11 0.000 1 0.000 62235 0.405 6 0.000 7 0.405 0.0 0.405
10717 T10717C|(ORF1ab_polyprotein:T10452C(N3484N))|(ORF1a_polyprotein:T10452C(N3484N)) 24 0.000 57 0.000 27 0.000 9 0.000 64406 0.530 5 0.53 0.0 0.53
10761 A10761G|(ORF1ab_polyprotein:A10496G(K3499R))|(ORF1a_polyprotein:A10496G(K3499R)) 17 0.000 71 0.000 19 0.000 1 0.000 55142 0.462 5 0.462 0.0 0.462
11081 RATG13 T11081G|(ORF1ab_polyprotein:T10816G(L3606V))|(ORF1a_polyprotein:T10816G(L3606V)) 1 0.000 14 0.001 70 0.001 36 0.001 124605 0.997 21 0.001 6 0.997 0.004 1.001
11109 C11109T|(ORF1ab_polyprotein:C10844T(A3615V))|(ORF1a_polyprotein:C10844T(A3615V)) 4 0.000 3 0.000 7 0.000 1 0.000 124611 0.997 3 0.000 6 0.997 0.0 0.997
11199 C11199T|(ORF1ab_polyprotein:C10934T(A3645V))|(ORF1a_polyprotein:C10934T(A3645V)) 5 0.000 2 0.000 6 0.000 6 0.000 150823 0.999 3 0.000 6 0.999 0.0 0.999
11283 GTTTGTCTG11283-11291del|(ORF1ab_polyprotein:AGTTTGTCTGGT11017-11028AGTdel(SLSG3673-3676Sdel))|(ORF1a_polyprotein:AGTTTGTCTGGT11017-11028AGTdel(SLSG3673-3676Sdel)) 5 0.000 11 0.000 16409 0.605 20 0.000 29 0.001 5 0.605 0.001 0.606
11449 T11449C|(ORF1ab_polyprotein:T11184C(D3728D))|(ORF1a_polyprotein:T11184C(D3728D)) 6 0.000 7883 0.288 7 0.000 1 0.000 4 0.288 0.0 0.288
11455 RATG13 C11455T|(ORF1ab_polyprotein:C11190T(A3730A))|(ORF1a_polyprotein:C11190T(A3730A)) 5 0.000 7890 0.288 1 0.000 3 0.288 0.0 0.288
11522 T11522G|(ORF1ab_polyprotein:T11257G(F3753V))|(ORF1a_polyprotein:T11257G(F3753V)) 11 0.005 13 0.007 42 0.007 25 0.007 3778 0.765 18 0.004 1 0.007 7 0.765 0.037 0.802
11537 A11537G|(ORF1ab_polyprotein:A11272G(I3758V))|(ORF1a_polyprotein:A11272G(I3758V)) 2 0.000 3765 0.757 2 0.757 0.0 0.757
11580 C11580T|(ORF1ab_polyprotein:C11315T(T3772I))|(ORF1a_polyprotein:C11315T(T3772I)) 1 0.000 1142 0.230 1 0.000 3 0.23 0.0 0.23
linked 11727 G11727A|(ORF1ab_polyprotein:G11462A(R3821K))|(ORF1a_polyprotein:G11462A(R3821K)) 1975 0.995 1869 0.994 6014 0.994 3511 0.993 1047 0.230 2480 0.619 85 0.988 7 0.23 5.583 5.813000000000001
11875 A11875G|(ORF1ab_polyprotein:A11610G(V3870V))|(ORF1a_polyprotein:A11610G(V3870V)) 36 0.000 3 0.000 5 0.000 26 0.000 47017 0.997 62 0.000 2 0.000 7 0.997 0.0 0.997
12100 C12100T|(ORF1ab_polyprotein:C11835T(A3945A))|(ORF1a_polyprotein:C11835T(A3945A)) 5 0.000 1 0.000 2 0.000 9 0.000 36096 0.749 15 0.000 2 0.000 7 0.749 0.0 0.749
12116 C12116T|(ORF1ab_polyprotein:C11851T(L3951F))|(ORF1a_polyprotein:C11851T(L3951F)) 13 0.000 4 0.000 12 0.000 11950 0.248 23 0.000 5 0.248 0.0 0.248
12135 T12135C|(ORF1ab_polyprotein:T11870C(F3957S))|(ORF1a_polyprotein:T11870C(F3957S)) 20 0.000 4 0.000 5 0.000 25 0.000 12485 0.260 38 0.000 6 0.26 0.0 0.26
12328 G12328A|(ORF1ab_polyprotein:G12063A(K4021K))|(ORF1a_polyprotein:G12063A(K4021K)) 5 0.000 1 0.000 3 0.000 16490 0.511 2 0.000 5 0.511 0.0 0.511
12331 G12331T|(ORF1ab_polyprotein:G12066T(R4022S))|(ORF1a_polyprotein:G12066T(R4022S)) 41 0.001 24 0.001 48 0.001 15 0.001 16525 0.512 44 0.001 6 0.512 0.005 0.517
linkedubiq 12789 C12789T|(ORF1ab_polyprotein:C12524T(T4175I))|(ORF1a_polyprotein:C12524T(T4175I)) 1 0.500 62120 0.996 27464 0.997 56076 0.995 28259 0.996 3533 0.997 18077 0.997 7 0.997 5.481 6.478
linkedubiq 12815 RATG13 C12815T|(ORF1ab_polyprotein:C12550T(L4184L))|(ORF1a_polyprotein:C12550T(L4184L)) 1 1.000 61844 0.992 27422 0.993 55939 0.992 28162 0.992 3523 0.994 18009 0.993 7 0.994 5.962 6.9559999999999995
12866 G12866T|(ORF1ab_polyprotein:G12601T(G4201*))|(ORF1a_polyprotein:G12601T(G4201*)) 29 0.000 5 0.000 17 0.000 7 0.000 3527 0.996 3 0.000 6 0.996 0.0 0.996
linkedubiq 12880 C12880T|(ORF1ab_polyprotein:C12615T(I4205I))|(ORF1a_polyprotein:C12615T(I4205I)) 1 1.000 61933 0.993 27471 0.994 55990 0.993 28188 0.993 3513 0.993 18034 0.994 1 0.500 8 0.993 6.467 7.46
13195 T13195C|(ORF1ab_polyprotein:T12930C(V4310V))|(ORF1a_polyprotein:T12930C(V4310V)) 6 0.000 2 0.001 1 0.000 1 0.000 1 0.000 6639 0.998 5 0.000 7 0.998 0.001 0.999
