TX-2 - Complete Raw Mutation Data

Full TSV data with all sample columns and abundance information
← Back to Dashboard

Complete Mutations Data

This table shows the complete data from the mutations.tsv file exactly as it appears in the source. Scroll horizontally to see all columns.

SRR34495487(4206130) SRR34495501(2654907) SRR34495603(3434375) SRR34495605(3145175) SRR34495606(4223426) SRR34495608(4037058) SRR34592166(7039763) SRR34592180(7232312)
"('2025-07-03', '115000')" "('2025-07-03', '115000')" "('2025-07-02', '539116')" "('2025-07-02', '529541')" "('2025-07-01', '2600000')" "('2025-07-01', '1000000')" "('2025-07-07', '120000')" "('2025-07-07', '200000')"
Sequences Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Count Abundance Total samples Positives Sum Negatives Sum Total Sum
2523 C2523T|(ORF1ab_polyprotein:C2258T(T753I))|(ORF1a_polyprotein:C2258T(T753I)) 1 0.000 2 0.000 54365 0.998 4 0.000 4 0.998 0.0 0.998
ubiq 3037 "RATG13,Delta" C3037T|(ORF1ab_polyprotein:C2772T(F924F))|(ORF1a_polyprotein:C2772T(F924F)) 3322 0.997 2630 0.997 1307 0.999 2909 0.995 12605 0.998 23492 0.997 20832 0.996 7 0.997 5.982 6.979
3335 GAAGTG3335-3340del|(ORF1ab_polyprotein:3070-3075del(EV1024-1025del))|(ORF1a_polyprotein:3070-3075del(EV1024-1025del)) 474 0.998 1 0.998 0 0.998
ubiq 9344 C9344T|(ORF1ab_polyprotein:C9079T(L3027F))|(ORF1a_polyprotein:C9079T(L3027F)) 53736 0.998 2496 0.999 31749 0.998 23519 0.998 1 1.000 114983 0.998 55928 0.998 7 1.0 5.989 6.989
ubiq 9424 A9424G|(ORF1ab_polyprotein:A9159G(V3053V))|(ORF1a_polyprotein:A9159G(V3053V)) 46635 0.998 25120 0.998 21287 0.998 1 1.000 114901 0.998 50203 0.998 6 1.0 4.99 5.99
ubiq 9534 C9534T|(ORF1ab_polyprotein:C9269T(T3090I))|(ORF1a_polyprotein:C9269T(T3090I)) 46628 0.998 25015 0.998 21204 0.998 1 1.000 114979 0.997 50162 0.998 6 1.0 4.989 5.989
9985 RATG13 C9985T|(ORF1ab_polyprotein:C9720T(D3240D))|(ORF1a_polyprotein:C9720T(D3240D)) 5108 0.998 1 0.998 0 0.998
10012 T10012A|(ORF1ab_polyprotein:T9747A(L3249L))|(ORF1a_polyprotein:T9747A(L3249L)) 7 0.001 2 0.001 1 0.001 6 0.002 5110 0.998 8 0.003 3 0.001 7 0.998 0.009000000000000000 1.007
10029 C10029T|(ORF1ab_polyprotein:ACC9763-9765ATT(T3255I))|(ORF1a_polyprotein:ACC9763-9765ATT(T3255I)) 5083 0.993 1 0.993 0 0.993
10030 C10030T|(ORF1ab_polyprotein:ACC9763-9765ATT(T3255I))|(ORF1a_polyprotein:ACC9763-9765ATT(T3255I)) 5083 0.993 1 0.993 0 0.993