13296 A13296C|(ORF1ab_polyprotein:A13031C(D4344A))|(ORF1a_polyprotein:A13031C(D4344A)) 16 0.000 1 0.000 8 0.001 8 0.000 6637 0.997 24 0.000 6 0.997 0.001 0.998
14034 T14034A|(ORF1ab_polyprotein:T13770A(N4590K)) 2 0.000 25 0.000 3 0.000 251 0.988 4 0.988 0.0 0.988
14107 A14107C|(ORF1ab_polyprotein:A13843C(I4615L)) 5 0.000 22 0.000 11 0.000 56 0.000 10 0.000 66740 0.999 6 0.000 7 0.999 0.0 0.999
14116 A14116G|(ORF1ab_polyprotein:A13852G(T4618A)) 25 0.000 11 0.000 9 0.000 7 0.000 67409 0.999 4 0.000 6 0.999 0.0 0.999
14126 G14126A|(ORF1ab_polyprotein:G13862A(S4621N)) 9 0.000 10 0.000 4 0.000 3 0.000 67278 0.997 1 0.000 6 0.997 0.0 0.997
linked 14459 T14459G|(ORF1ab_polyprotein:T14195G(F4732C)) 15 0.002 4 0.333 2 0.002 94 0.003 27 0.002 1 0.333 15 0.003 7 0.333 0.34500000000000003 0.678
14461 G14461T|(ORF1ab_polyprotein:G14197T(V4733L)) 3 0.000 5 0.000 2 0.000 1 1.000 4 1.0 0.0 1.0
14465 T14465A|(ORF1ab_polyprotein:T14201A(V4734D)) 2 0.000 7 0.000 2 0.000 1 1.000 1 0.000 5 1.0 0.0 1.0
14718 G14718T|(ORF1ab_polyprotein:G14454T(K4818N)) 5 0.001 16 0.000 2 0.000 1 0.125 4 0.125 0.001 0.126
14788 A14788G|(ORF1ab_polyprotein:A14524G(I4842V)) 6 0.000 6 0.000 2 0.000 6137 0.520 1 0.000 5 0.52 0.0 0.52
14889 C14889T|(ORF1ab_polyprotein:C14625T(Y4875Y)) 3 0.000 5 0.000 2 0.000 6227 0.519 1 0.000 5 0.519 0.0 0.519
15231 T15231C|(ORF1ab_polyprotein:T14967C(G4989G)) 20 0.000 8 0.000 52 0.000 20 0.000 24347 0.505 8 0.000 6 0.505 0.0 0.505
15240 C15240T|(ORF1ab_polyprotein:C14976T(N4992N)) 7 0.000 1 0.000 12 0.000 2 0.000 46564 0.989 2 0.000 6 0.989 0.0 0.989
15267 AG15267-15268del|(ORF1ab_polyprotein:15003-15004del(5001fs)) 23082 0.490 1 0.49 0 0.49
15284 T15284C|(ORF1ab_polyprotein:T15020C(M5007T)) 29 0.000 9 0.000 46 0.000 27 0.000 23104 0.491 12 0.000 6 0.491 0.0 0.491
15640 A15640G|(ORF1ab_polyprotein:A15376G(N5126D)) 4 0.000 15 0.000 24 0.000 11 0.000 15895 0.268 14 0.000 7 0.000 7 0.268 0.0 0.268
15656 C15656T|(ORF1ab_polyprotein:C15392T(T5131I)) 2 0.000 1 0.000 14 0.000 9 0.000 59144 0.997 5 0.000 6 0.997 0.0 0.997
15676 T15676G|(ORF1ab_polyprotein:T15412G(Y5138D)) 3 0.000 9 0.000 26 0.000 14 0.000 15456 0.261 12 0.000 2 0.000 7 0.261 0.0 0.261
15738 C15738T|(ORF1ab_polyprotein:C15474T(F5158F)) 1 0.000 7679 0.692 2 0.692 0.0 0.692
16076 A16076G|(ORF1ab_polyprotein:A15812G(D5271G)) 17 0.000 12 0.000 46 0.000 22 0.000 57786 0.288 7 0.000 6 0.288 0.0 0.288
16163 C16163A|(ORF1ab_polyprotein:C15899A(T5300N)) 44 0.000 32 0.000 72 0.000 49 0.000 57780 0.288 21 0.000 6 0.288 0.0 0.288
17014 G17014A|(ORF1ab_polyprotein:G16750A(D5584N)) 2 0.000 11704 0.356 2 0.356 0.0 0.356
17236 A17236G|(ORF1ab_polyprotein:A16972G(I5658V)) 8 0.000 8 0.000 10 0.000 12 0.000 57511 0.995 5 0.000 9 0.000 7 0.995 0.0 0.995
17322 A17322G|(ORF1ab_polyprotein:A17058G(A5686A)) 12 0.000 28 0.000 12 0.000 22 0.000 50868 0.881 18 0.000 26 0.000 7 0.881 0.0 0.881
18501 C18501A|(ORF1ab_polyprotein:C18237A(Y6079*)) 24 0.000 20 0.000 1 0.125 8 0.000 4 0.125 0.0 0.125
18509 T18509G|(ORF1ab_polyprotein:T18245G(L6082R)) 89 0.001 93 0.001 1 0.143 48 0.001 4 0.143 0.003 0.146
18513 T18513G|(ORF1ab_polyprotein:T18249G(P6083P)) 383 0.003 392 0.003 1 0.143 205 0.003 4 0.143 0.009000000000000001 0.152
18539 T18539G|(ORF1ab_polyprotein:T18275G(V6092G)) 23 0.000 20 0.000 1 0.167 13 0.000 4 0.167 0.0 0.167
18577 A18577C|(ORF1ab_polyprotein:A18313C(R6105R)) 189 0.001 151 0.001 1 0.167 129 0.002 4 0.167 0.004 0.171
18581 T18581G|(ORF1ab_polyprotein:T18317G(V6106G)) 380 0.003 318 0.002 1 0.167 273 0.003 4 0.167 0.008 0.17500000000000002
18585 RATG13 A18585G|(ORF1ab_polyprotein:A18321G(V6107V)) 504 0.003 426 0.003 1 0.167 314 0.004 4 0.167 0.01 0.17700000000000002
linked 18587 T18587G|(ORF1ab_polyprotein:T18323G(F6108C)) 526 0.004 468 0.003 2 0.333 335 0.004 1 0.250 5 0.333 0.261 0.5940000000000001
18592 T18592G|(ORF1ab_polyprotein:T18328G(L6110V)) 908 0.006 863 0.006 1 0.167 545 0.007 4 0.167 0.019 0.186
18607 T18607G|(ORF1ab_polyprotein:TTT18343-18345GGT(F6115G)) 41 0.000 27 0.000 1 0.167 17 0.000 4 0.167 0.0 0.167
18608 T18608G|(ORF1ab_polyprotein:TTT18343-18345GGT(F6115G)) 41 0.000 27 0.000 1 0.167 17 0.000 4 0.167 0.0 0.167
18611 A18611C|(ORF1ab_polyprotein:A18347C(E6116A)) 15 0.000 14 0.000 1 0.167 15 0.000 4 0.167 0.0 0.167
18613 T18613G|(ORF1ab_polyprotein:T18349G(L6117V)) 259 0.002 263 0.002 1 0.167 136 0.002 4 0.167 0.006 0.17300000000000001
18622 A18622C|(ORF1ab_polyprotein:A18358C(M6120L)) 137 0.001 115 0.001 1 0.167 76 0.001 4 0.167 0.003 0.17
18638 A18638C|(ORF1ab_polyprotein:A18374C(K6125T)) 57 0.000 45 0.000 1 0.167 22 0.000 4 0.167 0.0 0.167
18645 A18645C|(ORF1ab_polyprotein:A18381C(G6127G)) 148 0.001 139 0.001 2 0.286 99 0.001 4 0.286 0.003 0.289
18658 T18658C|(ORF1ab_polyprotein:T18394C(C6132R)) 65 0.000 65 0.000 1 0.143 46 0.001 4 0.143 0.001 0.144
18667 T18667G|(ORF1ab_polyprotein:T18403G(C6135G)) 257 0.002 301 0.002 1 0.143 183 0.002 4 0.143 0.006 0.149
linked 18672 T18672G|(ORF1ab_polyprotein:T18408G(D6136E)) 1 0.167 259 0.002 389 0.003 1 0.143 223 0.003 5 0.143 0.17500000000000002 0.318
18739 G18739T|(ORF1ab_polyprotein:G18475T(D6159Y)) 64 0.000 65 0.000 1 0.167 37 0.000 4 0.167 0.0 0.167
18752 A18752C|(ORF1ab_polyprotein:A18488C(N6163T)) 335 0.002 206 0.002 1 0.167 143 0.002 4 0.167 0.006 0.17300000000000001
18781 G18781T|(ORF1ab_polyprotein:G18517T(G6173C)) 83 0.001 79 0.001 1 0.167 50 0.001 4 0.167 0.003 0.17
linked 18793 A18793G|(ORF1ab_polyprotein:A18529G(N6177D)) 19 0.000 19 0.000 1 0.091 8 0.000 4 0.091 0.0 0.091
18802 A18802C|(ORF1ab_polyprotein:A18538C(S6180R)) 439 0.003 475 0.004 2 0.167 269 0.003 4 0.167 0.01 0.17700000000000002
linkedubiq 18894 C18894T|(ORF1ab_polyprotein:C18630T(C6210C)) 81292 0.996 1 1.000 7617 0.996 1 1.000 77803 0.996 35407 0.996 59639 0.996 1 1.000 8 0.996 6.984 7.98
linked 18977 A18977T|(ORF1ab_polyprotein:A18713T(Q6238L)) 121 0.001 8 0.001 145 0.002 58 0.002 87 0.001 5 0.002 0.005 0.007
linked 19046 A19046C|(ORF1ab_polyprotein:A18782C(K6261T)) 841 0.010 61 0.008 837 0.011 421 0.012 678 0.011 5 0.012 0.04 0.052000000000000005
linked 19059 T19059C|(ORF1ab_polyprotein:T18795C(C6265C)) 19 0.000 2 0.000 17 0.000 7 0.000 19 0.000 5 0.0 0.0 0.0
linked 19129 G19129C|(ORF1ab_polyprotein:G18865C(E6289Q)) 16 0.000 2 0.000 12 0.000 4 0.000 7 0.000 5 0.0 0.0 0.0
linked 19137 A19137T|(ORF1ab_polyprotein:A18873T(L6291F)) 43 0.000 10 0.000 63 0.001 15 0.000 41 0.001 5 0.0 0.002 0.002
linked 19163 A19163C|(ORF1ab_polyprotein:A18899C(D6300A)) 15 0.000 2 0.000 9 0.000 5 0.000 12 0.000 5 0.0 0.0 0.0
19186 C19186G|(ORF1ab_polyprotein:C18922G(L6308V)) 9 0.000 21 0.001 7 0.000 1 0.125 7 0.001 5 0.125 0.002 0.127
19193 G19193T|(ORF1ab_polyprotein:G18929T(W6310L)) 12 0.001 24 0.001 15 0.001 1 0.125 5 0.001 5 0.125 0.004 0.129
linked 19413 A19413T|(ORF1ab_polyprotein:A19149T(Q6383H)) 12 0.001 1 1.000 20 0.001 21 0.001 1 0.500 8 0.001 6 0.5 1.004 1.504
19493 G19493A|(ORF1ab_polyprotein:G19229A(R6410K)) 10 0.000 8 0.000 8 0.000 7 0.000 80850 0.502 9 0.000 5 0.000 7 0.502 0.0 0.502
19584 T19584C|(ORF1ab_polyprotein:T19320C(D6440D)) 98 0.000 68 0.000 53 0.000 73 0.000 81760 0.500 96 0.000 32 0.000 7 0.5 0.0 0.5
19728 T19728C|(ORF1ab_polyprotein:T19464C(D6488D)) 33 0.000 18 0.000 13 0.000 23 0.000 80042 0.496 20 0.000 11 0.000 7 0.496 0.0 0.496
20315 T20315C|(ORF1ab_polyprotein:T20051C(F6684S)) 5 0.000 2 0.000 5 0.000 8 0.000 15786 0.997 8 0.000 6 0.997 0.0 0.997
20404 C20404T|(ORF1ab_polyprotein:C20140T(P6714S)) 5 0.000 2 0.000 3481 0.180 1 0.000 1 0.000 5 0.18 0.0 0.18
20411 A20411C|(ORF1ab_polyprotein:A20147C(E6716A)) 1 0.000 3496 0.182 1 0.000 1 0.000 4 0.182 0.0 0.182
21271 T21271-21271del|(ORF1ab_polyprotein:21007-21007del(7003fs)) 27 0.000 27 0.000 2 0.000 59096 0.248 12 0.000 41 0.000 6 0.248 0.0 0.248
21587 C21587A|(surface_glycoprotein:C25A(P9T)) 5 0.001 51 0.001 6 0.001 2074 0.997 4 0.001 18 0.001 6 0.997 0.005 1.002