10082 T10082A|(ORF1ab_polyprotein:T9817A(S3273T))|(ORF1a_polyprotein:T9817A(S3273T)) 13 0.001 2 0.001 2 0.001 6 0.002 5142 0.992 4 0.001 3 0.001 7 0.992 0.007 0.999
ubiq 10447 RATG13 G10447A|(ORF1ab_polyprotein:G10182A(R3394R))|(ORF1a_polyprotein:G10182A(R3394R)) 24460 0.998 13441 0.999 16468 0.999 38621 0.999 90134 0.998 5 0.998 3.995 4.993
ubiq 10449 C10449A|(ORF1ab_polyprotein:C10184A(P3395H))|(ORF1a_polyprotein:C10184A(P3395H)) 24460 0.998 13433 0.998 16458 0.998 38591 0.998 90073 0.998 5 0.998 3.992 4.99
ubiq 11288 TCTGGTTTT11288-11296del|(ORF1ab_polyprotein:11023-11031del(SGF3675-3677del))|(ORF1a_polyprotein:11023-11031del(SGF3675-3677del)) 20290 0.999 3116 0.999 5906 0.999 16363 0.999 43950 0.999 62162 0.999 50099 0.999 7 0.999 5.994 6.993000000000000
11522 T11522G|(ORF1ab_polyprotein:T11257G(F3753V))|(ORF1a_polyprotein:T11257G(F3753V)) 2 0.001 1 0.002 5 0.001 4 0.001 9168 0.998 5 0.998 0.005 1.003
11537 A11537G|(ORF1ab_polyprotein:A11272G(I3758V))|(ORF1a_polyprotein:A11272G(I3758V)) 9171 0.992 1 0.992 0 0.992
11830 A11830G|(ORF1ab_polyprotein:A11565G(V3855V))|(ORF1a_polyprotein:A11565G(V3855V)) 28 0.000 11 0.000 9 0.000 6918 0.761 22 0.000 5 0.761 0.0 0.761
11970 A11970C|(ORF1ab_polyprotein:A11705C(K3902T))|(ORF1a_polyprotein:A11705C(K3902T)) 97 0.000 35 0.000 31 0.000 1 0.500 204 0.001 5 0.5 0.001 0.501
11992 A11992T|(ORF1ab_polyprotein:A11727T(E3909D))|(ORF1a_polyprotein:A11727T(E3909D)) 61 0.000 25 0.000 27 0.000 1 0.500 80 0.000 5 0.5 0.0 0.5
12017 T12017G|(ORF1ab_polyprotein:T11752G(L3918V))|(ORF1a_polyprotein:T11752G(L3918V)) 45 0.000 21 0.000 15 0.000 1 1.000 50 0.000 5 1.0 0.0 1.0
12021 T12021G|(ORF1ab_polyprotein:T11756G(L3919R))|(ORF1a_polyprotein:T11756G(L3919R)) 24 0.000 12 0.000 4 0.000 1 1.000 34 0.000 5 1.0 0.0 1.0
12026 A12026C|(ORF1ab_polyprotein:A11761C(M3921L))|(ORF1a_polyprotein:A11761C(M3921L)) 147 0.000 79 0.001 44 0.000 1 1.000 200 0.001 5 1.0 0.002 1.002
14074 14074-insertGA|(ORF1ab_polyprotein:13810insertGA(4604fs)) 4 0.182 2 0.000 2 0.182 0.0 0.182
linkedubiq 14408 Delta C14408T|(ORF1ab_polyprotein:C14144T(P4715L)) 25095 0.999 37051 0.999 116113 0.999 55357 0.999 145622 0.999 86433 0.999 6 0.999 4.995 5.994
15656 C15656T|(ORF1ab_polyprotein:C15392T(T5131I)) 1 0.000 2 0.000 42506 0.999 2 0.000 4 0.999 0.0 0.999
16228 G16228C|(ORF1ab_polyprotein:G15964C(V5322L)) 2 0.000 2 0.000 1 0.000 4 0.000 1 1.000 6 0.000 6 1.0 0.0 1.0
16233 A16233C|(ORF1ab_polyprotein:A15969C(L5323F)) 11 0.000 2 0.000 3 0.000 7 0.000 10 0.000 1 1.000 23 0.000 7 1.0 0.0 1.0