21624 G21624T|(surface_glycoprotein:G62T(R21I)) 7 0.000 2353 0.992 2 0.992 0.0 0.992
linkedubiq 21711 RATG13 C21711T|(surface_glycoprotein:C149T(S50L)) 1451 0.991 1 1.000 274 0.993 285 0.993 1739 0.995 1809 0.997 6 0.993 4.976 5.969
21762 C21762T|(surface_glycoprotein:C200T(A67V)) 291 0.990 1 0.99 0 0.99
linkedubiq 21765 TACATG21765-21770del|(surface_glycoprotein:ATACATGTC202-210ATCdel(IHV68-70Idel)) 1462 0.969 1 1.000 278 0.975 291 0.990 1764 0.973 1823 0.986 6 0.99 4.903 5.893
21789 RATG13 C21789T|(surface_glycoprotein:C227T(T76I)) 292 0.993 1 0.993 0 0.993
21792 A21792T|(surface_glycoprotein:A230T(K77M)) 9 0.006 276 0.939 2 0.939 0.006 0.945
21846 C21846T|(surface_glycoprotein:C284T(T95I)) 289 1.000 1 1.0 0 1.0
21969 G21969T|(surface_glycoprotein:G407T(C136F)) 154 0.001 213 0.001 47 0.001 134 0.001 100 0.001 51785 0.505 75 0.001 7 0.505 0.006 0.511
21977 CCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGG21977-22018del|(surface_glycoprotein:415-456del(PFLGVYYHKNNKSW139-152del)) 56419 0.551 1 0.551 0 0.551
21987 GTGTTTATT21987-21995del|(surface_glycoprotein:GGTGTTTATTAC424-435GACdel(GVYY142-145Ddel)) 45591 0.445 1 0.445 0 0.445
22012 AAGTTGGATGGAAAGTGAGTT22012-22032del|(surface_glycoprotein:AAAAGTTGGATGGAAAGTGAGTTC448-471AACdel(KSWMESEF150-157Ndel)) 45739 0.447 1 0.447 0 0.447
22079 C22079A|(surface_glycoprotein:C517A(Q173K)) 111 0.001 186 0.001 34 0.001 100 0.001 96 0.001 46232 0.445 49 0.000 7 0.445 0.005 0.45
22082 C22082T|(surface_glycoprotein:C520T(P174S)) 13 0.000 17 0.000 2 0.000 15 0.000 7 0.000 46121 0.444 5 0.000 7 0.444 0.0 0.444
22106 A22106G|(surface_glycoprotein:A544G(K182E)) 12 0.000 49 0.000 13 0.000 25 0.000 24 0.000 46137 0.444 6 0.444 0.0 0.444
linkedubiq 22194 ATT22194-22196del|(surface_glycoprotein:AATTTA631-636ATAdel(NL211-212Idel)) 213013 0.996 236292 0.997 100119 0.997 151418 0.997 169437 0.997 101860 0.996 141165 0.997 103207 0.998 414417 0.998 9 0.996 7.977 8.973
22205 22205-insertGAGCCAGAA|(surface_glycoprotein:643insertGAGCCAGAA(215EPE)) 101238 0.387 1 0.387 0 0.387
22209 T22209C|(surface_glycoprotein:T647C(L216P)) 52990 0.203 1 0.203 0 0.203
22217 G22217A|(surface_glycoprotein:G655A(G219S)) 7 0.000 15 0.000 4 0.000 7 0.000 6 0.000 256316 0.979 5 0.000 3 0.000 7 0.000 9 0.979 0.0 0.979
22224 C22224T|(surface_glycoprotein:C662T(S221L)) 28 0.000 36 0.000 39 0.000 37 0.000 22 0.000 48526 0.185 40 0.000 10 0.000 46 0.000 9 0.185 0.0 0.185
22289 GCTTTA22289-22294del|(surface_glycoprotein:727-732del(AL243-244del)) 54268 0.337 1 0.337 0 0.337
22308 T22308C|(surface_glycoprotein:T746C(L249S)) 16 0.000 3 0.000 8 0.000 157487 0.978 8 0.000 14 0.000 37 0.000 7 0.978 0.0 0.978
22329 CAGGTTGGACAGCTGGTGCTG22329-22349del|(surface_glycoprotein:TCAGGTTGGACAGCTGGTGCTGCA766-789TCAdel(SGWTAGAA256-263Sdel)) 156186 0.972 1 0.972 0 0.972
22578 G22578A|(surface_glycoprotein:G1016A(G339D)) 4 0.000 3 0.000 1 0.000 3 0.000 10369 0.697 2 0.000 55 0.000 7 0.697 0.0 0.697
linked 22599 RATG13 G22599C|(surface_glycoprotein:G1037C(R346T)) 47488 0.995 30759 0.995 15294 0.905 13631 0.995 24083 0.918 13511 0.908 9107 0.995 77 0.987 724221 0.996 9 0.908 7.786 8.693999999999999
22661 G22661T|(surface_glycoprotein:G1099T(V367F)) 23 0.000 18 0.001 5 0.000 6 0.000 12 0.000 9235 0.610 4 0.000 595 0.001 8 0.61 0.002 0.612
22667 T22667A|(surface_glycoprotein:T1105A(Y369N)) 13 0.000 18 0.001 7 0.000 9 0.001 10 0.000 9223 0.610 5 0.001 318 0.000 8 0.61 0.003 0.613
22673 T22673C|(surface_glycoprotein:TCC1111-1113CTC(S371L)) 25 0.001 26 0.001 14 0.001 7 0.001 14 0.001 10490 0.696 4 0.000 227 0.000 8 0.696 0.005 0.701
22674 C22674T|(surface_glycoprotein:TCC1111-1113CTC(S371L)) 25 0.001 26 0.001 14 0.001 7 0.001 14 0.001 10490 0.697 4 0.000 227 0.000 8 0.697 0.005 0.702
linked 22679 T22679C|(surface_glycoprotein:T1117C(S373P)) 48054 0.994 31114 0.994 16992 0.993 13789 0.993 26386 0.994 13698 0.910 9189 0.993 78 1.000 731123 0.994 9 0.91 7.955 8.865
22683 T22683C|(surface_glycoprotein:T1121C(F374S)) 15 0.000 11 0.000 8 0.000 1 0.000 11 0.000 9216 0.613 4 0.000 114 0.000 8 0.613 0.0 0.613
22812 A22812C|(surface_glycoprotein:AAG1249-1251ACT(K417T)) 20 0.000 14 0.000 9 0.000 5 0.000 7 0.000 63211 0.872 2 0.000 154 0.000 8 0.872 0.0 0.872
22813 G22813T|(surface_glycoprotein:AAG1249-1251ACT(K417T)) 20 0.000 14 0.000 9 0.000 5 0.000 7 0.000 63211 0.872 2 0.000 154 0.000 8 0.872 0.0 0.872
22894 RATG13 G22894A|(surface_glycoprotein:G1332A(K444K)) 57487 0.995 1 0.000 2 0.995 0.0 0.995
22907 T22907A|(surface_glycoprotein:T1345A(Y449N)) 2 0.003 57478 0.995 3 0.000 3 0.995 0.003 0.998
linkedubiq 22992 G22992A|(surface_glycoprotein:G1430A(S477N)) 2 1.000 2901 0.998 2 1.000 712 0.997 57642 0.996 628 1.000 10695 0.999 112 0.991 8 0.996 6.985 7.981
23040 A23040G|(surface_glycoprotein:A1478G(Q493R)) 57709 0.998 1 0.002 2 0.998 0.002 1.0
linkedubiq 23063 A23063T|(surface_glycoprotein:A1501T(N501Y)) 2887 0.993 1 1.000 711 0.996 57487 0.994 626 0.997 10670 0.997 110 0.991 7 0.994 5.974 6.968
23073 G23073A|(surface_glycoprotein:G1511A(G504D)) 57717 0.998 1 0.998 0 0.998
linkedubiq 23075 RATG13 T23075C|(surface_glycoprotein:T1513C(Y505H)) 2904 0.999 1 0.250 713 0.997 57725 0.999 628 0.998 10688 0.999 109 0.956 7 0.999 5.199 6.1979999999999995
23119 T23119A|(surface_glycoprotein:T1557A(H519Q)) 58 0.000 90 0.000 47 0.000 131 0.000 64 0.000 5188 0.108 67 0.000 383 0.001 8 0.108 0.001 0.109
23202 C23202A|(surface_glycoprotein:C1640A(T547K)) 104 0.001 154 0.001 96 0.001 217 0.001 142 0.001 48907 0.995 128 0.001 828 0.001 8 0.995 0.007 1.002
linkedubiq 23403 Delta A23403G|(surface_glycoprotein:A1841G(D614G)) 120295 0.999 235614 0.998 155790 0.998 313362 0.998 209053 0.998 60002 0.998 176722 0.999 1 1.000 598196 0.998 9 0.998 7.9879999999999995 8.985999999999999
23436 A23436G|(surface_glycoprotein:A1874G(H625R)) 16 0.000 35 0.000 20 0.000 75 0.000 38 0.000 13226 0.191 39 0.000 63 0.000 8 0.191 0.0 0.191
23453 C23453G|(surface_glycoprotein:C1891G(P631A)) 1 0.000 7766 0.678 2 0.678 0.0 0.678
linkedubiq 23525 C23525T|(surface_glycoprotein:C1963T(H655Y)) 12227 0.998 9408 0.998 18529 0.998 11403 0.997 6165 0.998 5 0.997 3.992 4.989
linked 23598 A23598G|(surface_glycoprotein:AAT2035-2037AGG(N679R)) 2 0.000 56105 0.477 7 0.636 24 0.000 3 0.000 58442 0.497 695798 0.999 7 0.0 2.609 2.609
linked 23599 T23599G|(surface_glycoprotein:AAT2035-2037AGG(N679R)) 2 0.000 56105 0.477 7 0.636 24 0.000 3 0.000 58442 0.497 695798 0.999 7 0.0 2.609 2.609
linkedubiq 23599 T23599G|(surface_glycoprotein:T2037G(N679K)) 69832 1.000 61362 0.522 1 0.091 88221 0.999 7580 0.999 59064 0.502 27 0.000 7 0.999 3.114 4.1129999999999995
23604 C23604A|(surface_glycoprotein:C2042A(P681H)) 7 0.000 11 0.000 6 0.000 1 0.125 6 0.000 34 0.000 6 0.125 0.0 0.125
linked 23604 Delta C23604G|(surface_glycoprotein:C2042G(P681R)) 70419 0.999 112384 0.999 8 0.889 74335 0.999 6 0.750 112589 0.999 708194 0.999 7 0.75 5.884 6.634
23667 A23667C|(surface_glycoprotein:A2105C(E702A)) 2 0.000 1 0.200 4 0.000 6 0.000 4 0.2 0.0 0.2
23669 A23669C|(surface_glycoprotein:A2107C(N703H)) 4 0.000 9 0.000 4 0.000 1 0.200 5 0.000 24 0.000 6 0.2 0.0 0.2
23819 T23819G|(surface_glycoprotein:T2257G(L753V)) 26 0.000 59 0.001 38 0.001 1 0.200 52 0.000 159 0.000 6 0.2 0.002 0.202
linked 23854 C23854A|(surface_glycoprotein:C2292A(N764K)) 70274 0.996 112961 0.997 7 0.467 74609 0.997 4 0.000 112518 0.997 707106 0.996 7 0.0 5.45 5.45
linkedubiq 23948 G23948T|(surface_glycoprotein:G2386T(D796Y)) 3 1.000 35178 0.986 59900 0.986 70808 0.987 47685 0.980 3 0.600 8 0.667 7 0.98 5.226 6.2059999999999995
23953 T23953A|(surface_glycoprotein:T2391A(F797L)) 5 0.000 31 0.001 22 0.000 48013 0.987 4 0.987 0.001 0.988
24032 A24032G|(surface_glycoprotein:A2470G(N824D)) 6 0.000 24 0.000 39 0.001 49517 0.992 4 0.992 0.001 0.993