16239 T16239A|(ORF1ab_polyprotein:T15975A(A5325A)) 2 0.000 4 0.000 1 0.000 4 0.000 1 1.000 4 0.000 6 1.0 0.0 1.0
16254 T16254A|(ORF1ab_polyprotein:T15990A(V5330V)) 18 0.000 12 0.000 9 0.000 5 0.000 15 0.000 1 1.000 21 0.000 7 1.0 0.0 1.0
16258 T16258A|(ORF1ab_polyprotein:T15994A(C5332S)) 5 0.000 1 0.000 5 0.000 7 0.000 1 1.000 11 0.000 6 1.0 0.0 1.0
16264 T16264A|(ORF1ab_polyprotein:T16000A(S5334T)) 27 0.000 18 0.000 7 0.000 11 0.000 22 0.000 1 1.000 36 0.000 7 1.0 0.0 1.0
16268 A16268C|(ORF1ab_polyprotein:A16004C(Q5335P)) 35 0.000 22 0.000 7 0.000 16 0.000 28 0.000 1 1.000 37 0.000 7 1.0 0.0 1.0
16294 A16294T|(ORF1ab_polyprotein:ATA16030-16032TTT(I5344F)) 6 0.000 1 0.000 1 0.000 1 1.000 3 0.000 5 1.0 0.0 1.0
16296 A16296T|(ORF1ab_polyprotein:ATA16030-16032TTT(I5344F)) 6 0.000 1 0.000 1 0.000 1 1.000 3 0.000 5 1.0 0.0 1.0
16298 G16298T|(ORF1ab_polyprotein:G16034T(R5345L)) 25 0.000 12 0.000 6 0.000 9 0.000 17 0.000 1 1.000 33 0.000 7 1.0 0.0 1.0
16300 A16300T|(ORF1ab_polyprotein:A16036T(R5346*)) 23 0.000 8 0.000 9 0.000 17 0.000 25 0.000 1 1.000 19 0.000 7 1.0 0.0 1.0
16303 C16303G|(ORF1ab_polyprotein:CCA16039-16041GAA(P5347E)) 1 1.000 1 1.0 0 1.0
16304 C16304A|(ORF1ab_polyprotein:CCA16039-16041GAA(P5347E)) 1 1.000 1 1.0 0 1.0
16313 G16313T|(ORF1ab_polyprotein:G16049T(C5350F)) 29 0.000 12 0.000 6 0.000 8 0.000 25 0.000 1 1.000 32 0.000 7 1.0 0.0 1.0
ubiq 18163 A18163G|(ORF1ab_polyprotein:A17899G(I5967V)) 13844 0.998 13007 0.999 18109 0.998 10390 0.998 1 1.000 13556 0.999 45506 0.999 42180 0.999 8 0.999 6.991 7.990000000000000
ubiq 18492 A18492G|(ORF1ab_polyprotein:A18228G(P6076P)) 62 0.939 2389 0.097 3697 0.999 2575 0.998 1 1.000 13571 0.999 26021 0.999 2 0.000 8 0.999 5.032 6.031
18858 T18858C|(ORF1ab_polyprotein:T18594C(D6198D)) 14 0.000 5 0.000 5 0.000 1 0.000 15 0.000 177200 0.441 9 0.000 43 0.000 8 0.441 0.0 0.441
18888 C18888T|(ORF1ab_polyprotein:C18624T(H6208H)) 3 0.000 3 0.000 6 0.000 176650 0.440 4 0.000 28 0.000 6 0.44 0.0 0.44
18978 A18978G|(ORF1ab_polyprotein:A18714G(Q6238Q)) 13 0.000 8 0.000 10 0.000 6 0.000 19 0.000 403076 0.999 17 0.000 86 0.000 8 0.999 0.0 0.999
20990 TG20990-20991del|(ORF1ab_polyprotein:20726-20727del(6909fs)) 1 1.000 1 1.0 0 1.0
21013 C21013A|(ORF1ab_polyprotein:C20749A(H6917N)) 26 0.000 10 0.000 27 0.000 17 0.000 26 0.000 2 0.118 41 0.000 7 0.118 0.0 0.118
linkedubiq 21137 A21137G|(ORF1ab_polyprotein:A20873G(K6958R)) 3 0.000 20979 0.184 12 0.000 146976 0.996 58 0.000 5 0.996 0.184 1.18