24130 C24130A|(surface_glycoprotein:C2568A(N856K)) 9 0.000 29 0.000 22 0.000 48239 0.992 4 0.992 0.0 0.992
24188 G24188T|(surface_glycoprotein:G2626T(A876S)) 6 0.000 15 0.000 15 0.000 48537 0.998 4 0.998 0.0 0.998
24199 RATG13 G24199A|(surface_glycoprotein:G2637A(A879A)) 8 0.000 10 0.000 1 0.000 48022 0.999 4 0.999 0.0 0.999
24443 24443-insertT|(surface_glycoprotein:2881insertT(961fs)) 2 0.667 1 0.667 0 0.667
linkedubiq 24469 T24469A|(surface_glycoprotein:T2907A(N969K)) 2462 0.990 333 0.994 834 0.990 5 1.000 1580 0.993 5 1.0 3.967 4.9670000000000005
24503 C24503T|(surface_glycoprotein:C2941T(L981F)) 1 0.000 4124 0.199 2 0.199 0.0 0.199
ubiq 24990 C24990T|(surface_glycoprotein:C3428T(P1143L)) 1 1.000 1 1.000 48954 0.994 90344 0.995 99921 0.994 3 1.000 160138 0.994 7 1.0 5.977 6.977
ubiq 25000 RATG13 C25000T|(surface_glycoprotein:C3438T(D1146D)) 1 1.000 48963 0.994 90160 0.993 99829 0.993 3 1.000 159936 0.993 1 1.000 7 1.0 5.973 6.973
25525 T25525A|(ORF3a_protein:T133A(W45R)) 60 0.000 41 0.000 60 0.000 46 0.000 90114 0.917 46 0.000 6 0.917 0.0 0.917
25536 T25536A|(ORF3a_protein:T144A(V48V)) 28 0.000 28 0.000 48 0.000 42 0.000 90350 0.919 38 0.000 6 0.919 0.0 0.919
linkedubiq 25584 C25584T|(ORF3a_protein:C192T(T64T)) 153273 0.994 1 1.000 131906 0.995 207042 0.995 149514 0.995 99244 0.995 189062 0.994 1 1.000 8 0.995 6.973 7.968
25614 RATG13 C25614T|(ORF3a_protein:C222T(S74S)) 6 0.000 8 0.000 24 0.000 7 0.000 90403 0.920 20 0.000 6 0.92 0.0 0.92
25652 T25652A|(ORF3a_protein:T260A(F87Y)) 35 0.000 30 0.000 36 0.000 30 0.000 18977 0.193 20 0.000 6 0.193 0.0 0.193
linked 25698 A25698T|(ORF3a_protein:A306T(E102D)) 58 0.000 45 0.000 80 0.000 63 0.000 3546 0.034 118 0.001 6 0.034 0.001 0.035
25710 C25710T|(ORF3a_protein:C318T(L106L)) 3 0.000 3 0.000 9 0.000 9 0.000 93483 0.888 6 0.000 6 0.888 0.0 0.888
25909 G25909A|(ORF3a_protein:G517A(D173N)) 1 0.000 2 0.000 3659 0.474 2 0.001 4 0.474 0.001 0.475
25916 C25916A|(ORF3a_protein:C524A(T175K)) 1 0.000 3 0.001 14 0.001 1 0.000 3656 0.474 5 0.474 0.002 0.476
26058 C26058T|(ORF3a_protein:C666T(D222D)) 1 0.000 2 0.000 3 0.000 2 0.000 4751 0.315 4 0.000 6 0.315 0.0 0.315
26110 C26110T|(ORF3a_protein:C718T(P240S)) 1 0.000 3 0.000 4803 0.316 3 0.000 4 0.316 0.0 0.316
26147 C26147T|(ORF3a_protein:C755T(S252L)) 1 0.000 1 0.000 4740 0.312 6 0.000 4 0.312 0.0 0.312
26159 TTA26159-26161del|(ORF3a_protein:GTTAAT766-771GATdel(VN256-257Ddel)) 4797 0.316 1 0.316 0 0.316
26161 AATCCAGTAATGGAACCAATTTATG26161-26185del|(ORF3a_protein:769-793del(257fs)) 10320 0.680 1 0.68 0 0.68
26185 G26185T|(ORF3a_protein:G793T(D265Y)) 1 0.000 8 0.001 3 0.000 10 0.000 4782 0.315 21 0.001 6 0.315 0.002 0.317
26205 T26205C|(ORF3a_protein:T813C(T271T)) 3 0.001 5 0.000 8 0.000 8 0.000 15364 0.993 21 0.001 6 0.993 0.002 0.995
linkedubiq 26270 C26270T|(envelope_protein:C26T(T9I)) 5390 0.994 15460 0.995 18480 0.995 20636 0.995 14920 0.995 35499 0.994 6 0.995 4.973 5.968
26309 C26309T|(envelope_protein:C65T(A22V)) 1 0.000 14960 0.998 1 0.000 3 0.998 0.0 0.998
26311 T26311A|(envelope_protein:TTC67-69ATT(F23I)) 4640 0.309 1 0.309 0 0.309
26313 C26313A|(envelope_protein:C69A(F23L)) 2 0.000 8 0.001 5 0.000 9 0.000 10299 0.687 18 0.001 6 0.687 0.002 0.6890000000000001
26313 C26313T|(envelope_protein:TTC67-69ATT(F23I)) 4640 0.309 1 0.309 0 0.309
26337 A26337T|(envelope_protein:A93T(L31L)) 2 0.000 7 0.000 7 0.000 13 0.001 4644 0.310 13 0.000 6 0.31 0.001 0.311
26394 T26394C|(envelope_protein:T150C(S50S)) 3 0.000 14 0.000 6 0.000 17 0.000 9 0.000 41222 0.231 6 0.231 0.0 0.231
26416 G26416A|(envelope_protein:G172A(V58I)) 15 0.000 1 0.000 8 0.000 1 0.000 54488 0.304 5 0.304 0.0 0.304
26434 A26434G|(envelope_protein:A190G(N64D)) 5 0.000 12 0.000 1 0.000 15 0.000 6 0.000 41109 0.230 6 0.23 0.0 0.23
26441 A26441G|(envelope_protein:A197G(N66S)) 11 0.000 16 0.000 7 0.000 27 0.000 9 0.000 41155 0.230 6 0.23 0.0 0.23
26465 TGG26465-26467del|(envelope_protein:CTGGTC220-225CTCdel(LV74-75Ldel)) 41105 0.230 1 0.23 0 0.23
26466 G26466T|(envelope_protein:G222T(L74L)) 14 0.000 22 0.000 2 0.000 30 0.000 10 0.000 31072 0.174 6 0.174 0.0 0.174
26478 C26478T 2 0.000 3 0.000 3 0.000 2 0.000 30911 0.173 5 0.173 0.0 0.173
26485 TTATATTAG26485-26493del 23223 0.130 1 0.13 0 0.13
26485 TTATATTAGTTTTTCTGTTTGGAACTTTAATT26485-26516del 132711 0.742 1 0.742 0 0.742
26529 G26529A|(membrane_glycoprotein:GAT7-9AGT(D3S)) 23260 0.130 1 0.13 0 0.13
26530 A26530G|(membrane_glycoprotein:A8G(D3G)) 1 0.000 2 0.000 133067 0.744 3 0.744 0.0 0.744
26530 A26530G|(membrane_glycoprotein:GAT7-9AGT(D3S)) 23260 0.130 1 0.13 0 0.13
26533 C26533A|(membrane_glycoprotein:C11A(S4Y)) 9 0.000 23 0.000 8 0.000 35 0.000 16 0.000 133158 0.745 6 0.745 0.0 0.745
linkedubiq 26577 C26577G|(membrane_glycoprotein:C55G(Q19E)) 33675 0.991 81570 0.992 25135 0.992 108987 0.991 34977 0.991 179190 0.991 1 1.000 2 1.000 1 1.000 9 0.991 7.957 8.948
26605 T26605A|(membrane_glycoprotein:T83A(F28Y)) 18 0.001 14 0.000 13 0.001 61 0.001 15 0.000 40940 0.230 6 0.23 0.003 0.233
26681 C26681A|(membrane_glycoprotein:C159A(F53L)) 14 0.000 20 0.000 21 0.000 50 0.000 20 0.000 31434 0.110 12 0.000 30 0.001 8 0.11 0.001 0.111
linked 26702 A26702C|(membrane_glycoprotein:A180C(V60V)) 10 0.000 7 0.000 19 0.000 25 0.000 12 0.000 23235 0.081 17 0.001 4 0.000 8 0.081 0.001 0.082
linkedubiq 26709 G26709A|(membrane_glycoprotein:G187A(A63T)) 48321 0.996 82193 0.998 70553 0.994 162608 0.996 52624 0.996 279061 0.977 25593 0.990 45133 0.995 2 0.667 9 0.977 7.632 8.609
26730 G26730A|(membrane_glycoprotein:G208A(V70I)) 2 0.000 8 0.000 2 0.000 64105 0.592 1 0.000 5 0.592 0.0 0.592
26842 G26842A|(membrane_glycoprotein:G320A(R107H)) 1 0.000 4 0.000 3 0.000 3 0.000 31690 0.289 2 0.000 1 0.000 7 0.289 0.0 0.289
26873 C26873T|(membrane_glycoprotein:C351T(N117N)) 3 0.000 3 0.000 5 0.000 1 0.000 64638 0.590 2 0.000 2 0.000 7 0.59 0.0 0.59
26908 T26908A|(membrane_glycoprotein:T386A(L129Q)) 3 0.000 3 0.000 6 0.000 7 0.000 109251 0.998 6 0.000 3 0.000 7 0.998 0.0 0.998
26934 C26934A|(membrane_glycoprotein:C412A(L138I)) 4 0.000 3 0.000 7 0.000 2 0.000 109243 0.998 3 0.000 9 0.000 7 0.998 0.0 0.998
27056 T27056-27056del|(membrane_glycoprotein:534-534del(178fs)) 8 0.000 3 0.000 6 0.000 10 0.000 24651 0.430 3 0.000 2 0.000 7 0.43 0.0 0.43
27143 C27143A|(membrane_glycoprotein:C621A(N207K)) 235 0.002 87 0.002 117 0.002 197 0.002 32836 0.567 122 0.001 1085 0.005 7 0.567 0.014 0.581
27147 G27147A|(membrane_glycoprotein:G625A(D209N)) 22 0.000 6 0.000 11 0.000 11 0.000 32744 0.566 19 0.000 60 0.000 7 0.566 0.0 0.566
27188 G27188T|(membrane_glycoprotein:G666T(Q222H)) 107 0.001 18 0.000 55 0.001 83 0.001 31962 0.564 62 0.001 273 0.001 7 0.564 0.005 0.569
27247 C27247T|(ORF6_protein:C46T(L16L)) 5 0.000 4 0.000 11 0.000 14 0.000 56480 0.552 4 0.000 8 0.000 7 0.552 0.0 0.552
27253 ATTATGAGGACTTTTAAAGTTTCCA27253-27277del|(ORF6_protein:ATTATGAGGACTTTTAAAGTTTCCATTTGG52-81TTTdel(IMRTFKVSIW18-27Fdel)) 31741 0.310 1 0.31 0 0.31
linked 27259 A27259C|(ORF6_protein:A58C(R20R)) 165694 0.997 5 0.625 90615 0.998 117818 0.997 177159 0.997 70152 0.686 152186 0.997 264476 0.996 2 1.000 9 0.686 7.607 8.293000000000001
27281 GG27281-27282del|(ORF6_protein:ATTATGAGGACTTTTAAAGTTTCCATTTGG52-81TTTdel(IMRTFKVSIW18-27Fdel)) 31741 0.310 1 0.31 0 0.31
27290 ATT27290-27292del|(ORF6_protein:GATTAC88-93GACdel(DY30-31Ddel)) 31931 0.312 1 0.312 0 0.312
27305 T27305G|(ORF6_protein:T104G(L35R)) 4 0.000 11 0.000 22 0.000 19 0.000 56339 0.551 20 0.000 4 0.000 7 0.551 0.0 0.551
ubiq 27382 G27382C|(ORF6_protein:GAT181-183CTC(D61L)) 16052 0.996 2 1.000 44981 0.997 42675 0.997 52789 0.997 45818 0.997 68124 0.997 66657 0.997 2 0.667 9 0.997 7.648 8.645
ubiq 27383 A27383T|(ORF6_protein:GAT181-183CTC(D61L)) 16052 0.996 2 1.000 44981 0.997 42675 0.997 52789 0.997 45818 0.997 68124 0.997 66657 0.997 2 0.667 9 0.997 7.648 8.645