21357 T21357C|(ORF1ab_polyprotein:T21093C(N7031N)) 1 0.000 7 0.000 5 0.000 147110 0.998 10 0.000 5 0.998 0.0 0.998
21404 21404-insertT|(ORF1ab_polyprotein:21140insertT(7047fs)) 1 0.167 1 0.167 0 0.167
ubiq 22556 A22556G|(surface_glycoprotein:A994G(I332V)) 57460 0.997 15723 0.998 25985 0.997 7302 0.997 55821 0.998 55738 0.998 6 0.998 4.987 5.985
ubiq 22577 G22577C|(surface_glycoprotein:GGT1015-1017CAT(G339H)) 57412 0.997 15695 0.996 25976 0.997 7303 0.997 55735 0.996 55632 0.996 6 0.996 4.983 5.979000000000000
ubiq 22578 G22578A|(surface_glycoprotein:GGT1015-1017CAT(G339H)) 57412 0.997 15695 0.996 25976 0.997 7303 0.997 55735 0.996 55632 0.996 6 0.996 4.983 5.979000000000000
ubiq 22629 A22629C|(surface_glycoprotein:A1067C(K356T)) 57479 0.998 15723 0.998 26002 0.998 7302 0.998 55843 0.998 55723 0.997 6 0.998 4.989 5.987
ubiq 22674 C22674T|(surface_glycoprotein:C1112T(S371F)) 57814 0.995 15802 0.996 26129 0.995 7359 0.995 56109 0.995 56375 0.994 6 0.995 4.975 5.97
ubiq 22679 T22679C|(surface_glycoprotein:T1117C(S373P)) 57814 0.996 15777 0.995 26149 0.997 7370 0.997 56102 0.996 56369 0.995 6 0.996 4.98 5.976000000000000
ubiq 22686 C22686T|(surface_glycoprotein:C1124T(S375F)) 57530 0.996 15715 0.997 26040 0.997 7342 0.998 55566 0.997 55912 0.995 6 0.997 4.983 5.9800000000000000
ubiq 22688 A22688G|(surface_glycoprotein:A1126G(T376A)) 57412 0.996 15693 0.997 25979 0.996 7320 0.995 55453 0.996 55852 0.995 6 0.996 4.979 5.975
ubiq 22770 G22770A|(surface_glycoprotein:G1208A(R403K)) 57492 0.997 15694 0.997 26017 0.997 7315 0.997 55483 0.996 55953 0.997 6 0.996 4.985 5.981
22812 A22812C|(surface_glycoprotein:AAG1249-1251ACT(K417T)) 1 0.000 2 0.000 1 0.000 138890 0.713 3 0.000 5 0.713 0.0 0.713
22813 G22813T|(surface_glycoprotein:AAG1249-1251ACT(K417T)) 1 0.000 2 0.000 1 0.000 138890 0.713 3 0.000 5 0.713 0.0 0.713
linkedubiq 22882 T22882G|(surface_glycoprotein:T1320G(N440K)) 1095 0.997 151 1.000 378 1.000 161 1.000 138818 0.998 2808 0.999 33 1.000 7 0.998 5.996 6.994000000000000
22907 T22907A|(surface_glycoprotein:T1345A(Y449N)) 2 0.002 1 0.006 138923 0.999 3 0.999 0.008 1.007
linkedubiq 22992 G22992A|(surface_glycoprotein:G1430A(S477N)) 1093 1.000 150 1.000 379 1.000 162 1.000 139011 0.999 2828 0.999 36 1.000 7 0.999 5.999 6.998000000000000
linkedubiq 23008 TGT23008-23010del|(surface_glycoprotein:GGTGTT1444-1449GGTdel(GV482-483Gdel)) 1089 0.996 149 0.993 378 0.997 160 0.988 138749 0.997 2817 0.996 36 1.000 7 0.997 5.97 6.967