ubiq 27384 T27384C|(ORF6_protein:GAT181-183CTC(D61L)) 16052 0.996 2 1.000 44981 0.997 42675 0.997 52789 0.997 45818 0.997 68124 0.997 66657 0.997 2 0.667 9 0.997 7.648 8.645
27649 C27649T|(ORF7a_protein:C256T(L86L)) 7 0.000 3 0.000 5 0.000 2 0.000 71793 0.711 2 0.000 4 0.000 7 0.711 0.0 0.711
27752 Delta C27752T|(ORF7a_protein:C359T(T120I)) 9 0.000 13 0.000 15 0.000 4 0.000 59786 0.588 4 0.000 29 0.000 7 0.588 0.0 0.588
27770 A27770T|(ORF7b:A15T(S5S)) 48 0.000 52 0.000 77 0.001 32 0.000 59650 0.591 29 0.001 229 0.001 7 0.591 0.003 0.594
linkedubiq 27807 C27807T|(ORF7b:C52T(L18L)) 115709 0.995 125989 0.995 135452 0.995 79003 0.995 100419 0.995 45972 0.995 379109 0.997 5 1.000 8 0.995 6.9719999999999995 7.967
27915 G27915T|(ORF8_protein:G22T(G8*)) 68 0.000 30 0.000 55 0.000 51 0.000 11855 0.103 13 0.000 217 0.001 7 0.103 0.001 0.104
linkedubiq 28271 A28271T 210482 0.997 303295 0.997 181852 0.997 268465 0.997 192695 0.998 102537 0.996 158135 0.997 503912 0.998 14 1.000 9 0.996 7.981 8.977
28303 A28303G|(nucleocapsid_phosphoprotein:A30G(R10R)) 33 0.000 66 0.000 34 0.000 39 0.000 18 0.000 102583 0.997 25 0.000 35 0.000 8 0.997 0.0 0.997
28310 C28310T|(nucleocapsid_phosphoprotein:CCC37-39TTC(P13F)) 19 0.000 10 0.000 11 0.000 13 0.000 3 0.000 101977 0.991 10 0.000 6 0.000 8 0.991 0.0 0.991
28311 C28311T|(nucleocapsid_phosphoprotein:CCC37-39TTC(P13F)) 19 0.000 10 0.000 11 0.000 13 0.000 3 0.000 101977 0.991 10 0.000 6 0.000 8 0.991 0.0 0.991
linkedubiq 28362 GAGAACGCA28362-28370del|(nucleocapsid_phosphoprotein:GGAGAACGCAGT88-99GGTdel(GERS30-33Gdel)) 210184 0.997 303363 0.997 181519 0.998 268162 0.998 192055 0.997 102511 0.997 157914 0.998 503068 0.998 13 0.929 9 0.997 7.912 8.909
28382 RATG13 T28382C|(nucleocapsid_phosphoprotein:T109C(S37P)) 58 0.000 78 0.000 35 0.000 59 0.000 41 0.000 102564 0.997 32 0.000 46 0.000 8 0.997 0.0 0.997
28472 C28472T|(nucleocapsid_phosphoprotein:C199T(P67S)) 14 0.000 20 0.000 12 0.000 14 0.000 11 0.000 102444 0.998 8 0.000 18 0.000 8 0.998 0.0 0.998
28541 G28541T|(nucleocapsid_phosphoprotein:G268T(A90S)) 13 0.000 37 0.000 7 0.000 21 0.000 16 0.000 24357 0.250 22 0.000 59 0.000 358 0.000 9 0.25 0.0 0.25
28550 C28550T|(nucleocapsid_phosphoprotein:C277T(R93*)) 14 0.000 13 0.000 6 0.000 8 0.000 10 0.000 29007 0.298 13 0.000 4 0.000 36 0.000 9 0.298 0.0 0.298
linked 28603 RATG13 C28603T|(nucleocapsid_phosphoprotein:C330T(F110F)) 6 0.000 7 0.000 3 0.000 2 0.000 28990 0.297 29101 0.182 8 0.000 7 0.297 0.182 0.479
28882 G28882A|(nucleocapsid_phosphoprotein:G609A(R203R)) 26 0.000 7 0.000 10 0.000 22445 0.629 10 0.000 8 0.000 6 0.629 0.0 0.629
linkedubiq 28883 G28883C|(nucleocapsid_phosphoprotein:G610C(G204R)) 123246 0.997 64 1.000 47116 0.714 46918 0.997 39319 0.997 35588 0.997 45708 0.997 118200 0.998 1 1.000 9 0.997 7.7 8.697000000000001
29095 RATG13 C29095T|(nucleocapsid_phosphoprotein:C822T(F274F)) 20 0.000 7 0.000 4 0.000 2 0.000 22508 0.628 3 0.000 6 0.000 7 0.628 0.0 0.628
29218 C29218T|(nucleocapsid_phosphoprotein:C945T(F315F)) 46 0.000 13 0.000 12 0.000 16 0.000 108226 0.365 8 0.000 14 0.000 7 0.365 0.0 0.365
29363 C29363T|(nucleocapsid_phosphoprotein:C1090T(P364S)) 30 0.000 15 0.000 12 0.000 19 0.000 109274 0.362 8 0.000 44 0.000 7 0.362 0.0 0.362
linked 29510 A29510C|(nucleocapsid_phosphoprotein:A1237C(S413R)) 1008037 0.999 15 1.000 355329 0.999 249216 0.999 356200 0.999 135894 0.276 375275 0.999 1 1.000 935827 0.998 9 0.276 7.993 8.269
29524 T29524A|(nucleocapsid_phosphoprotein:T1251A(T417T)) 394 0.000 132 0.000 90 0.000 131 0.000 59662 0.121 120 0.000 195 0.000 7 0.121 0.0 0.121
29730 CACCGAGGCCACGCGGAGTACGATCGAGTGTACAGTG29730-29766del 59686 0.302 1 0.302 0 0.302
linked 29734 GAGGCCACGCGGAGTACGATCGAGTG29734-29759del 538838 0.998 5 1.000 209413 0.938 81685 0.998 107424 0.998 136575 0.691 232831 0.998 7 1.000 8 0.691 6.93 7.6209999999999996
29875 A29875C 2 0.500 1 0.5 0 0.5