23040 A23040G|(surface_glycoprotein:A1478G(Q493R)) 138931 0.999 1 0.999 0 0.999
linkedubiq 23063 A23063T|(surface_glycoprotein:A1501T(N501Y)) 1093 1.000 150 1.000 378 0.997 161 0.994 138799 0.998 2812 0.998 36 1.000 7 0.998 5.989 6.987
23073 G23073A|(surface_glycoprotein:G1511A(G504D)) 1 0.001 138911 0.999 2 0.999 0.001 1.0
linkedubiq 23075 RATG13 T23075C|(surface_glycoprotein:T1513C(Y505H)) 1093 1.000 149 0.993 379 1.000 162 1.000 138925 0.999 2816 0.996 36 1.000 7 0.999 5.989 6.9880000000000000
ubiq 23222 G23222A|(surface_glycoprotein:G1660A(E554K)) 164354 0.997 52029 0.997 146322 0.998 98968 0.997 180956 0.998 371120 0.797 6 0.998 4.786 5.784
ubiq 23403 Delta A23403G|(surface_glycoprotein:A1841G(D614G)) 184990 0.999 65452 0.999 148567 0.999 104849 0.999 202631 0.999 477613 0.999 8909 0.996 7 0.999 5.991 6.990000000000000
23453 C23453G|(surface_glycoprotein:C1891G(P631A)) 3 0.000 1 0.000 1 0.000 21442 0.996 4 0.996 0.0 0.996
linkedubiq 23525 C23525T|(surface_glycoprotein:C1963T(H655Y)) 20506 0.999 13439 0.999 1854 1.000 5850 0.999 21469 0.999 12815 0.999 9012 0.999 7 0.999 5.995 6.994
linkedubiq 23599 T23599G|(surface_glycoprotein:T2037G(N679K)) 56984 0.548 22066 1.000 45121 0.999 56697 0.999 305139 0.999 124549 0.999 8726 1.000 7 0.999 5.545 6.544
23604 C23604A|(surface_glycoprotein:C2042A(P681H)) 9 0.000 1 0.000 1 0.000 2 0.000 285577 0.999 1 0.000 6 0.999 0.0 0.999
23609 C23609T|(surface_glycoprotein:C2047T(R683W)) 8 0.000 2 0.000 10 0.000 131581 0.460 4 0.000 5 0.46 0.0 0.46
23782 G23782A|(surface_glycoprotein:G2220A(M740I)) 4 0.000 2 0.000 4 0.000 131723 0.458 4 0.000 5 0.458 0.0 0.458
linkedubiq 23854 C23854A|(surface_glycoprotein:C2292A(N764K)) 98060 0.996 14647 0.996 43258 0.996 51534 0.997 285461 0.997 124643 0.997 6 0.997 4.982 5.979
23860 T23860-23860del|(surface_glycoprotein:2298-2298del(766fs)) 2 0.000 154157 0.538 2 0.000 3 0.538 0.0 0.538
23945 A23945T|(surface_glycoprotein:A2383T(K795*)) 1 0.000 1 0.000 1 0.000 3 0.200 4 0.2 0.0 0.2
linked 23948 G23948C|(surface_glycoprotein:G2386C(D796H)) 2 0.000 3 0.750 2 1.000 3 0.75 1.0 1.75
24241 A24241G|(surface_glycoprotein:A2679G(A893A)) 484 0.998 1 0.998 0 0.998
24416 G24416A|(surface_glycoprotein:G2854A(V952I)) 475 0.998 1 0.998 0 0.998
linkedubiq 24424 A24424T|(surface_glycoprotein:A2862T(Q954H)) 677 0.999 796 0.996 934 0.998 475 0.998 2435 0.999 5 0.998 3.992 4.99
24437 T24437A|(surface_glycoprotein:T2875A(L959I)) 476 1.000 1 1.0 0 1.0
linkedubiq 24469 T24469A|(surface_glycoprotein:T2907A(N969K)) 678 1.000 3 1.000 793 0.995 931 0.996 9 1.000 478 0.996 2436 0.993 7 0.996 5.984 6.98
linked 24503 C24503T|(surface_glycoprotein:C2941T(L981F)) 473 0.007 3 0.000 2 0.007 0.0 0.007
linkedubiq 25000 RATG13 C25000T|(surface_glycoprotein:C3438T(D1146D)) 37128 0.997 105579 0.997 8682 0.997 125257 0.996 165451 0.997 5 0.996 3.988 4.984
25067 A25067T|(surface_glycoprotein:A3505T(I1169F)) 12 0.000 29 0.000 1 0.000 125526 0.998 68 0.000 5 0.998 0.0 0.998
ubiq 25207 C25207T|(surface_glycoprotein:C3645T(Y1215Y)) 2079 0.994 872 0.997 2003 0.998 2964 0.997 7278 0.995 6204 0.996 6 0.995 4.982 5.977
ubiq 25352 G25352T|(surface_glycoprotein:G3790T(V1264L)) 1164 0.579 2 0.001 7370 0.999 5 0.001 4 0.999 0.581 1.58
25409 G25409A|(ORF3a_protein:G17A(R6K)) 3 0.000 1 0.000 209601 0.966 1 0.000 4 0.966 0.0 0.966
25420 RATG13 A25420C|(ORF3a_protein:A28C(I10L)) 2 0.000 2 0.000 3 0.000 3 0.000 209928 0.964 20 0.000 6 0.964 0.0 0.964
25535 T25535C|(ORF3a_protein:T143C(V48A)) 6 0.000 5 0.000 210202 0.999 7 0.000 4 0.999 0.0 0.999
linkedubiq 25584 C25584T|(ORF3a_protein:C192T(T64T)) 16312 0.998 63617 0.997 24863 0.998 19589 0.997 211318 0.997 158136 0.997 6 0.997 4.987 5.984
25710 C25710T|(ORF3a_protein:C318T(L106L)) 220061 0.967 1 0.000 2 0.967 0.0 0.967
25936 C25936G|(ORF3a_protein:C544G(H182D)) 1 0.001 10516 0.590 2 0.59 0.001 0.591
26013 C26013T|(ORF3a_protein:C621T(F207F)) 10533 0.591 1 0.591 0 0.591
26030 A26030T|(ORF3a_protein:A638T(Q213L)) 1 0.000 1 0.000 1 0.001 10521 0.591 4 0.000 5 0.591 0.001 0.592
26449 A26449G|(envelope_protein:A205G(R69G)) 1 0.000 2 0.000 57948 0.997 2 0.000 2 0.000 5 0.997 0.0 0.997
26526 G26526T|(membrane_glycoprotein:G4T(A2S)) 7 0.001 14 0.001 10 0.001 14 0.001 57981 0.999 51 0.001 5 0.000 7 0.999 0.005 1.004
26530 A26530G|(membrane_glycoprotein:A8G(D3G)) 57958 0.998 1 0.998 0 0.998
26533 C26533A|(membrane_glycoprotein:C11A(S4Y)) 6 0.000 4 0.000 7 0.000 6 0.000 57978 0.999 30 0.000 5 0.000 7 0.999 0.0 0.999
linkedubiq 26577 C26577G|(membrane_glycoprotein:C55G(Q19E)) 13332 0.997 13790 0.997 17148 0.997 27775 0.997 57502 0.998 71550 0.996 16226 0.997 7 0.998 5.981 6.979
linkedubiq 26709 G26709A|(membrane_glycoprotein:G187A(A63T)) 21557 0.998 14778 0.998 52413 0.997 47289 0.998 507684 0.996 151846 0.997 16259 0.999 7 0.996 5.987 6.9830000000000000
26873 C26873T|(membrane_glycoprotein:C351T(N117N)) 1422 0.040 245477 0.543 3 0.000 3 0.543 0.04 0.5830000000000000
26894 C26894T|(membrane_glycoprotein:C372T(L124L)) 245713 0.544 2 0.000 2 0.544 0.0 0.544
26908 T26908A|(membrane_glycoprotein:T386A(L129Q)) 1 0.000 245670 0.543 2 0.000 3 0.543 0.0 0.543
26934 C26934A|(membrane_glycoprotein:C412A(L138I)) 1 0.000 6 0.000 1 0.000 245684 0.544 16 0.000 5 0.544 0.0 0.544
26953 T26953C|(membrane_glycoprotein:T431C(I144T)) 5 0.000 245123 0.543 6 0.000 3 0.543 0.0 0.543
27050 T27050C|(membrane_glycoprotein:T528C(L176L)) 4 0.000 7 0.000 12 0.000 5 0.000 13 0.000 153215 0.989 2 0.000 7 0.989 0.0 0.989
27247 C27247G|(ORF6_protein:C46G(L16V)) 7 0.000 3 0.000 4 0.000 7 0.000 147240 0.900 2 0.000 6 0.9 0.0 0.9
linkedubiq 27259 A27259C|(ORF6_protein:A58C(R20R)) 117993 0.997 97252 0.997 130632 0.997 83103 0.997 256906 0.997 163125 0.997 106236 0.998 1 1.000 8 0.997 6.983 7.9800000000000000
linked 27278 T27278C|(ORF6_protein:T77C(I26T)) 13 0.000 3 0.000 10 0.000 5 0.000 15 0.000 14460 0.088 6 0.000 7 0.088 0.0 0.088
27281 G27281T|(ORF6_protein:G80T(W27L)) 58 0.000 87 0.001 108 0.001 79 0.001 245 0.001 147466 0.901 87 0.001 7 0.901 0.005 0.906
linked 27290 A27290C|(ORF6_protein:A89C(D30A)) 2 0.000 15924 0.097 1 0.000 3 0.097 0.0 0.097
27305 T27305G|(ORF6_protein:T104G(L35R)) 2 0.000 4 0.000 6 0.000 1 0.000 2 0.000 148613 0.909 6 0.000 7 0.909 0.0 0.909
27322 T27322C|(ORF6_protein:T121C(S41P)) 16 0.000 7 0.000 8 0.000 10 0.000 27 0.000 147389 0.901 4 0.000 7 0.901 0.0 0.901
27370 C27370T|(ORF6_protein:C169T(P57S)) 1 0.000 1 0.000 14494 0.997 3 0.000 4 0.997 0.0 0.997
linkedubiq 27382 G27382C|(ORF6_protein:GAT181-183CTC(D61L)) 57927 0.997 46633 0.998 40944 0.997 27453 0.998 49390 0.998 14488 0.997 73117 0.997 7 0.997 5.985 6.982
linkedubiq 27383 A27383T|(ORF6_protein:GAT181-183CTC(D61L)) 57927 0.997 46633 0.998 40944 0.997 27453 0.998 49390 0.998 14488 0.997 73117 0.997 7 0.997 5.985 6.982
linkedubiq 27384 T27384C|(ORF6_protein:GAT181-183CTC(D61L)) 57927 0.997 46633 0.998 40944 0.997 27453 0.998 49390 0.998 14488 0.997 73117 0.997 7 0.997 5.985 6.982
27445 T27445C|(ORF7a_protein:T52C(Y18H)) 2 0.000 8 0.000 2 0.000 2 0.000 14577 0.998 9 0.000 6 0.998 0.0 0.998
27530 T27530A|(ORF7a_protein:T137A(F46Y)) 6 0.000 1 0.000 1 0.000 1 0.000 14584 0.999 5 0.000 6 0.999 0.0 0.999
ubiq 27807 C27807T|(ORF7b:C52T(L18L)) 78843 0.998 88345 0.998 79097 0.998 43976 0.998 123823 0.998 45154 0.998 97467 0.998 7 0.998 5.9880000000000000 6.986
ubiq 27810 T27810C|(ORF7b:T55C(F19L)) 78821 0.998 88307 0.998 79047 0.998 43948 0.998 123746 0.998 45144 0.998 97405 0.997 7 0.998 5.987 6.985
28144 RATG13 T28144C|(ORF8_protein:T251C(L84S)) 5 0.000 5 0.000 3 0.000 1 1.000 2 0.000 6 0.000 6 1.0 0.0 1.0
28253 C28253-28253del|(ORF8_protein:TTCATC358-363TTATdel(FI120-121Ldel;fs)) 1 1.000 1 1.0 0 1.0
28256 C28256-28256del|(ORF8_protein:TTCATC358-363TTATdel(FI120-121Ldel;fs)) 1 1.000 1 1.0 0 1.0
28271 A28271C 11 0.000 3 0.000 9 0.000 9 0.000 27 0.000 1498 1.000 6 1.0 0.0 1.0
linkedubiq 28311 C28311T|(nucleocapsid_phosphoprotein:C38T(P13L)) 163690 0.998 106134 0.998 178150 0.999 83696 0.999 403685 0.998 1592 0.997 2 1.000 3 1.000 8 0.997 6.992 7.989
linked 28354 C28354A|(nucleocapsid_phosphoprotein:C81A(N27K)) 90 0.001 56 0.001 96 0.001 62 0.001 265 0.001 9 0.001 6 0.001 0.005 0.006
linkedubiq 28362 GAGAACGCA28362-28370del|(nucleocapsid_phosphoprotein:GGAGAACGCAGT88-99GGTdel(GERS30-33Gdel)) 163394 0.999 105753 0.999 177977 0.999 83429 0.999 215150 0.532 6988 0.997 1 0.500 2 1.000 8 0.997 6.0280000000000000 7.025
28382 RATG13 T28382C|(nucleocapsid_phosphoprotein:T109C(S37P)) 17 0.000 12 0.000 11 0.000 7 0.000 44 0.000 6968 0.994 6 0.994 0.0 0.994
linked 28405 T28405A|(nucleocapsid_phosphoprotein:T132A(G44G)) 35 0.000 18 0.000 39 0.000 11 0.000 83 0.000 16 0.002 6 0.002 0.0 0.002
linked 28417 T28417A|(nucleocapsid_phosphoprotein:T144A(N48K)) 1 0.000 2 0.000 1 0.000 1 0.000 4 0.000 1 0.000 6 0.0 0.0 0.0
28423 G28423A|(nucleocapsid_phosphoprotein:G150A(A50A)) 5 0.000 4 0.000 3 0.000 8 0.000 10 0.000 6982 0.996 6 0.996 0.0 0.996
28453 C28453T|(nucleocapsid_phosphoprotein:C180T(G60G)) 13 0.000 15 0.000 6 0.000 3 0.000 28 0.000 6984 0.998 6 0.998 0.0 0.998
linkedubiq 28472 C28472T|(nucleocapsid_phosphoprotein:C199T(P67S)) 4 0.000 3 0.000 5 0.000 3 0.000 18 0.000 6974 0.998 1 0.250 7 0.998 0.25 1.248
29158 A29158G|(nucleocapsid_phosphoprotein:A885G(G295G)) 3 0.000 4 0.000 8 0.000 2 0.000 11 0.000 6 0.750 14 0.000 60 0.001 8 0.75 0.001 0.751
linked 29510 A29510C|(nucleocapsid_phosphoprotein:A1237C(S413R)) 518924 0.999 321368 0.999 337412 0.999 286623 0.999 556197 0.999 285136 0.447 230919 0.999 1267492 0.999 8 0.447 6.993 7.44
29685 T29685C 19 0.000 6 0.000 16 0.000 13 0.000 15 0.000 141051 0.494 22 0.000 7 0.494 0.0 0.494
linkedubiq 29734 GAGGCCACGCGGAGTACGATCGAGTG29734-29759del 182257 0.999 118963 0.909 150189 0.999 138275 0.999 260057 0.999 285262 0.999 216097 0.999 7 0.999 5.904 6.903